Tobacco methylase gene with function of regulating tobacco nicotine content and application of tobacco methylase gene

Abstract

The invention belongs to the technical field of genetic engineering, and particularly relates to a tobacco methylase gene with a function of regulating and controlling nicotine content of tobacco and application of the tobacco methylase gene. The tobacco methylase gene is a NaDRM2-like2 gene, and the nucleotide sequence of the NaDRM2-like2 gene is as shown in SEQ ID: NO. 1, and the nucleotide sequence of the NaDRM2-like2 gene is as shown in SEQ ID: NO. The amino acid sequence coded by the NaDRM2-like2 gene is as shown in SEQ ID: NO. 2. The invention relates to a breeding method for knocking out genes related to tobacco nicotine regulation by using a CRSIPR / CAS9 system. The breeding method comprises the following steps: constructing a CRISPR / CAS9 carrier containing a NaDRM2-like2 gene; the CRISPR / CAS9 vector is subjected to agrobacterium tumefaciens transformation; and carrying out tobacco transformation. According to the invention, the tobacco methylase gene NaDRM2-like2 with the function of regulating and controlling the nicotine content of the tobacco is obtained from the tobacco, and a target gene is provided for regulating and controlling the nicotine content of the tobacco.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a tobacco methylase gene with the function of regulating nicotine content in tobacco and its application. Background Art

[0002] Nicotine is a characteristic alkaloid of cultivated tobacco, accounting for about 90% of the total alkaloid content. Nicotine is the material basis for smoking addiction. At present, the pathway of nicotine synthesis is basically clear, and multiple structural enzyme genes have been cloned, such as putrescine N-methyltransferase (PMT), etc. In recent years, great progress has also been made in the regulation research of nicotine synthesis. For example, it has been found that the synthesis of nicotine is regulated by two genetic loci, NIC1 and NIC2 . Among them NIC1 has a higher regulatory effect than NIC2 . NIC1 The locus is composed of the transcription factor gene ERF199, NIC2 The locus is composed of at least 7 ERF transcription factor genes, among which ERF189 is the main regulatory factor. In addition, plant hormones, such as auxin, jasmonic acid, ethylene, etc. have also been found to be involved in the regulation of nicotine synthesis, and the molecular mechanism of jasmonic acid regulating nicotine synthesis has been studied more thoroughly. For example, regulatory factors in the jasmonic acid signaling pathway, such as JAZ proteins, MYC2a, etc. are involved in regulating nicotine synthesis. MYC2a promotes the synthesis of nicotine and increases the nicotine content in tobacco leaves by binding to the G-BOX element in the promoter of the structural gene in the nicotine synthesis pathway and activating the expression of the structural gene.

[0003] There have been many reports on regulating the nicotine content in tobacco leaves by regulating gene expression. For example, overexpression of MYC2a etc. can significantly increase the nicotine content in tobacco leaves; reducing the expression of genes related to nicotine synthesis, such as QPT by RNA interference technology can significantly reduce the nicotine content in tobacco leaves. In recent years, genome editing technology has also been applied to regulate nicotine content. For example, knocking out the MYC2a gene to obtain tobacco with reduced nicotine content. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a tobacco methylase gene with the function of regulating nicotine content in tobacco and its application. The present invention obtains a tobacco methylase gene with the function of regulating nicotine content in tobacco NaDRM2-like2 , providing a target gene for regulating nicotine content in tobacco.

[0005] In order to achieve the above technical purpose, the present invention provides the following technical solutions: A tobacco methylase gene with the function of regulating nicotine content in tobacco, the tobacco methylase gene is the NaDRM2-like2 gene, theNaDRM2-like2 The nucleotide sequence of the gene is shown in SEQ ID: NO.1; the NaDRM2-like2 amino acid sequence encoded by the gene is shown in SEQ ID: NO.2.

[0006] Furthermore, NaDRM2-like2 gene knockout is achieved by CRISPR / Cas9 technology.

[0007] Use of a tobacco methylase gene with the function of regulating nicotine content in tobacco for reducing nicotine content in tobacco, the tobacco methylase gene is NaDRM2-like2 the gene, the NaDRM2-like2 nucleotide sequence of the gene is shown in SEQ ID: NO.1, the NaDRM2-like2 amino acid sequence encoded by the gene is shown in SEQ ID: NO.2, NaDRM2-like2 the nicotine content in the leaves of the edited material plants after gene knockout is significantly lower than that of the control plants.

[0008] A breeding method for knocking out genes related to nicotine regulation in tobacco using a CRSIPR / CAS9 system, the genes related to nicotine regulation in tobacco are the NaDRM2-like2 gene, and the method includes: (1) Construct a CRISPR / CAS9 vector containing the NaDRM2-like2 gene, and the constructed CRISPR / CAS9 vector is pHSE401-NaDRM2-like2; (2) Transform the CRISPR / CAS9 vector into Agrobacterium to obtain Agrobacterium containing the CRISPR / CAS9 vector; (3) Use the Agrobacterium obtained in step (2) for tobacco transformation, and the tobacco transformation includes the steps of germination of sterile seedlings, activation of Agrobacterium, infection, callus induction, maturation culture, rooting induction, acclimatization, transplanting to the greenhouse, and harvesting seeds; (4) Take the leaves of the T0 generation transgenic seedlings for sequencing to obtain NaDRM2-like2 the edited material with gene knockout. In the edited material, NaDRM2-like2 the nucleotide sequence of the mutant gene is shown in SEQ ID: NO.14; plant the T1 generation plants of the edited material, and screen for homozygous mutant single plants by sequencing and harvest the T2 generation seeds.

[0009] Furthermore, step (1) includes: (1.1) Design CRISPR / CAS9 target sites according to the NaDRM2-like2 gene sequence; (1.2) Synthesize target site primers according to the target sites designed in step (1.1); (1.3) Design detection primers for the editing material on both sides of the target site; (1.4) Prepare the target fragment; (1.5) Digest the pHSE401 vector with enzymes and ligate it with the target fragment prepared in step (1.4); (1.6) Transform the ligation product in step (1.5) into Escherichia coli, screen positive clones and perform sequencing verification.

[0010] Further, in step (1.1), design CRISPR / CAS9 target sites according to the gene NaDRM2-like2 sequence, including the first target site and the second target site; the nucleotide sequence of the first target site is shown in SEQ ID: NO.5; the nucleotide sequence of the second target site is shown in SEQ ID: NO.6.

[0011] Further, in step (1.2), the nucleotide sequences of the synthesized target site primers are shown in SEQ ID: NO.7, SEQ ID: NO.8, SEQ ID: NO.9, and SEQ ID: NO.10 respectively.

[0012] Further, in step (1.3), the detection primers for the editing material designed on both sides of the target site are: Upstream detection primer: 5’- TCTCGTTCCTCGATACCTTATGC -3’; Downstream detection primer: 5’- GCATCCAGCACCAAACCTTC -3’.

[0013] Further, the method further includes: planting T2 generation seeds in greenhouse pots, and selecting leaves to detect nicotine content at the rosette leaf stage.

[0014] A method for breeding tobacco using CRSIPR / CAS9 the system to knockout genes related to nicotine regulation in tobacco and its application in obtaining transgenic tobacco plants that regulate nicotine content in tobacco.

[0015] The beneficial effects of the present invention are: The present invention obtains a tobacco methylase gene with the function of regulating nicotine content in tobacco from tobacco NaDRM2- like2 , and uses CRISPR / CAS9 editing technology to NaDRM2-like2 perform gene editing, and obtains NaDRM2- like2 editing materials with gene knockout; and verifies that NaDRM2-like2 the gene has the function of regulating the accumulation of nicotine in tobacco leaves, providing a target gene for regulating nicotine content in tobacco. Description of the Drawings

[0016] Figure 1 For NaDRM2-like2 Comparison of nicotine content between gene-edited materials and control tobacco leaves; drm2-like2 is the edited material and WT is the control. Specific implementation manners

[0017] The technical solution of the present invention will be further described below in combination with specific embodiments and the accompanying drawings.

[0018] Example 1: This example provides a method for cloning a tobacco methyltransferase gene, and the tobacco methyltransferase gene is NaDRM2-like2 a gene, and the NaDRM2-like2 nucleotide sequence of the gene is shown as SEQ ID: NO.1. And the amino acid sequence encoded by the NaDRM2-like2 gene is shown as SEQ ID: NO.2.

[0019] The method for cloning the tobacco methyltransferase gene provided in this example includes the following steps: (1) Design primers according to the sequence of the tobacco methyltransferase gene NaDRM2-like2 : NaDRM2-like2 F: 5’- atggacaacaatctttctggag-3’ (SEQ ID: NO.3); NaDRM2-like2 R: 5’- tcatctggacgttattaacttc -3’ (SEQ ID: NO.4); (2) Extract RNA from tobacco root tissues and reverse transcribe to obtain the first-strand cDNA; (3) Use the first-strand cDNA obtained by reverse transcription as a template, and perform PCR amplification with primers NaDRM2-like2 F / R. After separation by agarose gel electrophoresis, the PCR products are recovered and purified; in this step, the reaction system for PCR amplification is a Phusion high-fidelity amplification enzyme reaction system with a total volume of 50 μL, including: 200 ng cDNA, 10 μL of 5×Phusion HF reaction buffer, 1 μL of 10 mM dNTP, 2 U of Phusion® High-Fidelity DNA Polymerase, 1 μL of each of the forward and reverse primers at 10 μM, and make up the volume to 50 μL with water.

[0020] And the reaction conditions for PCR amplification in this step are carried out on a Mastercycler® pro amplifier, and the reaction program is: 98°C, 30 seconds; 98°C, 7 seconds; 60°C, 30 seconds; 72°C, 60 seconds; 35 cycles; 72°C extension for 7 minutes; (4) The purified product is ligated to the vector. The ligation system and process are as follows: Mix 4 μL of the purified product, 1 μL of salt solution, and 1 μL of PCR®-BluntⅡ-TOPO (Invitrogen), and incubate at 25 °C in a water bath for 30 min; Transform the ligated vector into Escherichia coli DH5α by heat shock. After adding liquid LB medium and culturing with shaking, spread it onto an LB plate containing 100 mg / L kanamycin and culture overnight. Pick colonies for bacterial liquid culture, plasmid extraction, and PCR detection to screen for positive clones, and sequence the positive clones.

[0021] Example 2: Application of a tobacco methylase gene with the function of regulating nicotine content in reducing tobacco nicotine content. The tobacco methylase gene is NaDRM2-like2 a gene, and the NaDRM2-like2 nucleotide sequence of the gene is shown as SEQ ID: NO.1, and the NaDRM2-like2 amino acid sequence encoded by the gene is shown as SEQ ID: NO.2. NaDRM2-like2 The nicotine content in the leaves of the edited material plants after gene knockout is significantly lower than that of the control plants at the rosette leaf stage. NaDRM2-like2 Gene knockout is achieved by CRISPR / Cas9 editing technology.

[0022] Example 3: This example provides a breeding method for knocking out genes related to tobacco nicotine regulation using the CRSIPR / CAS9 system. The genes related to tobacco nicotine regulation are the NaDRM2-like2 genes cloned in Example 1. The method includes: (1) Construct a CRISPR / CAS9 vector containing the NaDRM2-like2 gene. The constructed CRISPR / CAS9 vector is pHSE401-NaDRM2-like2; (2) Transform the CRISPR / CAS9 vector into Agrobacterium to obtain Agrobacterium containing the CRISPR / CAS9 vector; (3) Use the Agrobacterium obtained in step (2) for tobacco transformation. The tobacco transformation includes steps such as germination of sterile seedlings, activation of Agrobacterium, infection, callus induction, maturation culture, rooting induction, acclimatization, transplanting to the greenhouse, and harvesting seeds; (4) Take the leaves of T0 generation transgenic seedlings for sequencing to obtain NaDRM2-like2 edited materials with gene knockout. In the edited materials, the NaDRM2-like2 nucleotide sequence of the mutant gene is shown as SEQ ID: NO.14; Plant the T1 generation plants of the edited materials, screen for homozygous mutant single plants by sequencing and harvest T2 generation seeds. And NaDRM2-like2The amino acid sequence of the mutated gene editing is shown in SEQ ID: NO. 15.

[0023] In this embodiment, step (1) includes: (1.1) Design CRISPR / CAS9 target sites (PAM) according to the NaDRM2-like2 gene sequence, including a first target site and a second target site; The nucleotide sequence of the first target site: GCACGGATTTAAGAACTACAGGG (SEQ ID: NO. 5); The nucleotide sequence of the second target site: GCATGCTGTTAGTTGTAACGGGG (SEQ ID: NO. 6); (1.2) Synthesize target site primers according to the target sites designed in step (1.1); the nucleotide sequences of the synthesized target site primers are shown in SEQ ID: NO. 7, SEQ ID: NO. 8, SEQ ID: NO. 9, and SEQ ID: NO. 10 respectively.

[0024] P1: 5’-TGCACGGATTTAAGAACTACAGTTTTAGAGCTAGAAATAGC-3’ (SEQ ID: NO. 7); P2: 5’- ATATATGGTCTCGATTGCACGGATTTAAGAACTACAGTT -3’ (SEQ ID: NO. 8); P3: 5’-AACCGTTACAACTAACAGCATGCAATCTCTTAGTCGACTCTAC-3’ (SEQ ID: NO. 9); P4: 5’- ATTATTGGTCTCGAAACCGTTACAACTAACAGCATGC-3’ (SEQ ID: NO. 10); (1.3) Design detection primers for the editing material on both sides of the target site; The detection primers for the editing material designed on both sides of the target site are: Upstream detection primer (NaDRM2-like2-SdF): 5’- TCTCGTTCCTCGATACCTTATGC -3’ (SEQ ID: NO. 11); Downstream detection primer (NaDRM2-like2-SdR): 5’- GCATCCAGCACCAAACCTTC -3’ (SEQ ID: NO. 12); (1.4) Prepare the target fragment; Using the primers designed and synthesized in step (1.2) and pUC57-DT1T2 as templates, a target fragment with a length of 626 bp was amplified; the nucleotide sequence of the target fragment is shown in SEQ ID: NO. 13; (1.5) Digest the pHSE401 vector with enzymes and ligate it with the target fragment prepared in step (1.4); Using Bsa BsaI enzyme and T4 DNA ligase were used to digest the pHSE401 vector and ligate it with the target fragment. The digestion system was 15 μL, including: 100 ng of plasmid, 15 ng of target fragment, 1.5 μL of 10×Cutsmart buffer, 1.5 μL of 10×T4 DNA ligase buffer, 10 U of BsaI enzyme, 35 U of T4 DNA ligase, and add sterile double-distilled water to 15 μL. Digest at 37°C for 1 h.

[0025] (1.6) Transform the ligation product in step (1.5) into Escherichia coli, screen for positive clones (the resistance of the pHSE401 vector is kanamycin resistance) and perform sequencing verification.

[0026] In this example, for the Agrobacterium transformation in step (2), specifically: Take out the Agrobacterium competent cells (LBA4404) from the -80°C refrigerator, add 4 μL of the vector pHSE401-NaDRM2-like2 after dissolving on ice; quickly freeze in liquid nitrogen for 1 minute, transfer to a 37°C water bath for 5 minutes, then ice-bath for 2 minutes, add 1 mL of LB liquid medium to the mixture, and culture at 28°C and 220 rpm for 3 - 4 hours; spread the culture on an LB solid medium containing 50 mg / L of kanamycin and 50 mg / L of rifampicin, and culture inverted at 28°C for 2 - 3 days to obtain Agrobacterium clones containing the target vector.

[0027] In this example, the tobacco transformation in step (3) specifically includes: (3.1) Germination of sterile seedlings: Treat Nicotiana attenuata seeds with 0.04 g of DCCS and 20 μL of 0.5% Tween for 5 min, then wash with sterile water 6 - 8 times. Add 40 μL of tobacco solution and 20 μL of GA3 and soak for 45 - 60 min, then wash with sterile water 6 - 8 times. Sow the seeds on GB5 medium, about 100 seeds per dish, and place them on the shelf in the tissue culture room (25°C, 16 h light, 8 h dark) for 8 - 10 days. At this time, the hypocotyl length is suitable for the infection experiment.

[0028] (3.2)Agrobacterium activation: Pick out the Agrobacterium clone containing the target vector and activate it with LB solid medium containing 50 mg / L kanamycin and 50 mg / L rifampicin. Incubate it in the dark in a constant temperature incubator at 28°C for 2 days. Then activate the strain once again with LB solid medium added with kanamycin (50 mg / L), and it can be used for the infection experiment after incubating in the dark for 2 days.

[0029] (3.3)Infection: Operate in a laminar flow hood. Add 2 mL of Agrobacterium washing solution (containing 4.41 g of MS medium, 30 g of sucrose, 1 mL of 6-BA (1 mg / ml), and 20 μL of IAA (1 mg / ml) in 1 L) to the culture dish of the activated strain, and gently wash down the Agrobacterium with a pipette and mix well. Take the sterile seedlings germinated for 9 days, and transfer the sterile seedlings to a sterile culture dish with forceps. Then cut off the hypocotyls of the sterile seedlings with a scalpel dipped in the bacterial solution, and the cut length is about 1 cm. Inoculate the cut hypocotyls into the co-culture medium (containing 4.41 g of MS medium, 30 g of sucrose, 4 g of Phytagel, 1 mL of 6-BA (1 mg / ml), and 20 μL of IAA (1 mg / ml) in 1 L), and inoculate 50 - 80 explants per dish. Incubate in the dark in a constant temperature incubator at 28°C for 3 days.

[0030] (3.4)Callus induction: Subculture the above materials into the callus induction medium (containing 4.41 g of MS medium, 30 g of sucrose, 4 g of Phytagel, 1 mL of 6-BA (1 mg / ml), 20 μL of IAA (1 mg / ml), 500 μL of hygromycin (50 mg / ml), 625 μL of Tim200 (200 mg / ml), and 1 mL of AgNO3 (2 mg / ml) in 1 L), and culture in a tissue culture room. Replace the medium every two weeks to ensure the effectiveness of the screening antibiotics. Bud tissue can be induced after culturing for 3 - 4 weeks.

[0031] (3.5)Maturation culture: Subculture the callus with young buds into the maturation medium (containing 4.41 g of MS medium, 30 g of sucrose, 4 g of Phytagel, 500 μL of hygromycin (50 mg / ml), and 625 μL of Tim200 (200 mg / ml) in 1 L), and continue to culture until the young buds grow to about 2 - 3 cm in height.

[0032] (3.6) Rooting induction: Excess callus tissue at the bottom of seedlings of appropriate age was removed and then inoculated into rooting medium (1L containing 1.1075g MS medium; 7g Agar; 10mL 100× KH2PO4 mother solution (25.5g KH2PO4 solid particles, 500ml pure water); 10mL MgSO4•7H2O (35.375g MgSO4•7H2O solid particles, 500ml pure water); 1mL FeSO4•7H2O (0.249g EDTA, 0.834g FeSO4•7H2O, 30ml pure water); 1mL CuSO4•5H2O (0.045g CuSO4•5H2O solid particles, 30ml pure water); 1mL vitamin mixture (niacin 0.025g, VB6 0.025g, VB1 0.005g, 100mL fixed volume) 2mL; IBA (1 mg / ml) 800μL), cultured under LED light, subcultured once a month until rooting.

[0033] (3.7) Hardening the seedlings: After the compressed soil block absorbs water and becomes moist, use tweezers to take out the rooted seedlings in the tissue culture bottle and plant them in the soil block. Be careful to remove the culture medium attached to the roots as much as possible. Then move the soil block to the tissue culture bottle, seal the bottle mouth with a rubber band, and place it in the tissue culture room for cultivation until lateral roots grow.

[0034] (3.8) Transplanting in greenhouse: Transplant the seedlings into seedling bags, cover with transparent plastic bags and place in a dark place to avoid direct sunlight. After 3 days of hardening, remove the plastic bags and wait for the plants to grow for a period of time before watering and fertilizing.

[0035] (3.9) Harvesting: Harvest seeds when the pods burst. Place the seeds in an EP tube filled with absorbent silica gel. The silica gel needs to be replaced every 7 days to ensure that the seeds are fully dried and ripened.

[0036] In this embodiment, step (4) specifically includes: taking leaves of T0 transgenic seedlings and extracting DNA using DNeasy Plant MiniKit (QIAGEN), amplifying and sequencing using the primers SdF / SdR designed in step (1.3). The sequencing results were analyzed to obtain a plant NaDRM2-like2 Gene knockout editing material. In the editing material, NaDRM2-like2 The nucleotide sequence of the mutant gene is shown in SEQ ID: NO.14; T1 generation plants of the edited material are planted, homozygous mutant plants are screened by sequencing and harvested to obtain T2 generation seeds.

[0037] Nicotine content detection of edited materials: The edited homozygous T2 material drm2-like2 and the control (WT) were planted in a greenhouse pot. During the rosette leaf stage, leaves were selected to detect nicotine content. The results are as follows Figure 1As shown, the results show that the nicotine contents (fresh weight) of drm2-like2 and the control (WT) are 207.52 µg / g and 319.75 µg / g respectively. The nicotine content of the edited material is significantly lower than that of the control, indicating that the knockout of the NaDRM2- like2 gene affects the accumulation of nicotine in tobacco leaves.

[0038] Finally, it should be noted that the above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those of ordinary skill in the art, they can still modify or deform and improve the aforementioned technical solutions, and these all fall within the protection scope of the present invention.

Claims

1. A tobacco methylase gene having the function of regulating the nicotine content of tobacco, characterized in that: The tobacco methylase gene is NaDRM2-like2 Gene, NaDRM2-like2 The nucleotide sequence of the gene is shown in SEQ ID: NO.1; NaDRM2-like2 The amino acid sequence encoded by the gene is shown in SEQ ID: NO.

2.

2. Use of a tobacco methylase gene having the function of regulating tobacco nicotine content in reducing tobacco nicotine content, characterized in that: The tobacco methylase gene is NaDRM2-like2 Gene, NaDRM2-like2 The nucleotide sequence of the gene is shown in SEQ ID: NO.

1. NaDRM2-like2 The amino acid sequence encoded by the gene is shown in SEQ ID: NO.

2. NaDRM2-like2 The nicotine content in the leaves of the gene-knockout edited material plants was significantly lower than that in the control plants.

3. The use of a tobacco methylase gene having the function of regulating tobacco nicotine content according to claim 2 in reducing tobacco nicotine content, characterized in that: NaDRM2-like2 Gene knockout is achieved through CRISPR / Cas9 editing technology.

4. A kind of utilization CRSIPR / CAS9 A breeding method for systematically knocking out tobacco nicotine regulation-related genes, characterized in that: The tobacco nicotine regulation-related gene is the gene described in claim 1 or 2 NaDRM2-like2 gene, the method comprising: (1) Construct the NaDRM2-like2 The CRISPR / CAS9 vector of the gene, the constructed CRISPR / CAS9 vector is pHSE401-NaDRM2-like2; (2) transforming the CRISPR / CAS9 vector into Agrobacterium to obtain Agrobacterium containing the CRISPR / CAS9 vector; (3) using the Agrobacterium obtained in step (2) to transform tobacco, wherein the tobacco transformation includes the steps of germination of sterile seedlings, activation of Agrobacterium, infection, callus induction, maturation culture, rooting induction, seedling hardening, greenhouse transplanting, and seed harvesting; (4) Take the leaves of T0 transgenic seedlings for sequencing and obtain NaDRM2-like2 A gene knockout editing material, wherein the editing material NaDRM2-like2 The nucleotide sequence of the mutant gene is shown in SEQ ID: NO.14; T1 generation plants of the edited material are planted, homozygous mutant plants are screened by sequencing and harvested to obtain T2 generation seeds.

5. A method according to claim 4 CRSIPR / CAS9 A breeding method for systematically knocking out tobacco nicotine regulation-related genes, characterized in that: Step (1) includes: (1.1) According to NaDRM2-like2 Gene sequence design of CRISPR / CAS9 target sites; (1.2) synthesizing target site primers according to the target site designed in step (1.1); (1.3) Designing detection primers for the edited material on both sides of the target site; (1.4) Preparation of target fragments; (1.5) digesting the pHSE401 vector and ligating it with the target fragment prepared in step (1.4); (1.6) Transform the ligation product in step (1.5) into Escherichia coli, screen the positive clones and verify by sequencing.

6. A method according to claim 5 CRSIPR / CAS9 A breeding method for systematically knocking out tobacco nicotine regulation-related genes, characterized in that: In step (1.1), according to the gene NaDRM2-like2 The sequence design of CRISPR / CAS9 target sites includes a first target site and a second target site; the nucleotide sequence of the first target site is shown in SEQ ID: NO.5; the nucleotide sequence of the second target site is shown in SEQ ID: NO.

6.

7. A method according to claim 5 CRSIPR / CAS9 A method for systematically knocking out genes related to tobacco nicotine regulation, characterized in that: In step (1.2), the nucleotide sequences of the synthesized target site primers are shown as SEQ ID: NO.7, SEQ ID: NO.8, SEQ ID: NO.9, and SEQ ID: NO.10, respectively.

8. A method according to claim 5 CRSIPR / CAS9 A breeding method for systematically knocking out tobacco nicotine regulation-related genes, characterized in that: In step (1.3), the detection primers for the edited material are designed on both sides of the target site as follows: Upstream detection primer: 5′- TCTCGTTCCTCGATACCTTATGC -3′; Downstream detection primer: 5'- GCATCCAGCACCAAACCTTC -3'.

9. A method according to claim 3 CRSIPR / CAS9 A breeding method for systematically knocking out tobacco nicotine regulation-related genes, characterized in that: The method further comprises: planting T2 generation seeds in a greenhouse potted plant, and selecting leaves to detect nicotine content during the rosette leaf stage.

10. A method of using according to any one of claims 3 to 9 CRSIPR / CAS9 The application of a breeding method for systematically knocking out tobacco nicotine regulation-related genes in obtaining transgenic tobacco plants with regulated tobacco nicotine content.

Images