Blue-grain wheat SNP (Single Nucleotide Polymorphism) marker CAPS-6168 and application thereof

Abstract

The invention relates to a blue-grain wheat SNP (Single Nucleotide Polymorphism) marker CAPS-6168 and belongs to the technical field of wheat breeding, the CAPS-6168 is located in a TaMYC4-4D gene in haplotype wheat, and the nucleotide sequence of the CAPS-6168 is as shown in SEQ ID NO.1. The invention also relates to a blue-grain wheat SNP marker CAPS-6168. The TaMYC4-4D blue grain specific haplotype is identified by detecting nucleoside polymorphism of the TaMYC4-4D gene in wheat varieties with different grain colors, the blue grain wheat SNP marker CAPS-6168 is developed, the marker can be used for screening and identifying the blue grain wheat when the grain color does not appear, and the TaMYC4-4D blue grain specific haplotype is obtained. The method is beneficial to early identification and generation-adding propagation in the cultivation process of the blue-grain wheat.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat breeding and relates to a blue-grain wheat SNP marker CAPS-6168 and a use thereof. Background Art

[0002] Colored wheat is considered to be a new type of functional wheat variety. Its characteristic is that the seed coat and endosperm contain rich natural anthocyanin compounds, which give the grains different colors (Ye Lin, 2018). Anthocyanin is a secondary metabolite belonging to flavonoids (Karakaya et al., 2016). It has antioxidant, anti-inflammatory, and antibacterial properties. It can maintain normal vascular osmotic pressure to prevent blood vessel rupture, eliminate free radicals in the body, improve immunity, and inhibit the growth of cancer cells (Yang Xiujuan et al., 2005; Zong Xuefeng et al., 2006; Li et al., 2005; Kris et al., 2002). It also has the functions of preventing diabetes, preventing obesity, and protecting eyesight (Mellen et al., 2008; Lutsey et al., 2007; Sharma et al., 2020). As an ideal raw material for functional health foods, colored wheat has a wide range of application markets and development prospects. At the same time, as a precious and characteristic germplasm resource, it can provide material support for high-quality wheat breeding (Ma Lanxiang et al., 2021). Therefore, studying the biosynthesis mechanism of anthocyanins in colored wheat and cultivating new varieties of excellent colored wheat are of great significance for developing new health foods, improving people's dietary structure, and promoting people's health.

[0003] According to different colors, colored wheat can be divided into two major categories: blue-grained wheat and purple-grained wheat. The difference between them and common wheat lies in the different types of anthocyanins contained in the aleurone layer and pericarp (Liu et al., 2021). Blue-grained wheat has blue grains due to the presence of blue anthocyanin compounds in the aleurone layer of wheat (Gao et al., 2000). The main regulatory genes for anthocyanin biosynthesis are three types of transcription factors, MYB, bHLH, and WD40, which either act alone or form an MBW complex to regulate the expression of genes related to anthocyanin synthesis by binding to the corresponding cis-acting elements in the promoters of structural genes (Li et al., 2022). The synthesis of anthocyanins in the blue aleurone layer involves at least the action of two key genes, Ba 1 and Ba 2, and the gene ThMYC4E has been identified as a candidate gene for Ba 1 (Zhao et al., 2019). In the study of the blue and white aleurone layers of triticale, the transcription factor BcMYC1 was identified as a candidate gene regulating the synthesis and metabolism of anthocyanins in the blue aleurone layer (Li, 2020). In the study of blue-grained barley, a "three-gene cluster" consisting of two transcription factors, HvMYB4H and HvMYC4H, and the structural gene HvF3’5’H related to the blue-grain trait was found to be highly expressed in blue-grained barley and specifically expressed only in the aleurone layer (Jia et al., 2020).

[0004] The expression level of the wheat TaMYC4-4D gene was significantly reduced in the grains of blue-grained wheat plants with virus-induced silencing of the TaMYC4-4D gene. Moreover, the blue color of the mature grains disappeared and the anthocyanin content was significantly reduced, indicating that this transcription factor is involved in regulating the biosynthesis of anthocyanins in blue-grained wheat grains. The rich genetic variation among wheat varieties enables breeders to create better gene combinations and cultivate excellent varieties suitable for different cultivation environments (Xu et al., 2014; Rasheed & Xia, 2019). Molecular marker-assisted selection is an effective means for crop genetic improvement. Currently, more than 100 functional markers related to important agronomic traits have been used in wheat variety breeding and germplasm resource improvement (Meng et al., 2018; Zhao et al., 2019; Vishwakarma et al., 2016; Ma et al., 2018). Since the grain color of blue-grained wheat gradually appears mainly after 20 days after flowering, and in the process of cultivating new wheat varieties, in order to accelerate the breeding progress, it is often necessary to harvest in advance for multiplication, and at this time, it may be impossible to screen the grain color. Therefore, developing molecular markers that can mark the blue color of grains and identifying them at the early stage of grain development will effectively solve this problem and contribute to the breeding of new blue-grained wheat varieties. Summary of the Invention

[0005] The present invention provides a blue-grained wheat SNP marker CAPS-6168 and its use, which solves the problem that in the existing blue-grained wheat breeding, early harvest and multiplication are required, and it may not be possible to screen the grain color at this time.

[0006] To solve the above technical problems, the technical solution adopted by the present invention is:

[0007] A blue-grained wheat SNP marker CAPS-6168, wherein the CAPS-6168 is located in the TaMYC4-4D gene in haploid wheat, and its nucleotide sequence is shown in SEQ ID NO.1: CTTAAT.

[0008] Furthermore, preferably: the nucleotide sequence of the TaMYC4-4D gene is shown in SEQ ID NO.2.

[0009] The present invention also provides a primer for detecting blue-grained wheat, and the primer is

[0010] As shown in SEQ ID NO.3: TaMYC4-4D-SNP-F: TGCATGATGTCTTCCTACAC;

[0011] As shown in SEQ ID NO.4: TaMYC4-4D-SNP-R: TCGGAAGAACATGCTGAGAG.

[0012] The use of the blue-grained wheat SNP marker CAPS-6168 of the present invention in detecting or breeding varieties or lines with wheat grain blue pigment content.

[0013] Furthermore, preferably: for detecting blue-grained wheat, including the following steps:

[0014] (1) Design primers upstream and downstream of the SNP, specifically as shown in SEQ ID NO.3 and SEQ ID NO.4;

[0015] (2) Using the DNA of haploid wheat varieties as a template, amplify the TaMYC4-4D coding region fragment in different haploid wheats to obtain a single amplification band;

[0016] (3) Use Mse I to digest the purified PCR product, and detect it by electrophoresis. If the amplified product remains a single band after digestion, it is blue-grained wheat.

[0017] The beneficial effects of the present invention:

[0018] The present invention detected the nucleotide polymorphisms of the TaMYC4-4D gene in different grain color wheat varieties, identified the TaMYC4-4D blue-specific haplotype, and developed the blue-grained wheat SNP marker CAPS-6168, which can be used for screening and identification of blue-grained wheat when the grain color has not yet appeared. This will contribute to the early identification and accelerated propagation in the process of cultivating blue-grained wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0020] Figure 1 . Phenotype diagrams of some hexaploid wheat varieties used;

[0021] Figure 2 . PCR amplification results of the TaMYC4-4D coding region;

[0022] Figure 3 . Variant sites and two haplotypes formed by the TaMYC4-4D coding region sequence in common hexaploid wheat;

[0023] Figure 4 . Determination results of the TaMYC4-4D coding region haplotype CAPS molecular marker. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0024] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0025] 1. Materials

[0026] In this study, 50 common wheat varieties were selected (10 blue-grained wheat varieties, 16 purple-grained wheat varieties, and 24 common wheat varieties), and the detailed information is shown in Table 1. The phenotypes will Figure 1 .

[0027] The high-fidelity PCR enzyme KOD OneTM PCR Master Mix used for PCR amplification was purchased from Toyobo Biochemical Co., Ltd., and the zero-background ZT4-Blunt rapid cloning kit was purchased from Beijing Zhuangmeng International Biotechnology Co., Ltd.

[0028] The MseⅠ restriction endonuclease was purchased from Beijing Baori Biotechnology Co., Ltd. (TAKARA).

[0029] Table 1 Hexaploid wheat varieties used in this experiment

[0030]

[0031]

[0032] 2. Primer design

[0033] First, the gene sequence of TaMYC4-4D (TraesCS4D03G0543900) was retrieved from the wheat genome database. It was found that it was a single-copy gene on chromosome 4D in the wheat genome. Further, specific primers for amplifying the coding region of chromosome 4D were designed. Since the full length of this gene is 8556 bp and contains 7 introns, it was amplified in five segments and then spliced together.

[0034] The first segment consists of a 393-bp fragment from 145 bp upstream of the first exon to 135 bp downstream of the first exon.

[0035] The second segment consists of a 506-bp fragment from 145 bp upstream of the second exon to 254 bp downstream of the second exon.

[0036] The third segment consists of a 587-bp fragment from 62 bp upstream of the third exon to 335 bp downstream of the third exon.

[0037] The fourth segment consists of a 761-bp fragment from 184 bp upstream of the fourth exon to 163 bp downstream of the fifth exon.

[0038] The fifth segment consists of a 1519-bp fragment from 108 bp upstream of the sixth exon to 108 bp downstream of the eighth exon. The primers are shown in Table 2. Primer synthesis and sequencing were completed by Henan Shangya Biotechnology Co., Ltd.

[0039] Table 2 Primers used in this experiment

[0040]

[0041] 3. Extraction of total DNA from wheat

[0042] Extract total DNA from wheat using the CTAB method. First, quickly freeze and grind wheat leaves or other tissues in liquid nitrogen, add 1 mL of preheated CTAB extraction buffer, and incubate in a water bath at 65 °C for 1 h. Then, centrifuge at 12,000 g, take the supernatant, add an equal volume of chloroform:isoamyl alcohol (24:1) mixture, and shake. Centrifuge at 12,000 g for 10 min, transfer the supernatant to a new tube, add 2 volumes of absolute ethanol, mix well, and let stand at -20 °C for 30 min. Centrifuge again to remove the supernatant, wash twice with 75% ethanol, air dry, and then dissolve the DNA in 100 μL of sterile water.

[0043] 4. Amplification and sequencing of the coding region of the TaMYC4-4D gene

[0044] Use the high-fidelity PCR enzyme KOD OneTM PCR MasterMix to amplify the target fragment. Using five pairs of designed amplification primers, amplify the TaMYC4-4D coding domain sequence with 50 hexaploid wheat DNAs as templates. The PCR system contains: 25 μL of KOD OneTM PCR MasterMix (2×), 0.3 μL of each upstream and downstream primer (10 μM), 200 ng of DNA template, and ddH2O is added to make the total volume 50 μL. The PCR reaction program is as follows: the first step, 98 °C for 5 min; the second step, 98 °C for 10 s, 56 °C for 10 s, 68 °C for 10 min, 35 cycles; the third step, 68 °C for 5 min. The amplification results are as Figure 2 shown. Figure 2 In A: PCR amplification results of the first fragment; B: PCR amplification results of the second fragment; C: PCR amplification results of the third fragment; D: PCR amplification results of the fourth fragment; E: PCR amplification results of the fifth fragment.

[0045] Recover the PCR amplification target fragments of each variety, ligate them with the ZT4-Blunt cloning vector, transform Escherichia coli, pick more than three positive clones, and sequence them with the universal primers T7-F / R.

[0046] Sequencing results: The TaMYC4-4D-CD sequence of blue-grained wheat is shown in SEQ ID NO.2; the TaMYC4-4D-CD sequences of purple-grained wheat and white-grained wheat are shown in SEQ ID NO.5.

[0047] 5. Sequence alignment and haplotype analysis of the coding region of the TaMYC4-4D gene

[0048] The sequencing results were assembled and sequence alignment was performed using DNAMAN software (http: / / www.lynnon.com). The sequence alignment results showed that there were 3 SNP sites with sense mutations (5845G / A, 5859G / A, 6168C / A) in the coding region of TaMYC4-4D in 50 wheat varieties. Haplotype identification of the coding region was performed using DnaSP 5.10 software (http: / / www.ub.edu / DnaSP), and the results showed that these 3 SNPs were tightly linked to form two haplotypes, named TaMYC4-4D-Hap 1 and TaMYC4-4D-Hap 2, as Figure 3 shown.

[0049] 6. Observation and analysis of grain colors of wheat varieties with different haplotypes

[0050] After classifying wheat varieties with different haplotypes, it was found that among the 50 wheat varieties tested, there were 10 varieties with the Hap 1 haplotype, all of which were blue-grained wheat varieties; there were 40 varieties with the Hap 2 haplotype, all of which were purple and common wheat. Therefore, Hap 1 is a blue-specific haplotype.

[0051] 7. Development of CAPS molecular markers

[0052] Since the difference between the coding regions of the two haplotypes of TaMYC4-4D is a single-base difference (SNP), cleavage amplified polymorphism sequence-tagged sites (CAPS) molecular markers can be developed based on these differences. The sequence differences between the coding regions of the Hap 1 blue-specific haplotype and the Hap 2 haplotype of TaMYC4-4D were analyzed using dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html). The SNP of TaMYC4-4D-Hap 1: 6168bp (C / A) was located in the sequence CTTCAT; the SNP of TaMYC4-4D-Hap 2: 6168bp (C / A) was located in the sequence CTTAAT. CTTAAT can be recognized and cleaved by the restriction endonuclease Mse I, while CTTCAT cannot be cleaved ( Figure 3)。Based on the sequence differences at this site, CAPS molecular markers can be developed to distinguish Hap 1 from other haplotypes, and this marker is named CAPS-6168. Primers were designed upstream and downstream of the SNP identified by the CAPS marker (TaMYC4-4D-SNP-F: TGCATGATGTCTTCCTACAC; TaMYC4-4D-SNP-R: TCGGAAGAACATGCTGAGAG). Using the DNA of different haplotype wheat varieties (6 varieties were selected for each haplotype) as templates, the coding region fragments (6008bp - 6261bp) of TaMYC4-4D in different haplotype wheats were amplified, and a single amplification band (254bp) could be obtained. Then, the purified PCR products were digested with Mse I. The electrophoresis detection results showed that the amplified products of the Hap 1 haplotype wheat varieties remained a single 254bp band after digestion, while the amplified products of the Hap 2 haplotype materials became two fragments, 159bp and 95bp respectively ( Figure 4 )。Therefore, the CAPS-6168 molecular marker can distinguish Hap 1 from other haplotypes, and this marker can be used for the screening and identification of blue-grained wheat when the grain color has not appeared, which will contribute to the early identification and accelerated propagation in the process of blue-grained wheat cultivation.

[0053] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A blue-grain wheat SNP marker CAPS-6168, characterized in that: The CAPS-6168 is located in the TaMYC4-4D gene in haploid wheat, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The blue-grain wheat SNP marker CAPS-6168 according to claim 1, characterized in that: The nucleotide sequence of the TaMYC4-4D gene is shown in SEQ ID NO.

2.

3. A primer for detecting blue-grain wheat, characterized in that: The primers are TaMYC4-4D-SNP-F: as shown in SEQ ID NO.3; TaMYC4-4D-SNP-R: as shown in SEQ ID NO.

4.

4. Use of the blue-grain wheat SNP marker CAPS-6168 according to claim 1 or 2 in detecting or breeding varieties or strains having a high content of blue-grain protein in wheat grains.

5. The use according to claim 3, characterized in that: For detecting blue-grain wheat, the method comprises the following steps: (1) Designing primers upstream and downstream of SNP, such as SEQ ID NO.3 and SEQ ID NO.4; (2) Using haploid wheat variety DNA as a template, the TaMYC4-4D coding region fragments in different haploid wheats were amplified to obtain a single amplified band; (3) Use Mse I to digest the purified PCR product and perform electrophoresis detection. If the amplified product remains as a single band after digestion, it is blue-grain wheat.

Images