SNP (Single Nucleotide Polymorphism) molecular marker closely linked with pepper fruit length as well as primer, kit, obtaining method and application of SNP molecular marker

By developing SNP molecular markers closely linked to the length of capsicum fruits, the genetic regulation problem of capsicum fruit length in the prior art has been solved, rapid identification and efficient breeding have been achieved, and breeding efficiency and accuracy have been improved.

CN120119022AActive Publication Date: 2025-06-10HUNAN AGRI UNIV

Patent Information

Application Number
CN202510321276.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-18
Publication Date
2025-06-10
Estimated Expiration
2045-03-18

AI Technical Summary

Technical Problem

The prior art is difficult to effectively solve the genetic regulation of capsicum fruit length, resulting in slow breeding process and high cost.

Method used

A SNP molecular marker closely linked to the length of capsicum fruit was developed, identified by single nucleotide polymorphism at base 4397410 of chromosome 3 of capsicum, and PCR amplification and typing were performed using primers and kits.

Benefits of technology

The rapid identification of capsicum fruit length is achieved, the breeding cycle is shortened, the selection efficiency and accuracy are improved, and the planting scale and post-evaluation workload are reduced.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120119022A_ABST
    Figure CN120119022A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of pepper breeding and molecular biology, and discloses an SNP (Single Nucleotide Polymorphism) molecular marker closely linked with pepper fruit length, which takes a camphor harbor as a reference, and a base C-to-A replacement occurs at a single nucleotide polymorphism at a 4397410 site base of a pepper No.3 chromosome. The invention further discloses an obtaining method of the SNP molecular marker closely linked with the length of the pepper fruit, a primer and a kit for identifying the SNP molecular marker closely linked with the length of the pepper fruit, and application of the primer and the kit in identification of different length types of the pepper fruit or molecular assisted breeding. The SNP molecular marker closely linked with the length of the pepper fruit is screened, the primer and the kit are developed for the molecular marker, the SNP molecular marker can be used for identifying the shape of the pepper fruit, then auxiliary breeding is carried out by depending on the molecular marker, the identification period is shortened, and the selection efficiency and accuracy are greatly improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the fields of pepper breeding and molecular biology, and particularly relates to an SNP molecular marker closely linked to pepper fruit length, primers, a kit, a obtaining method and applications thereof. Background Art

[0002] Capsicum annuum Capsicum annuum L.) is one of the important vegetable crops in the genus Capsicum of the Solanaceae family and is widely cultivated around the world. Capsicum annuum has the characteristics of strong adaptability, rich functions and varieties, a long industrial chain and high economic benefits, and has strong development potential and utilization value. The fruit development process is an important stage in plant growth and development and is also an important period for regulating fruit quality formation. Fruit development mainly includes fruit swelling and ripening. After pollination and fertilization of Capsicum annuum, the fruit begins to develop. First, the ovary wall tissue growth mainly based on cell division occurs, then cell division occurs for embryo and endosperm development, and finally it enters the fruit growth process mainly based on cell enlargement. The previous cell division provides a quantitative basis for the subsequent cell growth. The number and volume of cells determine the final size of fruit development. For Capsicum annuum with different fruit shapes, the cell size and number of its ovary before pollination, as well as the cells during pollination and fertilization, also show different degrees of division and swelling. At the same time, during the fruit ripening process, changes occur in the external phenotype and internal quality of the fruit. Fruit is the main edible part and product organ of most horticultural crops, and its main agronomic traits (such as fruit longitudinal diameter, fruit transverse diameter, single fruit weight and flesh thickness, etc.) are closely related to crop yield and commercial traits.

[0003] Molecular design breeding shows advantages at the crop seedling stage. Traditional plant breeding methods focus on screening based on the phenotypic characteristics of excellent individuals in the offspring segregation induced by hybridization. However, the long phenotypic evaluation cycle in this process greatly restricts its practical efficiency. Molecular design breeding can directly select target genes, thereby eliminating plants carrying unfavorable gene combinations at an early stage, significantly accelerating the breeding process and reducing costs. It has now become a frontier exploration direction in the field of crop breeding. In the practice of molecular design breeding, molecular markers closely related to target quantitative traits obtained by using molecular marker-assisted selection technology not only have high reliability, but also can be independent of the dominant and recessive effects of alleles and environmental conditions, thus enhancing the accuracy of selection and the overall efficiency of breeding. Therefore, deeply exploring the core genes regulating pepper fruit length and developing molecular markers related to pepper fruit length accordingly have far-reaching significance for revealing the genetic mechanism of pepper fruit shape regulation and promoting the molecular breeding process of pepper. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology, and provide an SNP molecular marker closely linked to the length of pepper fruits, as well as primers, kits, obtaining methods and applications thereof.

[0005] To solve the above technical problems, the technical solution proposed by the present invention is: An SNP molecular marker closely linked to the length of pepper fruits, with the Zhangshugang genome as a reference, a single nucleotide polymorphism at the 4,397,410th base of chromosome 3 of pepper, where a base substitution from C to A occurs.

[0006] As a general inventive concept, the present invention also provides primers for identifying the above-mentioned SNP molecular marker closely linked to the length of pepper fruits, including: Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTATCATGAAGAGATCAGAGGCAAAC-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTATCATGAAGAGATCAGAGGCAAAA-3'; Reverse primer: 5'- TTTCAGACATCCCCTTGAGAAAGT -3'.

[0007] For the above primers, preferably, the two forward primers are respectively linked to different fluorescent linker sequences: the linker sequence matching FAM fluorescence is GAAGGTGACCAAGTTCATGC, and the linker sequence matching HEX fluorescence is GAAGGTCGGAGTCAACGGAT.

[0008] As a general inventive concept, the present invention also provides a kit for identifying the above-mentioned SNP molecular marker closely linked to the length of pepper fruits, including the above primers.

[0009] As a general inventive concept, the present invention also provides an application of the above-mentioned molecular marker or the above-mentioned primers or the above-mentioned kit in identifying different length types of pepper fruits or molecular assisted breeding.

[0010] For the above application, preferably, the specific process of identifying different length types of pepper fruits includes: (1) Extract the DNA of the pepper to be tested as a template; (2) Perform PCR amplification on the DNA template using the above primers or the above kit; (3) Use KASP reagent to perform genotyping detection on the PCR amplification product, and use the LightCycler Application system to read the genotyping result.

[0011] For the above application, preferably, in step (3), if only the blue fluorescence corresponding to the forward primer 1 linked with the fluorescent adapter sequence is detected, it is determined that the pepper fruit is a homozygous single plant with short fruits, and the genotype is CC; if only the green fluorescence corresponding to the forward primer 2 linked with the fluorescent adapter sequence is detected, it is determined that the pepper fruit is a homozygous single plant with long fruits, and the genotype is AA; if the fluorescence signals corresponding to the forward primers 1 and 2 linked with the fluorescent adapter sequence are detected simultaneously, it is determined that the pepper fruit is a heterozygous single plant.

[0012] For the above application, preferably, in step (2), the PCR amplification program includes: Preincubation 94°C 900S; 94°C 20S, 78°C 10S, TD 62°C, 0 Cyc -> 57 (-0°C), 10 cycles; 94°C 20S, 57°C 60S, 35 cycles; Cooling 37°C 30S.

[0013] As a general inventive concept, the present invention also provides a method for obtaining an SNP molecular marker closely linked to the length of pepper fruits as described above, including the following steps: (1) Using the wild-type pepper LY0 as the male parent and the long-fruit mutant LY143 of pepper as the female parent, a cross between the two parental lines is made to construct an F 1 population, and the F 1 is self-crossed to construct an F 2 population; (2) Phenotypic identification of fruit length is carried out on the F 2 population. The bulked segregant analysis (BSA) method is used to obtain the wild-type pool and the long-fruit mutant pool respectively, and RNA-seq sequencing is carried out. After bioinformatics analysis of the sequencing results, the chromosomal region linked to the length of pepper fruits is obtained; (3) Molecular marker techniques are developed for single-base mutations in the candidate interval to narrow the candidate interval, and finally an SNP molecular marker closely linked to the fruit length is obtained.

[0014] Compared with the prior art, the beneficial effects of the present invention are: The present invention constructs an F 2A population was used, and candidate genes were screened by BSA-Seq analysis in the candidate interval. A SNP molecular marker was screened based on the base deletion of the candidate gene, and primers and kits were developed for this molecular marker, which can be used for the identification of pepper fruit shape. Furthermore, assisted breeding was carried out relying on this molecular marker, with the identification cycle shortened and the efficiency and accuracy of selection greatly improved. In addition, by identifying the plants at the early stage of pepper development, the planting scale of the plants and the workload of later identification were effectively reduced, and the influence degree of the environment was also reduced. The present invention has laid a certain foundation for the research on the regulation mechanism of pepper fruit shape and has important significance in promoting the breeding practice of pepper fruits. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 In the examples of the present invention, the phenotypes of the parents, F 1 and F 2 per individual plant; Figure 2 The BSA-seq mapping results of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0016] To facilitate the understanding of the present invention, the following will describe the present invention more comprehensively and meticulously in conjunction with the accompanying drawings of the specification and preferred embodiments, but the protection scope of the present invention is not limited to the following specific embodiments.

[0017] Unless otherwise defined, all the technical terms used hereinafter have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the protection scope of the present invention.

[0018] Unless otherwise specifically stated, all kinds of raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchase or can be prepared by existing methods.

[0019] Example 1: A method for obtaining a SNP molecular marker tightly linked to the length of pepper fruit is as follows: 1. Construction of the population Select the pepper wild type LY0 and the long fruit mutant LY143 as parents. After hybridization, an F 1 population is obtained, and after self-crossing, an F 2 segregating population is obtained, completing the F 1 , F 2 population.

[0020] 2. Phenotypic identification of fruit shape For each individual plant, three fruits at the green mature stage of the four-branch peppers are selected, photographed with a digital camera, and the length, width, and fruit shoulder width of the pepper fruits are measured with a vernier caliper, completing the above-mentioned F 1 , F2 Preliminary identification of the phenotypic traits of the fruit length of a group of peppers, such as Figure 1 shown. Among them, fruits with a measured length of 10 cm or more are long fruits, and those less than 10 cm are short fruits.

[0021] 3. BSA analysis of the fruit length gene According to the results of the fruit length trait investigation, 25 long-fruit and 25 short-fruit plants were selected from the F 2 population. Equal amounts of young and tender leaves of individuals were selected and mixed to construct two extreme pools. The DNA samples of the mixed pools were subjected to whole-genome resequencing, and the two parents were also resequenced. After sequencing, the relevant sequences and variation information were obtained by aligning to the Zhangshugang reference genome. Based on the statistical method SNP-index of the mixed pool segregation analysis, by comparing the differences in SNP allele frequencies in the two mixed pools (long-fruit pool and short-fruit pool), the genomic regions associated with the target traits were located; a threshold was set, and by calculating the difference in allele frequencies at the same SNP locus in the long-fruit pool and the short-fruit pool, Δ(SNP-Index) was obtained, and the SNP locus region significantly associated with the target traits could be intuitively obtained.

[0022] 4. Mapping of the fruit length gene As Figure 2 shown, after obtaining the target region significantly associated with the fruit length trait, we combined the variation information to develop KASP markers within the target region to further narrow down and precisely define the gene region. Through the joint analysis of the genotypes and phenotypes of the entire F 2 population plants using KASP markers, the candidate gene was finally mapped to an interval of approximately 573 kb on chromosome 3. To ensure the usability of the markers, we strictly screened the markers using the parents and F 1 previously. 5. Development of molecular markers linked to the fruit length gene All gene annotation information within the fine mapping interval was deeply analyzed and genes with functional relevance were screened out. Then, real-time fluorescence quantitative PCR technology was used to measure the expression levels of all genes within the fine mapping interval in the two parents, so as to determine the genes whose gene expression characteristics are associated with the traits. The sequence of this gene was further cloned, and through sequencing, it was found that the two SNP variations on this gene could clearly distinguish the parents and the F 1 genotypes. Finally, the variation at the 4397410th base (where a base C to A substitution occurred) was selected to genotype the individual plants of the F 2 population.

[0023] II. Application of SNP molecular markers tightly linked to pepper fruit length in identifying pepper fruit shape Using SNP molecular markers tightly linked to pepper fruit length for F2 Perform phenotypic identification on the fruit shapes of individual plants in the population, and the operation steps are as follows: (1)Extract the DNA of each individual plant in the F 2 population using the TransGen Biotech DNA Extraction Kit ① Weigh approximately 100 mg of fresh plant tissue ground in liquid nitrogen into a 1.5 ml sterile centrifuge tube. Place the centrifuge tube in a 65 °C water bath for 40 min, and gently invert it 3 times during this period; after the water bath, cool it at 4 °C for 2 min; ② Add 800 µL of lysis buffer LB 49 and 40 µL of RNase A and mix well. Incubate in a 65 °C water bath for 15 min; ③ Add 200 µL of solution PB 49, vortex thoroughly, and centrifuge at 12,000 rpm for 5 min; transfer 700 µL of the supernatant to Filtration Columns with Collection Tubes, and then centrifuge at 12,000 rpm for 2 min, collecting the filtrate into a 2 ml collection tube.

[0024] ④ Add 700 µL of absolute ethanol to the above 2 ml collection tube and mix by inverting up and down. At this time, flocculent precipitates may appear.

[0025] ⑤ Pipette all of the above mixture and add it to the Genomic Spin Column with Collection Tubes in two portions, 700 µL each time, and centrifuge at 12,000 rpm for 60 min, discarding the effluent.

[0026] ⑥ Add 500 µL of solution CB 49 and centrifuge at 12,000 rpm for 30 s, discarding the effluent (check whether absolute ethanol has been added before using CB 9).

[0027] ⑦ Add 500 µL of solution WB 49 and centrifuge at 12,000 rpm for 30 s, discarding the effluent (check whether absolute ethanol has been added before using WB 49).

[0028] ⑧ Repeat step ⑦.

[0029] ⑨ Centrifuge at 12,000 rpm for 2 min to completely remove the residual WB 49. Place the adsorption column in a new 1.5 ml sterile centrifuge tube and dry it in a 65 °C metal bath for 3 min or air-dry it at room temperature for 5 min.

[0030] ⑩ Add 100 µL of EB (preheated at 60 °C - 70 °C) or deionized water (pH > 7.0) to the center of the adsorption column, let it stand at room temperature for 5 min, centrifuge at 12,000 rpm for 1 min to elute the DNA. Take the DNA for electrophoresis detection. Use a micro-spectrophotometer to measure the DNA concentration and the ratios of 260 / 280 and 260 / 230. Store it at -20 °C for future use to prevent degradation.

[0031] (2)Use KASP molecular markers to identify the genotypes of each individual plant in the F 2 population ① The primer design sequences are as follows (shown in SEQ ID NO.1 - 3 respectively): Forward primer 1: 5'-GAAGGTGACCAAGTTCATGCTATCATGAAGAGATCAGAGGCAAAC-3'; Forward primer 2: 5'-GAAGGTCGGAGTCAACGGATTATCATGAAGAGATCAGAGGCAAAA-3'; Reverse primer: 5'- TTTCAGACATCCCCTTGAGAAAGT -3'.

[0032] The two forward primers are respectively linked with different fluorescent adapter sequences. The adapter sequence matching FAM fluorescence is GAAGGTGACCAAGTTCATGC, and the adapter sequence matching HEX fluorescence is GAAGGTCGGAGTCAACGGAT. Judge the genotype according to the fluorescence signal. If it is a homozygous genotype, only one fluorescence signal will be produced, and if it is a heterozygous genotype, a mixed fluorescence signal will be produced.

[0033] ② Genotyping reaction system: The total volume is 10 µL, and the specific components are as follows: 5 µL of 2× PARMS reagent, 0.15 µL each of forward primer 1 and 2, 0.4 µL of reverse primer, and 10 - 100 ng of DNA template (supplemented with ultrapure water to 10 µL).

[0034] ③ Genotyping amplification program: Preincubation 94 °C 900S; 94 °C 20S, 78 °C 10S, TD 62 °C, 0 Cyc -> 57 (-0 °C), 10 cycles; 94 °C 20S, 57 °C 60S, 35 cycles; Cooling 37 °C 30S.

[0035] (3) Genotyping results: If only the blue fluorescence corresponding to the forward primer 1 ligated with the fluorescent adapter sequence is detected in the test, the pepper fruit is determined to be a homozygous single plant with short fruits, and its genotype is CC. If only the green fluorescence corresponding to the forward primer 2 ligated with the fluorescent adapter sequence is detected, the pepper fruit is determined to be a homozygous single plant with long fruits, and its genotype is AA. If the yellow fluorescence signals corresponding to both the forward primer 1 and 2 ligated with the fluorescent adapter sequence are detected simultaneously, the pepper fruit is determined to be a heterozygous single plant with short fruits.

[0036] As shown in Table 1, F 2 The coincidence rate between the phenotypes of randomly tested single plants in the population and the genotyping results reached 100%.

[0037] Table 1 Molecular marker results and fruit phenotypes of parents, F 1 and some F 2 population single plants

[0038] III. Application of SNP molecular markers tightly linked to pepper fruit length in molecular assisted breeding Select the plants with the above-mentioned target fruit length, cross them with other pepper plants, and continue to screen for pepper plants with the target fruit length in the hybrid offspring using the above method to obtain new pepper plant lines.

Claims

1. A SNP molecular marker tightly linked to pepper fruit length, characterized in that: Taking the Zhangshugang genome as a reference, a single nucleotide polymorphism at base 4397410 on pepper chromosome 3 occurred, where a substitution from base C to A occurred.

2. A primer for identifying the SNP molecular marker tightly linked to pepper fruit length as claimed in claim 1, characterized in that: include: Forward primer 1: 5′-GAAGGTGACCAAGTTCATGCTATCATGAAGAGATCAGAGGCAAAC-3′; Forward primer 2: 5′-GAAGGTCGGAGTCAACGGATTATCATGAAGAGATCAGAGGCAAAA-3′; Reverse primer: 5′-TTTCAGACATCCCCTTGAGAAAGT-3′.

3. The primer according to claim 2, characterized in that The two forward primers were connected to different fluorescent linker sequences: the linker sequence matching the FAM fluorescence was GAAGGTGACCAAGTTCATGC, and the linker sequence matching the HEX fluorescence was GAAGGTCGGAGTCAACGGAT.

4. A kit for identifying the SNP molecular marker tightly linked to pepper fruit length as claimed in claim 1, characterized in that: Comprising the primers as claimed in claim 2 or 3.

5. Use of the molecular marker according to claim 1, the primer according to claim 2 or 3, or the kit according to claim 4 in identifying different length types of pepper fruits or in molecular-assisted breeding.

6. The use according to claim 5, characterized in that The specific process of identifying different length types of pepper fruit includes: (1) Extract the DNA of the pepper to be tested as a template; (2) using the primers described in claim 2 or 3 or the kit described in claim 4 to perform PCR amplification on the DNA template; (3) Use KASP reagent to perform typing detection on the PCR amplification products, and use the LightCycler Application system to read the typing results.

7. The use according to claim 6, characterized in that In step (3), if only the blue fluorescence corresponding to the forward primer 1 connected to the fluorescent linker sequence is detected, the pepper fruit is determined to be a short-fruit homozygous plant with a genotype of CC; If only the green fluorescence corresponding to the forward primer 2 connected to the fluorescent linker sequence is detected, the pepper fruit is judged to be a homozygous individual plant with fruit growth and a genotype of AA. If the fluorescence signals corresponding to the forward primers 1 and 2 connected to the fluorescent linker sequence are detected at the same time, the pepper fruit is judged to be a heterozygous individual plant.

8. The use according to claim 6, characterized in that In step (2), the PCR amplification program includes: Preincubation 94℃ 900S; 94℃ 20S, 78℃ 10S, TD 62℃, 0 Cyc->57 (-0℃), 10 cycles; 94℃ 20S, 57℃ 60S, 35 cycles; Cooling 37℃ 30S.

9. A method for obtaining a SNP molecular marker tightly linked to pepper fruit length as claimed in claim 1, characterized in that: The following steps are involved: (1) Using the wild-type pepper LY0 as the male parent and the fruit-bearing pepper mutant LY143 as the female parent, the two parents were crossed to construct the F1 population, and the F1 was self-pollinated to construct the F2 population; (2) The fruit length phenotype of the F2 population was identified. The wild-type pool and the long-fruit mutant pool were obtained by the BSA method. RNA-seq sequencing was performed. The sequencing results were analyzed by bioinformatics to obtain the chromosome region linked to pepper fruit length. (3) Develop molecular marker technology for single base mutations in the candidate interval to narrow the candidate interval and ultimately obtain SNP molecular markers that are closely linked to fruit length.

Citation Information

Patent Citations

  • Molecular marker for pepper fruit length, primer, kit and application

    CN117402998A

  • KASP molecular marker closely linked with pepper fruit width gene as well as acquisition method, primer, kit and application of KASP molecular marker

    CN117965784A

  • KASP molecular marker closely linked with pepper fruit length, primer, kit and application

    CN118600089A

Cited By

  • KASP molecular marker closely linked with pepper plant height as well as primer, kit and application of KASP molecular marker

    CN121204298A

  • KASP molecular marker closely linked with pepper fruit length, primer, kit and application

    CN121653288A

  • KASP molecular markers, primers, kits and applications that are tightly linked to pepper fruit length

    CN121653288B