SNP molecular marker combination for germplasm identification of phoxinus lagowskii and application of SNP molecular marker combination
Through simplified genome sequencing technology, specific SNP sites of the Rasstridium genus population were screened out and primers were designed for identification, which solved the problem that the existing technology was difficult to distinguish between the Taizihe population in Liaoning and the Sanhe population in Tianjin, and achieved the accurate identification of the Rasstridium genus germplasm resources.
Patent Information
- Application Number
- CN202510408932.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-02-27
- Filing Date
- 2025-04-02
- Publication Date
- 2025-06-10
AI Technical Summary
It is difficult to effectively identify the germplasm resources of Laseria germplasm resources in the prior art, especially in the distinction between the Taizihe group in Liaoning and the Taihe group in Tianjin.
Through simplified genome sequencing technology, the DNA sequence of Rassanthemum was screened and aligned, and specific SNP sites of the two populations were found, and corresponding primers and identification methods were designed.
The accurate and rapid identification of the Taizihe group in Liaoning and the Lashiki squid group in Tianjin has been achieved, and technical support is provided for germplasm resource monitoring and evaluation, group breeding and family identification.
Smart Images

Figure CN120119007A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of aquatic animal germplasm resource identification, and particularly relates to a SNP molecular marker combination for identifying Megalosoma lagomorpha germplasm and an application thereof. Background Art
[0002] The largemouth gudgeon (Psora larvae) is a small, commercial freshwater fish, highly sought after for its high nutritional and economic value. This fish is widely distributed across multiple waters, making identification of its diverse populations crucial. This not only has a profound impact on the monitoring and evaluation of its germplasm resources, but also plays an irreplaceable role in population selection and family identification.
[0003] Through advanced molecular identification techniques, we can accurately reveal the genetic differences and diversity between different populations of Lamarckian gudgeon, providing strong data support for the scientific management and protection of germplasm resources. This helps to promptly identify and respond to potential genetic risks, and also lays a solid foundation for the development of more precise germplasm resource protection strategies. At the same time, in the population breeding of Lamarckian gudgeon, molecular identification can screen out individuals or groups with excellent growth performance, disease resistance, and meat quality characteristics, thereby accelerating the breeding process of excellent varieties and injecting new vitality into the sustainable development of the aquaculture industry. In addition, family identification is also an indispensable part of Lamarckian gudgeon breeding. Through paternity testing technology, the pedigree relationship between parents and offspring can be accurately traced, effectively avoiding genetic problems caused by inbreeding, and further improving breeding efficiency and quality.
[0004] In summary, molecular identification of different populations of P. lamarckii is not only an important means to effectively monitor and evaluate its germplasm resources, but also the key to promoting the healthy development of its aquaculture industry. Summary of the Invention
[0005] The technical problem addressed by the present invention is to provide a combination of single-nucleotide polymorphism (SNP) molecular markers for identifying long-necked gudgeon (L. lagerstroemia) germplasm and its application. Using simplified genome sequencing technology, the present invention sequenced L. lagerstroemia from the Taizihe population in Liaoning and the Beihe population in Tianjin. By screening and comparing DNA sequences between the two populations, specific SNP sites were identified. Accordingly, primers and identification methods were proposed for germplasm identification, providing technical support for germplasm resource monitoring and evaluation, population selection, and family identification.
[0006] The technical solutions of the present invention are as follows:
[0007] The SNP molecular marker combination used for identification of L. lagerstroemia germplasm includes the loci listed in the following table:
[0008]
[0009]
[0010] The SNP molecular marker combination is used to identify the largemouth bass of Taizi River in Liaoning and the largemouth bass of Beihe River in Tianjin. When used, at least one site is used to identify the largemouth bass of Taizi River in Liaoning and the largemouth bass of Beihe River in Tianjin.
[0011] The PCR amplification primer pair combination of the SNP molecular marker combination for identification of the germplasm of the giant mullet comprises 4 pairs of primers as shown in the following table:
[0012]
[0013] The method for identifying the germplasm of Megalos lagellii using the PCR amplification primer pair combination comprises the following steps:
[0014] (1) extracting genomic DNA from the population of the tested giant mullet;
[0015] (2) using the genomic DNA of the tested population of P. lagerstroemia as a template to perform PCR amplification reaction;
[0016] (3) The genotype of the tested population of P. lamarckii was determined by Sanger sequencing analysis, and it was identified as the Taizi River population in Liaoning or the Beihe River population in Tianjin.
[0017] Preferably, the reaction system for PCR amplification is 5 μL of template DNA, 1 μL of upstream and downstream primers, 18 μL of H 2 O, and 25 μL of 2×Primer STAR Max Premix.
[0018] Preferably, the reaction procedure of the PCR amplification is pre-denaturation at 94°C for 7 min; denaturation at 94°C for 30 s, annealing at 63°C for 45 s, extension at 72°C for 30 s, 35 cycles; and extension at 72°C for 7 min.
[0019] When the SNP marker site of contig8071 was used for identification, the genotype of the site at 169bp in the Taizihe population of Liaoning was GG, while the genotype of the site in the Beihe population of Tianjin was CC.
[0020] When the three SNP molecular marker sites of contig56419 were used for identification, the genotype of the site in the Liaoning Taizihe population at 200bp was CC, and the genotype of the site in the Tianjin Beihe population was TT; the genotype of the site in the Liaoning Taizihe population at 206bp was CC, and the genotype of the site in the Tianjin Beihe population was TT; the genotype of the site in the Liaoning Taizihe population at 208bp was TT, and the genotype of the site in the Tianjin Beihe population was CC.
[0021] When the SNP marker site of contig97273 was used for identification, the genotype of the site at 217 bp in the Taizihe population of Liaoning was AA, while the genotype of the site in the Beihe population of Tianjin was TT.
[0022] When the SNP marker site of contig129277 was used for identification, the genotype of the site at 183bp in the Taizihe population of Liaoning was TT, while the genotype of the site in the Beihe population of Tianjin was GG.
[0023] Compared with the prior art, the present invention has the following beneficial effects:
[0024] This invention reports for the first time a combination of SNP molecular markers for identifying the germplasm resources of the Lamarckian gudgeon population. Using one of the SNP sites, accurate and rapid identification of the Lamarckian gudgeon of the Taizihe population in Liaoning and the Beihe population in Tianjin can be achieved, providing technical support for the monitoring and evaluation of the Lamarckian gudgeon germplasm resources, population breeding and family identification. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 This is a representative Sanger sequencing diagram of the present invention, which shows the sequence diagram of the three SNP marker sites of contig56419 of the individuals of the Taizihe population in Liaoning and the Beihe population in Tianjin. In the figure, B51-B60 are the Taizihe population in Liaoning, and the genotype at 200bp is CC; Y41-Y50 are the Beihe population in Tianjin, and the genotype at this site is TT; at 206bp, the genotype of the Taizihe population in Liaoning is CC, and the genotype of the Beihe population in Tianjin is TT; at 208bp, the genotype of the Taizihe population in Liaoning is TT, and the genotype of the Beihe population in Tianjin is CC;
[0026] Figure 2 This is a representative Sanger sequencing image of the present invention, a sequence diagram of the SNP marker site at 217bp of contig97273 of individuals of the Taizihe population in Liaoning and the Beihe population in Tianjin. In the figure, B51-B60 are from the Taizihe population in Liaoning, and the genotype at 217bp is AA, and Y41-Y50 are from the Beihe population in Tianjin, and the genotype at this site is TT;
[0027] Figure 3 This is a representative Sanger sequencing image of the present invention, a sequence diagram of the SNP marker site at 183bp of contig129277 of individuals of the Taizihe population in Liaoning and the Beihe population in Tianjin. In the figure, B51-B60 are from the Taizihe population in Liaoning, and the genotype at 183bp is TT, and Y41-Y50 are from the Beihe population in Tianjin, and the genotype at this site is GG;
[0028] Figure 4This is a representative Sanger sequencing diagram of the present invention, which is a sequence diagram of the SNP marker site at 169bp of contig8071 of the individuals of the Taizihe population in Liaoning and the Beihe population in Tianjin. In the figure, B51-B60 are the Taizihe population in Liaoning, and the genotype at 169bp is GG, and Y41-Y50 are the Beihe population in Tianjin, and the genotype at this site is CC. DETAILED DESCRIPTION
[0029] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0030] Example 1
[0031] In this example, the GBS technology was used to perform simplified genome sequencing on individuals of the Taizihe population in Liaoning and the Beihe population in Tianjin to obtain a large number of SNP sites. The intra-group consistency method was used for screening, that is, all samples in the group were recorded as having mutations, and SNP sites specific between the two populations were screened.
[0032] The specific implementation method of the present invention is as follows:
[0033] (1) Genomic DNA extraction and GBS library construction
[0034] DNA was extracted from 30 individuals of the Taizihe population in Liaoning and the Beihe population in Tianjin. Genomic DNA was double-digested with the restriction endonucleases PstI-HF and MspI. The digested products were then ligated with adapters using T4 DNA ligase at 22°C for 2 h. The ligated products were purified and recovered using 0.7 volumes of Sera-Mag beads to remove fragments less than 300 bp. The ligated products were amplified by PCR, and their concentrations were determined. DNA libraries were prepared from samples that passed the test with equal amounts and sequenced using the Illumina Novaseq PE150 sequencing platform.
[0035] (2) Quality control and SNP identification
[0036] The raw sequencing data (raw data) was stripped of adapters and filtered to remove sequences without restriction endonuclease recognition sites, sequences with an N content exceeding 8%, and low-quality reads. High-quality reads (HQReads) were generated for statistical analysis. The obtained GBS sequencing data (HQReads) were clustered and SNP typing was performed. The obtained SNP typing results were filtered to remove non-binary sites, sites with a MAF less than 0.01, and sites with a SNP typing missing rate greater than 20%, thereby obtaining the SNP typing results for the sample.
[0037] (3) Specific SNP site screening
[0038] The deletion-type SNP sites in the two populations were filtered and screened according to 100% consistency within the group, that is, all samples in the group were recorded as mutated, and finally the SNP sites specific between the two populations were screened.
[0039] (4) Primer design
[0040] The specific SNP sites obtained by screening were located on chromosomes to obtain a sequence containing these SNPs sites, which are SEQ ID NO.1-SEQ ID NO.4 in the present invention. Primers were designed using software such as Oligo for PCR amplification verification. The primer sequences are SEQ ID NO.5-SEQ ID NO.12, as shown in Table 1.
[0041] SEQ ID NO.1: contig8071
[0042] CCCCAGACGGGCATGGCGGGGAGCAACCAGAAAGTCATATCCAAGCCATTGTGTCCAAATGTACAGAGATCTGTGGCAAAGGTAACAGCTCACCGCTCATGCTCCAAAATCTGTCTAGTAAACATTTATCCTGCTGGNNNNNNNNNNTCTTTGAGATCTTTAACATTAAC(G)ACAGGCACCAAAGTTTACACTTTGAAAAC CTGCTCAGGTGTAGGAGAGACAAGGGCACGCCAAGCTGACGGTTTCATAGTAGAGTCTCTCGACGGCAACACTCTAGTGTCTGGCTTCCCACATTGATCGAGTGCAACATGCTCCCAGATGATCGATCTGAGATCCCGACA
[0043] The SNP molecular marker site on contig8071 is position 169 in SEQ ID NO.1, which is C or G.
[0044] SEQ ID NO.2:contig56419
[0045] GCAGCACTAGAGGCCGAGAGACGCCGCAAAGCTGCATTAGAGATCTTACTGCGCAACACAGAGCGCAGCAGAGACGAAGCTCTCACGCGCAATGAGCAGCTCAACAGAGAGATTCAGGAGTTCCTC AACAGACCCACTGGTGGACCATCTTAATGACGCCATCAAACAAAGTTCAAGCTCAGTCCTGTCTAGCTTCTCAC(T)AGGAGC(T)AT(C)AAGACGAGCTATCTGGACAACTACATTGTTTTTTAC ACCTTGAACTGCTGTGAATAATGTCTTCCGGAGACCCAGGTTCGAG ACCCGCTCAGAGCGGGGTGAGAAGGAC
[0046] The SNP molecular marker sites on contig56419 are position 200 in SEQ ID NO. 2, which is C or T; position 206, which is C or T; and position 208, which is C or T.
[0047] SEQ ID NO.3: contig97273
[0048] GGTTCCCCTGTCATGAGATCAGTGTCAACTGCACTCAATATAGTGACCCATCACAGTCCCACCAGAGTAAGCTGATGTGGGATCAGTGCCAGCATCCACTATCACAGAGGATGTACTGTATC TCTATATGAATGGACTGCAACCAGGCCAGCCTTTCTTCTCCTGGCCCACATTCCTTCTCTCCTCTGAAGACCATTAAGGATGTTCAGGGGTCAT(A)ATGAGAGACCTCGCTGTTTCCGGT
[0049] The SNP molecular marker site on contig97273 is position 217 in SEQ ID NO.3, which is A or T.
[0050] SEQ ID NO.4: contig129277
[0051] TATAAACAAGAGGAGCTGATCAACACCAGCATCTACAACATACTGCATGAGGAAGACCGAGAAGAATTGCATAAAAACTTGCCCAAAAGCAATGGTACGAACGCTACTGTATTCATCTAAAACAATGTGTNNNNNNNNNNTTTTC TGTATGTTTGTTAAGGTCCCAACAGTGTGTCGTGGGGG(T)GGTGATGCTTCCCGTCAGAAGAGTCACACGTTTAACTGCCGCATGCTGGTGAAGTTCGGCCATGGTGGTCCTGGAGGTGAAGAAGGGTCCGGCTCAGGAACAGC
[0052] The SNP molecular marker site on contig129277 is position 183 in SEQ ID NO.4, which is T or G.
[0053] Table 1 Primer sequences
[0054]
[0055] (5) PCR amplification
[0056] Reaction system: template DNA 5 μL, upstream and downstream primers 1 μL each, H2O 18 μL, 2× Primer STAR MaxPremix 25 μL;
[0057] Reaction procedure: pre-denaturation at 94°C for 7 min; denaturation at 94°C for 30 s, annealing at 63°C for 45 s, extension at 72°C for 30 s, 35 cycles; and extension at 72°C for 7 min.
[0058] (6) Result verification
[0059] When the three SNP marker sites of contig56419 were used for identification ( Figure 1 ), at 200bp, the genotype of this site in the Taizihe population of Liaoning was CC, and the genotype of this site in the Beihe population of Tianjin was TT; at 206bp, the genotype of this site in the Taizihe population of Liaoning was CC, and the genotype of this site in the Beihe population of Tianjin was TT; at 208bp, the genotype of this site in the Taizihe population of Liaoning was TT, and the genotype of this site in the Beihe population of Tianjin was CC.
[0060] When the SNP marker locus of contig97273 was used for identification ( Figure 2 ), the genotype of this site in the Taizihe population in Liaoning was AA at 217bp, while the genotype of this site in the Beihe population in Tianjin was TT.
[0061] When the SNP marker locus of contig129277 was used for identification ( Figure 3 ), the genotype of this site in the Taizihe population in Liaoning was TT at 183bp, while the genotype of this site in the Beihe population in Tianjin was GG.
[0062] When the SNP marker locus of contig8071 was used for identification ( Figure 4 ), the genotype of this site in the Taizihe population in Liaoning was GG, while the genotype of this site in the Beihe population in Tianjin was CC.
[0063] Any one site or multiple sites in the present invention can be used to accurately identify the Liaoning Taizi River population and the Tianjin Beihe River population of the bigmouthed grunt.
Claims
1. A SNP molecular marker combination for identification of L. lagerstroemia germplasm, characterized in that: The SNP molecular marker combination includes the sites shown in the following table:
2. Use of the SNP molecular marker combination according to claim 1 in identifying the population of Taizi River in Liaoning and the population of Beihe in Tianjin.
3. The PCR amplification primer pair combination of the SNP molecular marker combination for identification of L. lagerstroemia germplasm according to claim 1, characterized in that: Includes 4 pairs of primers as shown in the following table:
4. A method for identifying the germplasm of Myna ragwort using the PCR amplification primer pair combination according to claim 3, characterized in that: The following steps are involved: (1) extracting genomic DNA from the tested population of P. lamarckii; (2) using the genomic DNA of the tested population of P. lamarckii as a template to perform a PCR amplification reaction; (3) The genotype of the tested population of M. lamarckii was determined through sequencing analysis and identified as the Liaoning Taizihe population or the Tianjin Beihe population.
5. The method for identifying the germplasm of Pseudochelys lamarckii according to claim 4, wherein: The reaction system of the PCR amplification is 5 μL of template DNA, 1 μL of upstream and downstream primers, 18 μL of H2O, and 25 μL of 2×Primer STAR Max Premix.
6. The method for identifying the germplasm of Megalosoma lagomorpha according to claim 4, wherein: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 94° C. for 7 min; denaturation at 94° C. for 30 s, annealing at 63° C. for 45 s, extension at 72° C. for 30 s, 35 cycles; and extension at 72° C. for another 7 min.