Detection method of aedes albopictus drug resistance related gene mutation based on PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) technology
Through detection methods based on PCR-RFLP technology, the problem of complex and high cost of detecting mutations related to drug resistance of Aedes albopictus in the prior art is solved, and a rapid, accurate and economical detection effect is achieved.
Patent Information
- Application Number
- CN202510362981.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-26
- Publication Date
- 2025-06-10
AI Technical Summary
The prior art has problems such as high experimental equipment requirements, high cost and complex operation technology when detecting drug resistance-related gene mutations of Aedes albopictus, making it difficult to achieve simple, fast and efficient detection.
Using detection methods based on PCR-RFLP technology, the genomic DNA of Aedes albopictus was extracted, and PCR amplification and enzyme cleavage were performed using specific PCR primers and restriction enzymes, and subsequently electrophoretic detection was performed to distinguish different genotypes.
This method can quickly and accurately detect resistance mutations of Aedes albopictus, improve the accuracy and repeatability of the detection results, simplify the operation process, and reduce the experimental cost.
Smart Images

Figure CN120119005A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to molecular detection technology, and particularly to a method for detecting mutations in genes related to insecticide resistance of Aedes albopictus based on the PCR-RFLP technique. Background Art
[0002] Aedes albopictus (Skuse, 1894) is a major vector insect for various pathogens such as dengue virus, chikungunya virus, yellow fever virus, and Zika virus. Since there is currently a lack of widely effective treatment methods and vaccines, the use of insecticides to control the density of vector insects remains a key means of combating the spread of the above diseases. However, with the widespread application of insecticides, the Aedes albopictus population has shown varying degrees of resistance to a variety of insecticides, especially pyrethroids.
[0003] Genetic and molecular biology studies have shown that insecticide resistance is usually associated with a few genes and limited mutations in these genes. Among them, the voltage-gated sodium channel (VGSC), encoded by the VGSC gene, is the main target of pyrethroid insecticides. To date, three different site mutations related to insecticide resistance in the sodium channel of Aedes albopictus have been discovered: 1016V / G, 1532I / T, and F1534C / L / S.
[0004] Previous studies have shown that mutations at the 1016V / G, 1532I / T, and 1534F / S sites can cause Aedes albopictus to develop resistance to pyrethroid insecticides. Gene sequencing was initially used to detect whether there are mutations in genes related to pyrethroid resistance in Aedes albopictus. However, the gene sequencing method has limitations such as high requirements for experimental equipment, high costs, and professional operation techniques. Therefore, there is an urgent need to develop a simple, rapid, and efficient method for detecting resistance mutations.
[0005] Although there are currently allele-specific PCR (AS-PCR) or polymerase chain reaction-mass spectrometry (PCR-MS) methods for detecting VGSC gene mutations related to insecticide resistance, AS-PCR has the problem of low accuracy; the PCR-MS method requires expensive instruments, is complex to operate, and has high requirements for laboratory conditions and technical personnel. Summary of the Invention
[0006] In view of the above deficiencies, the present invention provides a method for detecting mutations in genes related to insecticide resistance of Aedes albopictus based on the PCR-RFLP technique, which can quickly detect resistance mutations in Aedes albopictus.
[0007] The method for detecting mutations in genes related to insecticide resistance of Aedes albopictus based on the PCR-RFLP technique comprises the following steps:
[0008] S1. Extract the genomic DNA of a single Aedes albopictus, and the genotype of the mutation site related to the resistance of the single Aedes albopictus is already known;
[0009] S2. Obtain the electrophoresis maps of 1016V / V, 1016V / G, 1016G / G, 1532I / I, 1532I / T, and 1532T / T respectively: First, perform a PCR amplification reaction, then digest the PCR amplification product, and perform electrophoresis detection on the digested product; the gene locus is the VGSC 1016 locus or the VGSC 1532 locus; the primers for PCR amplification of VGSC 1016 are SEQ ID NO:3 and SEQ ID NO:4, and the primers for amplification of VGSC1532 are SEQ ID NO:7 and SEQ ID NO:8;
[0010] S3. Establish a standard map: The electrophoresis maps of 1016V / V, 1016V / G, and 1016G / G are combined together to form a standard map of the VGSC 1016 locus; or the electrophoresis maps of 1532I / I, 1532I / T, and 1532T / T are combined together to form a standard map of the VGSC 1532 locus;
[0011] Among them, 1016V / V is the wild homozygous genotype, 1016V / G is the resistant heterozygous genotype, and 1016G / G is the resistant homozygous genotype; 1532I / I is the wild homozygous genotype, 1532I / T is the resistant heterozygous genotype, and 1532T / T is the resistant homozygous genotype.
[0012] Preferably, in S2, the restriction sites for the VGSC 1016 locus are SEQ ID NO:5 and SEQ ID NO:6, and the enzyme is BsaJI; the restriction sites for the VGSC 1532 locus are SEQ ID NO:09 and SEQ ID NO:10, and the enzyme is Bs1I.
[0013] Preferably, the reaction system for the amplification PCR reaction at the VGSC 1016 site is as follows: 2x Taq MasterMix, 22 μL; SEQ ID NO:3: 1 μL; SEQ ID NO:4: 1 μL; DNA extracted from S1 or Q1: 1 μL; The reaction conditions for the amplification PCR reaction are: 98 °C, 2 min, 1 cycle; 98 °C, 10 s, 56 °C, 12 s, 72 °C, 8 s, 37 cycles; 72 °C, 3 min, 1 cycle; 4 °C, ∞;
[0014] The reaction system for the amplification PCR reaction at the VGSC 1532 site is as follows: 2x Taq Master Mix, 22 μL; SEQID NO:07: 1 μL; SEQ ID NO:08: 1 μL; DNA extracted from S1 or Q1: 1 μL; The reaction conditions for the amplification PCR reaction are: 98 °C, 2 min, 1 cycle; 98 °C, 10 s, 57 °C, 12 s, 72 °C, 6 s, 37 cycles; 72 °C, 3 min, 1 cycle; 4 °C, ∞.
[0015] Preferably, the reaction system for the digestion of the VGSC 1016 site is 10X rCutSmart TM buffer, 2 μL; BsaJI, 1 μL; PCR product of S2 or Q2, 5 μL; ddH 2 O, 12 μL; The reaction conditions for the digestion are digestion at 60 °C for 2 hours; or
[0016] The reaction system for the digestion of the VGSC 1532 site is 10X rCutSmart TM buffer, 2 μL; Bs1I, 1 μL; PCR product of S2 or Q2, 5 μL; ddH 2 O, 12 μL; The reaction conditions for the digestion are digestion at 60 °C for 2 hours.
[0017] The present invention also provides the application of the method for detecting mutations related to insecticide resistance in Aedes albopictus based on the PCR-RFLP technique in the detection of insecticide resistance in Aedes albopictus.
[0018] The method for detecting mutations related to insecticide resistance in Aedes albopictus based on the PCR-RFLP technique is characterized by comprising the following steps:
[0019] Q1, extract the genomic DNA of a single Aedes albopictus to be detected;
[0020] Q2. Obtain the electrophoresis map of mutation sites related to the resistance of single Aedes albopictus to be detected: First, perform a PCR amplification reaction, then digest the PCR amplification product, and detect the digested product by electrophoresis; the gene loci are VGSC 1016 locus or VGSC 1532 locus; the primers for PCR amplification of VGSC 1016 are SEQ ID NO:3 and SEQ ID NO:4, and the primers for amplification of VGSC 1532 are SEQ ID NO:7 and SEQ ID NO:8;
[0021] Q3. Compare the electrophoresis map of mutation sites related to the resistance of single Aedes albopictus obtained in Q2 with the standard map of VGSC 1016 locus or VGSC 1532 locus in any one of claims 1-4 to determine whether it is a resistance mutation.
[0022] Preferably, in Q3, the discrimination method for VGSC 1016 locus is:
[0023] The part of the electrophoresis map of mutation sites related to the resistance of single Aedes albopictus to be detected that coincides with the standard map of VGSC 1016 locus is the genotype of mutation sites related to the resistance of the single Aedes albopictus to be detected. Whether it is a resistance mutation can be determined through this genotype. Among them, 1016V / V is the wild homozygous genotype, 1016V / G is the resistant heterozygous genotype, and 1016G / G is the resistant homozygous genotype.
[0024] Preferably, in Q3, the discrimination method for VGSC 1532 locus is:
[0025] The part of the electrophoresis map of mutation sites related to the resistance of single Aedes albopictus to be detected that coincides with the standard map of VGSC 1532 locus is the genotype of mutation sites related to the resistance of the single Aedes albopictus to be detected. Whether it is a resistance mutation can be determined through this genotype. Among them, 1532I / I is the wild homozygous genotype, 1532I / T is the resistant heterozygous genotype, and 1532T / T is the resistant homozygous genotype.
[0026] Beneficial effects:
[0027] 1. Through the cooperation of specific PCR primers and restriction endonucleases in the present invention (although PCR primers can be designed with the help of software, the actual effects of the designed PCR primers are uncertain. Therefore, how to obtain suitable PCR primers and there is only 1 restriction enzyme digestion site for the amplification product, and different genotypes can be distinguished after digestion has become a difficulty in the industry), the changes in the restriction enzyme digestion sites can be accurately recognized by the restriction endonuclease, thereby improving the accuracy of the detection results. The "PCR-restriction fragment length polymorphism (PCR-RFLP)" method is adopted to utilize the advantages of simplicity, economy, and high accuracy of PCR-RFLP to detect the pyrethroid resistance of Aedes albopictus.
[0028] 2. The PCR-RFLP of the present invention has the following advantages compared with traditional biological assays: (1) Shorter detection cycle: Compared with biological assays that usually require long-term observation and data analysis, the molecular detection method can complete resistance evaluation in a shorter time. (2) Simplicity and high throughput: The molecular detection technology does not rely on live mosquitoes, is easy to operate, and can efficiently process a large number of samples. (3) Accuracy: By methods such as PCR-RFLP, specific resistance mutation sites can be directly detected, avoiding errors caused by environmental factors or individual differences of mosquitoes in traditional biological assays. (4) Repeatability: The molecular detection method has strong repeatability and consistency, and can provide more reliable experimental data.
[0029] 3. Compared with other molecular detection methods for detecting Aedes albopictus resistance, the method of the present invention: (1) High specificity: The AS-PCR method relies on the matching of primers with specific mutation sites. The sensitivity and specificity of AS-PCR are affected by many factors such as sequence polymorphisms outside the mutation sites and PCR conditions, thus reducing the accuracy and repeatability of the detection results. (2) Simplicity and high efficiency: PCR-MS requires multiple PCR amplifications, digestion reactions, product extension, and mass spectrometry detection. The operation technology is complex and difficult, and has high requirements for the technical level of operators. In addition, the analysis of mass spectrometry data is also relatively complex and usually requires specialized software and a long processing time. (3) Economical and practical: The instrument requirements of the PCR-MS method are very high and the consumable costs are high. It is not suitable for the routine detection of a large number of samples, which becomes a bottleneck of this method. Description of the Drawings
[0030] Figure 1 Gel imaging diagram after amplification by primers P1 and P2 of the present invention;
[0031] Figure 2 Gel imaging diagram after amplification by primers P3 and P4 of the present invention;
[0032] Figure 3 Gel imaging diagram after cleavage by BsajI enzyme of the present invention;
[0033] Figure 4 Gel imaging diagram after amplification by primers P5 and P6 of the present invention;
[0034] Figure 5 Gel imaging diagram after cleavage by Bs1I enzyme of the present invention. Detailed Embodiments
[0035] The present invention will be further described below.
[0036] Aedes albopictus in the embodiments of the present invention are all collected from four counties and three districts of Guangyuan City.
[0037] Example 1: Method for Extracting Genomic DNA of Single Aedes albopictus
[0038] The extraction of genomic DNA of single Aedes albopictus includes the following steps:
[0039] (1) Place single Aedes albopictus (abdomen removed) in a 1.5 ml centrifuge tube (eppendorf tube), add 0.5 ml of lysis buffer (6.057 g 100 mM Tris, 1.4612 g 10 mM EDTA, 1.461 g 50 mM NaCl, 5 g 1% SDS, add H 2 O to 500 ml), grind to crush the insect body, place in a 60 °C water bath, and take out after 20 minutes.
[0040] (2) Add 75 μl of 8 M potassium acetate, mix well, and place on ice for 10 minutes.
[0041] (3) Centrifuge at 14000 g for 5 min, transfer 400 μl of the supernatant (avoid taking the precipitate) to a new centrifuge tube;
[0042] (4) Add 800 μl (2 times the volume of the supernatant) of 100% ice-cold ethanol to the supernatant, and let stand at room temperature for 10 min;
[0043] (5) Centrifuge at 14000 g for 10 minutes, discard the supernatant, and wash the precipitate with 0.5 ml of 70% ethanol;
[0044] (6) Centrifuge at 14000 g for 5 minutes, after the precipitate is dried, add 50 μl of water to redissolve.
[0045] The prepared DNA sample can be directly used for subsequent PCR, or the sample can be stored at 4 °C for later use, or stored long-term at -20 °C.
[0046] The following Examples 2 - 5 are for locus 1016, and Examples 6 - 8 are for locus 1532.
[0047] Example 2: Using Primers P1 and P2
[0048] (1) PCR Primers:
[0049] The primers are shown in Table 1:
[0050] Primer Serial Number Primer Sequence Sequence Name P1 GAACTTCACCGACTTCATGCA SEQ ID NO:01 P2 TTGTTCGTTTCGTTGTCGGC SEQ ID NO:02
[0051] Primer P1 is prepared with sterile water to 100 μM and diluted to 10 μM when used; primer P2 is prepared with sterile water to 100 μM and diluted to 10 μM when used.
[0052] (2) PCR Reaction Setup
[0053] PCR reaction system, containing:
[0054] 2x Ex Taq Master Mix (Tsingke Biological, TSE102), 22 μL;
[0055] Primer P1 (10 μM): 1 μL;
[0056] Primer P2 (10 μM): 1 μL;
[0057] DNA obtained according to the method of Example 1: 1 μL.
[0058] (3) PCR reaction procedure
[0059] 98 °C, 2 min, for 1 cycle;
[0060] 98 °C, 10 s, 56 °C, 12 s, 72 °C 8 s, for 37 cycles;
[0061] 72 °C, 3 min, for 1 cycle;
[0062] 4 °C, ∞.
[0063] After PCR reaction, PCR products are obtained.
[0064] (4) Electrophoresis detection of PCR products
[0065] Electrophorese the PCR products on a 2.0% agarose gel, set the voltage at 160 V, detect under ultraviolet light after 25 min of electrophoresis, and the amplified NDA fragment is 311 bp, as Figure 1 .
[0066] Example 3: Using primers P3 and P4
[0067] (1) PCR primers:
[0068] The primers are shown in Table 2:
[0069]
[0070] Primer P3 is prepared into 100 μM with sterile water and diluted to 10 μM during use; Primer P4 is prepared into 100 μM with sterile water and diluted to 10 μM during use.
[0071] (2) PCR reaction setup
[0072] PCR reaction system, containing:
[0073] 2x Taq Master Mix (Tsingke Biological, TSE102), 22 μL;
[0074] Primer P3 (10 μM): 1 μL;
[0075] Primer P4 (10 μM): 1 μL;
[0076] DNA obtained by the method of Example 1: 1 μL.
[0077] (3) PCR reaction procedure
[0078] 98 °C, 2 min, for 1 cycle;
[0079] 98 °C, 10 s, 56 °C, 12 s, 72 °C, 6 s, for 37 cycles;
[0080] 72 °C, 3 min, for 1 cycle;
[0081] 4 °C, ∞.
[0082] After the PCR reaction, the PCR product is obtained.
[0083] (4) Electrophoresis detection of the PCR product
[0084] Electrophorese the PCR product on a 2.0% agarose gel, set the voltage at 160 V, and detect it under ultraviolet light after 25 min of electrophoresis. The amplified DNA fragment is 341 bp, as Figure 2 .
[0085] Compare the amplification results of Example 2 and Example 3. The 2 samples in Example 2 did not obtain the target fragment, did not meet the requirements, and could not be used for PCR-RFLP detection at the 1016 locus. All samples in Example 3 obtained the target fragment and had good specificity and met the requirements. The following examples are based on Example 3.
[0086] Example 4
[0087] Enzyme digestion and electrophoresis detection of the PCR product
[0088] Restriction site:
[0089] 5′…C ▼ CAGGG…3′ (SEQ ID NO:5)
[0090] 3′…GGNNC ▲ C…5′ (SEQ ID NO:6)
[0091] Restriction reaction system, containing:
[0092] 10X rCutSmart TM Buffer (New England Biolabs, R0536S): 2 μL;
[0093] BsaJI (10 u / ul) (New England Biolabs, R0536S): 1 μL;
[0094] PCR product of Example 3: 5 μL;
[0095] ddH 2 O: 12 μL.
[0096] Digestion condition: Digest at 60 °C for 2 hours.
[0097] After the digestion reaction, a digested product is obtained.
[0098] 10 μL of the digested product is electrophoresed on a 2.0% agarose gel, the voltage is set at 160 V, and after electrophoresis for 25 min, it is detected under ultraviolet light.
[0099] At the 1016 site of Aedes albopictus VGSC, a valine (V) to glycine (G) mutation occurred. Among them, 1016V / V is the wild homozygous genotype, 1016V / G is the resistant heterozygous genotype, and 1016G / G is the resistant homozygous genotype.
[0100] After the amplification product of the 1016 site of Aedes albopictus VGSC is digested with the restriction enzyme BsajI, DNA fragments of different sizes are generated, which can effectively distinguish the genotypes of the 1016 site of Aedes albopictus VGSC. The BsajI enzyme can cut the gene sequence of the resistant mutation at the 1016 site. Therefore, after the digestion reaction, 1016V / G (resistant heterozygous genotype) generates 3 DNA fragments of 341 bp, 226 bp, and 115 bp, and 1016G / G (resistant homozygous genotype) generates 2 DNA fragments of 226 bp and 115 bp after the digestion reaction; the BsajI enzyme cannot cut the 1016V / V (wild homozygous genotype) gene sequence. Therefore, the wild genotype generates 1 DNA fragment of 341 bp after the digestion reaction, as Figure 3 , Figure 3 is the standard map of the VGSC 1016 site, which is composed of the gel imaging map after digestion of 1016V / G (resistant heterozygous genotype) with BsajI enzyme, the gel imaging map after digestion of 1016G / G (resistant homozygous genotype) with BsajI enzyme, and the gel imaging map after digestion of 1016V / V (wild homozygous genotype) with BsajI enzyme.
[0101] Therefore, primers P3 and P4 and the BsajI enzyme can be used for the molecular detection of the 1016 resistance mutation of Aedes albopictus VGSC.
[0102] Here it needs to be explained that Figures 1 - 3In the process of obtaining, after extracting genomic DNA by the method of Example 1, the genotype at locus 1016 of Aedes albopictus was confirmed (for example, by traditional bioassay).
[0103] Example 5
[0104] Take a single Aedes albopictus to be tested (genotype unknown), extract the single Aedes albopictus to be tested in the manner of Example 1, obtain the digestion products according to the methods of Example 3 and Example 4, obtain the electrophoresis pattern of the digestion products of the single Aedes albopictus to be tested, and compare the electrophoresis pattern of the digestion products of the single Aedes albopictus to be tested with Figure 3 Compare and discriminate.
[0105] If 341bp, 226bp and 115bp are detected, it is 1016V / G, the resistant heterozygous genotype;
[0106] If 226bp and 115bp are detected, it is 1016G / G, the resistant homozygous genotype;
[0107] If only 341bp is detected, it is 1016V / V, the wild homozygous genotype.
[0108] Example 6: Using primers P5 and P6
[0109] (1) PCR primers:
[0110] The primers are shown in Table 3:
[0111] Primer Serial Number Primer Sequence Sequence Name P5 CGATTCGCGAGACCAACAT SEQ ID NO:07 P6 TAGCTTTCAGCGGCTTCTTC SEQ ID NO:08
[0112] Primer P5 was prepared into 100 μM with sterile water and diluted to 10 μM when used; primer P6 was prepared into 100 μM with sterile water and diluted to 10 μM when used.
[0113] (2) PCR reaction settings
[0114] The PCR reaction system contains:
[0115] 2x Ex Taq Master Mix (Tsingke Biological, TSE102), 22 μL;
[0116] Primer P5 (10 μM): 1 μL;
[0117] Primer P6 (10 μM): 1 μL;
[0118] DNA obtained according to the method of Example 1: 1 μL.
[0119] (3) PCR reaction program
[0120] 98 °C, 2 min, for 1 cycle;
[0121] 98°C, 10 s, 57°C, 12 s, 72°C, 6 s, for 37 cycles;
[0122] 72°C, 3 min, for 1 cycle.
[0123] 4°C, ∞.
[0124] After the PCR reaction, the PCR product is obtained.
[0125] (4) Electrophoresis detection of the PCR product
[0126] The PCR product is electrophoresed on a 2.0% agarose gel, the voltage is set at 160 V, and after electrophoresis for 25 min, it is detected under ultraviolet light. The NDA fragment of the amplified PCR product is a 219 bp band, as Figure 4 .
[0127] Example 7
[0128] Restriction enzyme digestion and electrophoresis detection of the PCR product
[0129] Restriction enzyme cutting site:
[0130] BslI restriction enzyme cutting site 5′....CCNNNNN ▼ NNGG....3′(SEQ ID NO:09)
[0131] 3′....GGNN ▲ NNNNNCC....5′(SEQ ID NO:10)
[0132] The restriction enzyme digestion reaction system contains:
[0133] 10X rCutSmart TM Buffer (New England Biolabs, R0555S): 2 μL;
[0134] Bs1I (10 u / ul) (New England Biolabs, R0555S): 1 μL;
[0135] The PCR product of Example 6: 5 μL;
[0136] ddH 2 O: 12 μL.
[0137] Restriction enzyme digestion condition: Digest at 60°C for 2 hours.
[0138] After the restriction enzyme digestion reaction, the restriction enzyme digestion product is obtained.
[0139] 10 μL of the digested product was electrophoresed on a 2.0% agarose gel with the voltage set at 160 V. After 25 min of electrophoresis, it was detected under ultraviolet light.
[0140] A mutation from isoleucine (I) to threonine (T) occurred at position 1532 of the VGSC in Aedes albopictus. Among them, 1532I / I is the wild homozygous genotype, 1532I / T is the resistant heterozygous genotype, and 1532T / T is the resistant homozygous genotype.
[0141] After the amplified product of the VGSC 1532 site in Aedes albopictus was digested with the restriction enzyme Bs1I, DNA fragments of different sizes were generated, which could effectively distinguish the genotypes of the VGSC 1532 site in Aedes albopictus. The Bs1I enzyme can cut the gene sequence of the resistance mutation at position 1532. Therefore, after the enzyme digestion reaction of 1532I / T (resistant heterozygous genotype), three DNA fragments of 219 bp, 55 bp, and 164 bp were generated, but the 55 bp was too short to be easily observed by a conventional gel imaging instrument, so actually 219 bp and 164 bp were seen. After the enzyme digestion reaction of 1532T / T (resistant homozygous genotype), two DNA fragments of 55 bp and 164 bp were generated, but the 55 bp was too short to be easily observed by a conventional gel imaging instrument, so actually one DNA fragment of 164 bp was seen. The Bs1I enzyme cannot cut the wild homozygous type (1532I) gene sequence. Therefore, after the enzyme digestion reaction of 1532I / I (wild homozygous genotype), one DNA fragment of 219 bp was generated. As Figure 5 , Figure 5 Figure 0000332 is the standard map of the VGSC 1532 site, which is composed of the gel imaging map after enzyme digestion of 1532T / T (resistant homozygous genotype), the gel imaging map after enzyme digestion of 1532I / T (resistant heterozygous genotype), and the gel imaging map after enzyme digestion of 1532I / I (wild homozygous genotype).
[0142] Therefore, primers P5 and P6 and the Bs1I enzyme can be used for the molecular detection of the resistance mutation at the VGSC 1532 site in Aedes albopictus.
[0143] It should be noted here that Figures 4 - 5 in the process of obtaining, after using the method of Example 1 for genomic DNA, the genotype of the 1532 site in Aedes albopictus was confirmed (for example, it can be confirmed by traditional bioassay).
[0144] Example 8
[0145] Take a single Aedes albopictus to be detected (unknown genotype), extract the single Aedes albopictus to be detected in the manner of Example 1, obtain the digestion products according to the methods of Example 6 and Example 7, obtain the electrophoresis pattern of the digestion products of the single Aedes albopictus to be detected, and compare the electrophoresis pattern of the digestion products of the single Aedes albopictus to be detected with Figure 5 for comparison and discrimination.
[0146] If 219bp, 55bp and 164bp are detected (where 55bp is not easily observable), it is 1532I / T, the resistant heterozygous genotype;
[0147] If 55bp and 164bp are detected (where 55bp is not easily observable), it is 1532T / T, the resistant homozygous genotype;
[0148] If only 219bp is detected, it is 1532I / I, the wild homozygous genotype.
[0149] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A method for detecting mutations in genes related to insecticide resistance in Aedes albopictus based on PCR-RFLP technology, characterized in that: The following steps are involved: S1, extract genomic DNA from a single-headed Aedes albopictus mosquito, the genotype of the mutation site associated with resistance of the single-headed Aedes albopictus mosquito has been confirmed; S2, obtaining electrophoretic patterns of 1016V / V, 1016V / G, 1016G / G, 1532I / I, 1532I / T, and 1532T / T respectively: firstly performing PCR amplification reaction, then performing enzyme digestion on the PCR amplification product, and then performing electrophoresis detection on the enzyme digestion product; the gene locus is the VGSC 1016 locus or the VGSC 1532 locus; the primers for PCR amplification of VGSC 1016 are SEQ ID NO:3 and SEQ ID NO:4, and the primers for PCR amplification of VGSC 1532 are SEQ ID NO:7 and SEQ ID NO:8; S3, establishing a standard map: the electrophoretic maps of 1016V / V, 1016V / G, and 1016G / G are combined to form a VGSC 1016-site standard map; or the electrophoretic maps of 1532I / I, 1532I / T, and 1532T / T are combined to form a VGSC 1532-site standard map; Among them, 1016V / V is a wild homozygous genotype, 1016V / G is a resistant heterozygous genotype, and 1016G / G is a resistant homozygous genotype; 1532I / I is a wild homozygous genotype, 1532I / T is a resistant heterozygous genotype, and 1532T / T is a resistant homozygous genotype.
2. The method for detecting the mutation of the gene related to insecticide resistance of Aedes albopictus based on PCR-RFLP technology according to claim 1, characterized in that: In S2, the restriction sites of VGSC 1016 are SEQ ID NO: 5 and SEQ ID NO: 6, and the enzyme is BsaJI; the restriction sites of VGSC 1532 are SEQ ID NO: 09 and SEQ ID NO: 10, and the enzyme is Bs1I.
3. The method for detecting the mutation of the gene related to insecticide resistance of Aedes albopictus based on PCR-RFLP technology according to claim 2, characterized in that: The reaction system of the amplification PCR reaction of the VGSC 1016 site is: 2x Taq Master Mix, 22 μL; SEQ ID NO: 3: 1 μL; SEQ ID NO: 4: 1 μL; DNA extracted from S1 or Q1: 1 μL; the reaction conditions of the amplification PCR reaction are: 98°C, 2 min, 1 cycle; 98°C, 10 s, 56°C, 12 s, 72°C 8 s, 37 cycles; 72°C, 3 min, 1 cycle; 4°C, ∞; The reaction system of the PCR amplification reaction of the VGSC 1532 site is: 2x Taq Master Mix, 22 μL; SEQ ID NO:07: 1 μL; SEQ ID NO:08: 1 μL; DNA extracted from S1 or Q1: 1 μL; the reaction conditions of the PCR amplification reaction are: 98°C, 2 min, 1 cycle; 98°C, 10 s, 57°C, 12 s, 72°C, 6 s, 37 cycles; 72°C, 3 min, 1 cycle; 4°C, ∞.
4. The method for detecting the mutation of the gene related to insecticide resistance of Aedes albopictus based on PCR-RFLP technology according to claim 3, characterized in that: The reaction system for restriction digestion of the VGSC 1016 site is 10X rCutSmart TM Buffer, 2 μL; BsaJI, 1 μL; PCR product of S2 or Q2, 5 μL; ddH2O, 12 μL; the enzyme digestion reaction conditions are 60°C for 2 hours; or The reaction system for restriction digestion of the VGSC 1532 site is 10X rCutSmart TM Buffer, 2 μL; Bs1I, 1 μL; PCR product of S2 or Q2, 5 μL; ddH2O, 12 μL; the reaction conditions of the enzyme digestion are 60°C for 2 hours.
5. A method for detecting mutations in genes related to insecticide resistance in Aedes albopictus based on PCR-RFLP technology, characterized in that: The following steps are involved: Q1, extract the genomic DNA of the single-headed Aedes albopictus to be tested; Q2, obtaining an electrophoresis diagram of the mutation site associated with resistance of the single-headed Aedes albopictus to be detected: firstly perform PCR amplification reaction, then digest the PCR amplification product, and perform electrophoresis detection on the digestion product; the gene site is the VGSC 1016 site or the VGSC 1532 site; the primers for PCR amplification of VGSC1016 are SEQ ID NO:3 and SEQ ID NO:4, and the primers for PCR amplification of VGSC 1532 are SEQ ID NO:7 and SEQ ID NO:8; Q3, compare the electrophoresis pattern of the mutation site associated with resistance of the single-headed Aedes albopictus to be detected obtained in Q2 with the VGSC 1016 site standard map or the VGSC 1532 site standard map of any one of claims 1-4 to determine whether it is a resistance mutation.
6. The method for detecting the mutation of the gene related to insecticide resistance of Aedes albopictus based on PCR-RFLP technology according to claim 5, characterized in that: In Q3, the VGSC 1016 site discrimination method is: The electrophoresis diagram of the mutation site associated with resistance of the single-headed Aedes albopictus to be tested is consistent with the standard diagram of the VGSC 1016 site. The matching part is the genotype of the mutation site associated with resistance of the single-headed Aedes albopictus to be tested. The genotype can be used to determine whether it is a resistance mutation. Among them, 1016V / V is the wild homozygous genotype, 1016V / G is the resistance heterozygous genotype, and 1016G / G is the resistance homozygous genotype.
7. The method for detecting the mutation of the gene related to insecticide resistance of Aedes albopictus based on PCR-RFLP technology according to claim 5, characterized in that: In Q3, the VGSC 1532 site discrimination method is: The electrophoresis pattern of the mutation site associated with resistance of the single-headed Aedes albopictus to be tested is consistent with the VGSC 1532 site standard pattern. The matching part is the genotype of the mutation site associated with resistance of the single-headed Aedes albopictus to be tested. The genotype can be used to determine whether it is a resistance mutation. Among them, 1532I / I is a wild homozygous genotype, 1532I / T is a resistance heterozygous genotype, and 1532T / T is a resistance homozygous genotype.