RT-MIRA-LFD kit for detecting PEDV

Abstract

The invention discloses an RT-MIRA-LFD kit for detecting PEDV (Porcine Epidemic Diarrhea Virus), and belongs to the technical field of molecular biology. The invention firstly provides an RT-MIRA-LFD primer probe combination for rapidly detecting the porcine epidemic diarrhea virus. The RT-MIRA-LFD primer probe combination comprises an upstream primer as shown in SEQ ID NO.5, a downstream primer as shown in SEQ ID NO.7 and a probe as shown in SEQ ID NO.9; the invention further provides a kit and a detection method for rapidly detecting the porcine epidemic diarrhea virus. The primer and the probe for detecting the porcine epidemic diarrhea virus and the RT-MIRA-LFD detection method are designed based on the RT-MIRA-LFD technology, the detection method has the advantages of high sensitivity and high specificity, the detection time is short, the result is visual, and a new experience method is provided for rapid detection of the porcine epidemic diarrhea virus.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly to an RT-MIRA-LFD kit for detecting PEDV. Background Art

[0002] Porcine Epidemic Diarrhea (PED) is a highly contagious intestinal disease characterized by vomiting, dehydration, and diarrhea caused by infection with Porcine Epidemic Diarrhea Virus (PEDV). Porcine Epidemic Diarrhea Virus belongs to the Coronaviridae family and the Coronavirus genus. It is a linear, positive-strand, single-stranded RNA virus with a full genome length of approximately 280,000 bp. Suckling piglets, growing pigs, and fattening pigs are all pig populations that are extremely susceptible to Porcine Epidemic Diarrhea, with an incidence rate of 100%. In particular, suckling piglets are the most severely affected. Suckling piglets at 1 week of age continue to have diarrhea for 3 to 4 days and then die due to dehydration, with an average mortality rate of 50%, and sometimes as high as 90%. Porcine Epidemic Diarrhea is an independent acute contagious intestinal disease of pigs. Diseased pigs and virus-carrying pigs are the main sources of infection. Under natural conditions, it is infected through the oral route by feces or pollutants excreted by infected pigs. Suckling piglets, weaned piglets, and fattening pigs are all relatively susceptible, with an incidence rate as high as 100%. These pig populations will continuously carry the virus.

[0003] Currently, traditional methods such as virus isolation, HA / HI, ELISA, and PCR technology have been used to detect PEDV. Among them, PCR technology has better detection specificity and sensitivity, and is highly reliable in clinical sample detection, and is more favored by testers. However, due to the characteristics of relying on precision and expensive instruments, long detection time, high cost, and requiring professional operation, PCR technology is difficult to popularize and has certain limitations in the process of clinical application, and it is difficult to meet the needs of grass-roots detection. In addition, pathogen isolation and serological methods cannot confirm the diagnosis. Therefore, there is an urgent need to provide a method with a faster detection speed, higher sensitivity, and more concise detection process to improve the detection efficiency and diagnostic accuracy of PEDV. Summary of the Invention

[0004] The purpose of the present invention is to provide an RT-MIRA-LFD kit for detecting PEDV to solve the problems existing in the above-mentioned prior art. The present invention designs primers and probes for detecting Porcine Epidemic Diarrhea Virus based on RT-MIRA-LFD technology, as well as an RT-MIRA-LFD detection method. This method has the advantages of high sensitivity and high specificity, short detection time, and visual results, providing a new empirical method for the rapid detection of Porcine Epidemic Diarrhea Virus.

[0005] To achieve the above purpose, the present invention provides the following solutions:

[0006] The present invention provides an RT-MIRA-LFD primer-probe combination for rapid detection of porcine epidemic diarrhea virus, and the RT-MIRA-LFD primer-probe combination includes an upstream primer shown in SEQ ID NO.5, a downstream primer shown in SEQ ID NO.7, and a probe shown in SEQ ID NO.9.

[0007] Further, the 5'-end of the downstream primer is labeled with biotin; the 5'-end of the probe is labeled with a FAM group, the 3'-end is modified with C3-spacer, and the 31st base from the 5'-end is replaced with a dSpacer label.

[0008] The present invention also provides an application of the above RT-MIRA-LFD primer-probe combination in the preparation of a reagent or kit for rapid detection of porcine epidemic diarrhea virus.

[0009] The present invention also provides an RT-MIRA-LFD kit for rapid detection of porcine epidemic diarrhea virus, and the kit contains the above RT-MIRA-LFD primer-probe combination.

[0010] Optionally, the RT-MIRA-LFD kit further contains a lateral flow chromatographic test strip.

[0011] The present invention also provides a method for detecting porcine epidemic diarrhea virus for non-diagnostic purposes, which reversely transcribes the RNA of the sample to be detected to obtain a nucleic acid sample;

[0012] Using the nucleic acid sample as a template, MIRA amplification is carried out by using the above RT-MIRA-LFD kit;

[0013] The lateral flow chromatographic test strip is used to detect the MIRA amplification product for result interpretation.

[0014] Further, the reaction system for MIRA amplification is: 29.4 μL of A Buffer, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream primer, 0.6 μL of 10 μM probe, 5 μL of template, 2.5 μL of B Buffer, and 8.5 μL of RNase-free Water.

[0015] Further, the reaction temperature for MIRA amplification is 36°C - 41°C, and the reaction time is 15 - 20 min.

[0016] Further, the method for result interpretation is: when the control line and the test line are colored, it indicates that the sample to be detected contains porcine epidemic diarrhea virus; when the control line is colored and the test line is not colored, it indicates that the sample to be detected does not contain porcine epidemic diarrhea virus; when neither the control line nor the test line is colored, it indicates that the lateral flow chromatographic test strip fails and needs to be retested.

[0017] The present invention discloses the following technical effects:

[0018] (1) The present invention first adopts the RT-MIRA nucleic acid test strip detection technology to establish a detection method for rapid detection of porcine epidemic diarrhea virus, and this method has the advantages of high sensitivity, specificity and repeatability.

[0019] (2) The present invention designs multiple pairs of primers for screening porcine epidemic diarrhea virus, and finally obtains primers and probes with good specificity and high amplification efficiency, and at the same time has no cross-reaction with various viruses such as TGEV, HCoV-OC43, and VSV.

[0020] (3) Compared with ordinary PCR, the RT-MIRA-LFD of the present invention can obtain the detection result within 30 minutes, does not require expensive thermal cycling instrument equipment, the amplification product is detected by a test strip, and the detection result can be read in 2 - 5 minutes. The sensitivity can be increased from 10 2 copies to 10 0 copies, greatly improving the detection sensitivity, and is especially suitable for grass-roots laboratories and on-site detection. Description of the Drawings

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0022] Figure 1 It is the screening result diagram of MIRA primers; among them, A is the electrophoresis result diagram of the reaction products of primer combinations F1 / R1, F1 / R2, F1 / R3, F2 / R1, F2 / R2 and F2 / R3; B is the electrophoresis result diagram of the reaction products of primer combinations F3 / R1 and F3 / R2; C is the electrophoresis result diagram of the reaction products of primer combination F3 / R3;

[0023] Figure 2 It is the optimization result diagram of the optimal reaction temperature of the RT-MIRA-LFD reaction system; N is the negative control for the reaction at 40°C;

[0024] Figure 3 It is the optimization result diagram of the optimal probe addition amount of the RT-MIRA-LFD reaction system; N is the negative control for the reaction after adding 0.6 μL of probe;

[0025] Figure 4 It is the optimization result diagram of the optimal reaction time of the RT-MIRA-LFD reaction system; N is the negative control for the reaction for 20 min;

[0026] Figure 5 The sensitivity analysis results of the RT-MIRA-LFD detection system are shown in Figure 1. Test strips 1 to 12 represent 1.67×10 10 -1.67×10 -1 copies / μL of positive standard sample; N is the negative control;

[0027] Figure 6 The specific analysis results of the RT-MIRA-LFD detection system; test strips 1-4 represent the detection results of PEDV, TGEV, HCoV-OC43, and VSV nucleic acid samples respectively; P is 1×10 5 The positive standard pUC19-PEDV-N was 100 copies / μL; N was the negative control. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0032] Regarding the terms "comprising", "including", "having", "containing", etc. used in this text, they are all open-ended terms, meaning including but not limited to.

[0033] The reaction principle of the RT-MIRA-LFD of the present invention is as follows: Based on the synergistic action of multiple functional proteins (helicase, recombinase, single-stranded DNA binding protein, DNA polymerase, etc.), the recombinase and primer form a protein / single-stranded nucleotide complex Rec / SsDNA, search for the homologous sequence on the template DNA, initiate a strand displacement reaction after positioning and binding, the primer binds to the corresponding template, and extends under the action of DNA polymerase, achieving rapid nucleic acid amplification at room temperature. The amplified product is double-labeled with biotin and carboxyfluorescein (FITC), dropped onto a colloidal gold type test strip, biotin will bind to streptomycin labeled with colloidal gold to form a ternary complex, diffuse through the chromatography membrane, and be captured by the anti-FITC antibody to form a colored test line.

[0034] Example 1

[0035] I. Experimental design

[0036] The present invention uses SnapGene software to manually design upstream and downstream primers, and simultaneously uses the biological software Oligo7.0 to screen the primers to ensure a low probability of dimer formation between the primers. Subsequently, the positive standard was amplified by RT-MIRA using the screened primers. After the amplification result was purified, 1% agarose gel electrophoresis was used to screen the primers with the best amplification effect, and probes were designed for the screened primers with the aim of further increasing the amplification specificity. All primers and probes were synthesized by Beijing Ruibo Xingke Biotechnology Co., Ltd. The RT-MIRA detection system was established using the designed primers and probes, and the reaction conditions were optimized. Finally, the sensitivity and specificity of the optimized RT-MIRA detection system were analyzed.

[0037] II. Experimental methods

[0038] 1. Virulent strains, cells and clinical samples

[0039] The porcine epidemic diarrhea virus used in the present invention was isolated from Vero-E6 cells by the Veterinary Public Health Laboratory of the Institute of Animal Science, Chinese Academy of Agricultural Sciences. The Vero-E6 cells were preserved by the Veterinary Public Health Laboratory and cultured in DMEM containing 10% serum at 37 °C and 5% CO 2 under the condition, and other virulent strains: TGEV, HCoV-OC43, VSV, were all preserved by the Veterinary Public Health Laboratory.

[0040] 2. Preparation of viral nucleic acid samples

[0041] Porcine epidemic diarrhea virus was inoculated into Vero-E6 cells. After repeated freezing and thawing three times, 200 μL of the supernatant was taken and used TIANamp Virus RNA Kit to extract the viral RNA genome according to the instructions. Finally, it was eluted with 40 μL of Buffer TE (nuclease-free). The extracted RNA was used One-Step gDNA Removal and cDNA Synthesis Super Mix for reverse transcription to obtain the viral nucleic acid sample.

[0042] 3. Preparation of positive standard

[0043] (1) Using the N gene sequence of the PEDV classical strain CV777 (accession number: KT323979.1) as the reference sequence, primers for amplifying the full-length PEDV N gene were designed. Using the viral nucleic acid sample prepared in step 2 as the template and PowerPol 2×PCR Mix, the PEDV genome was amplified;

[0044] The primers for PEDV-N gene amplification are as follows:

[0045] Forward primer: 5’-aaaacgacggccagtgaattcATGGCTTCTGTCAGCTTTCAGG-3’ (SEQ ID NO.1);

[0046] Reverse primer: 5’-caggtcgactctagaggatccTTAATTTCCTGTGTCGAAGATCTCG-3’ (SEQ ID NO.2);

[0047] (2) Use Universal DNA Purification Kit gel recovery kit to recover and purify the amplification product according to the instructions;

[0048] (3) Select Ⅱ One Step Cloning Kit to ligate the target fragment to the pUC19 vector, transform it into 5α competent cells, pick 6 sample colonies after plate culture, and perform shaking culture.

[0049] (4) Perform colony PCR on the bacterial liquid using 1% agarose gel electrophoresis to identify positive clones. At the same time, send the bacterial liquid to Genewiz for sequencing, and store the remaining bacterial liquid at 4°C.

[0050] (5) Select the bacterial liquid with successfully identified positive clones, inoculate it into LB medium (Amp+) at a volume ratio of 1:100, shake the bacteria for 12 h, then extract the plasmid using the Tiangen Biotech endotoxin-free large plasmid extraction kit to obtain the pUC19-PEDV-N positive standard, measure the plasmid concentration, and calculate the plasmid copy number.

[0051] 4. Design and screening of MIRA amplification primers

[0052] Use the extracted plasmid as a template for amplification, combine the primers in Table 1, a total of 9 primer combinations: F1 / R1, F1 / R2, F1 / R3, F2 / R1, F2 / R2, F2 / R3, F3 / R1, F3 / R2, F3 / R3. The reaction system is as follows: 8.5 μL of RNase-free Water, 29.4 μL of A Buffer, 2 μL of upstream primer (10 μM), 2 μL of downstream primer (10 μM), 0.6 μL of probe (10 μM), 5 μL of template, and 2.5 μL of B Buffer. React at 39 °C for 20 min. Perform 1% agarose gel electrophoresis on the reaction products, and the amplification primer that shows the earliest amplification band and no miscellaneous bands is the best primer. The test results are as Figure 1 shown. The two primer pairs F1 / R3 and F3 / R2 have the best amplification effect. Considering increasing the selectivity of the designed probe, select the primer pair F3 / R2 with a longer amplified fragment for subsequent experiments.

[0053] Table 1 Primer and probe sequence information

[0054] Name Sequence (5’-3’) MIRA-F1 TAACAACAGAGGCAACAACCAGTCCCGTGG (SEQ ID NO.3) MIRA-F2 CCAGTCCCGTGGTAATTCACAGAATCGTGG (SEQ ID NO.4) MIRA-F3 ACAGAATCGTGGAAATAACCAGGGTCGTGG (SEQ ID NO.5) MIRA-R1 GCTTATGCCTGTCAGGATTTTCTCCAATAC (SEQ ID NO.6) MIRA-R2 TCTCCAATACCCAAAGATTTAAGGGCATCC (SEQ ID NO.7) MIRA-R3 GATTTAAGGGCATCCTTGACAGCAGCCACC (SEQ ID NO.8)

[0055] 5. Establishment of the PEDV RT-MIRA-LFD reaction system

[0056] (1) Probe design: Design a 46-bp probe according to the target fragment amplified by the selected upstream and downstream primers. The 5' end of the probe is labeled with the FAM group, the middle dSpacer replaces G or C, and the 3' end is modified with C3-spacer. Try to avoid the generation of dimers between the probe and itself and the selected primers.

[0057] The designed probe sequence is:

[0058] [FAM]CAATAACAAGTCTCGTAACCAGTCCAAGAA[dSpacer]CAGGAACCAGTCAAA[C3spacer](SEQ ID NO.9).

[0059] (2) Among the selected best primer pairs, label the 5' end of the downstream primer with biotin (Biotin).

[0060] (3)Preliminary establishment of the RT-MIRA-LFD reaction system:

[0061] The RNA isothermal rapid amplification kit (colloidal gold test strip type) and the HybriDetect colloidal gold test strip were both purchased from AmpFuture (Changzhou) Biotechnology Co., Ltd. 8.5 μL of RNase-free Water, 29.4 μL of A Buffer, 2 μL each of the upstream primer (10 μM) and the downstream primer (10 μM), 0.6 μL of the probe (10 μM), and 5 μL of the template were successively added to the octuplet tube containing the lyophilized powder. 2.5 μL of B Buffer was added to the reaction tube lid. After instantaneous centrifugation, it was shaken and mixed evenly, and then centrifuged again. It was incubated at a constant temperature in a water bath at 36 - 41 °C for 5 - 20 min. The negative control was ddH 2 O.

[0062] (4) Take 1 μL of the reaction product, dilute it with the buffer at a ratio of 1:10000, and detect it with a nucleic acid test strip (purchased from AmpFuture (Changzhou) Biotechnology Co., Ltd.). The result can be observed in 2 - 5 min.

[0063] (5) Result interpretation:

[0064] ① Negative: Both the quality control line (C line) and the test line (T line) are colored, indicating that amplification occurred in the reaction tube and the test sample contains the nucleic acid to be detected;

[0065] ② Positive: The C line is colored while the T line is not colored, indicating that the test sample does not contain the nucleic acid to be detected;

[0066] ③ Invalid: The T line is not colored. Whether the C line is colored or not indicates that the test strip is invalid and needs to be replaced with a new test strip for re - detection.

[0067] 6. Optimization of the RT-MIRA-LFD reaction conditions

[0068] (1) Optimization of the optimal reaction temperature: Using the positive standard pUC19 - PEDV - N at 1×10 5 copies / μL as the template, different reaction temperatures of 36 °C, 37 °C, 38 °C, 39 °C, 40 °C, and 41 °C were set respectively, and the incubation time was set to 15 min. The reaction product was detected with a nucleic acid test strip. The results of the test strip were as Figure 2 shown. The reaction product could be detected under the condition of 36 °C - 41 °C, but the band was clearest at 40 °C, indicating that the amplification efficiency was higher at 40 °C. Considering the simplicity of clinical detection and the optimal reaction temperature of the enzyme, all incubation temperatures in subsequent experiments were 40 °C.

[0069] (2) Optimization of the optimal probe addition amount: Using 1×10 5Using the positive standard pUC19-PEDV-N at [X] copies / μL as the template, 0.4 μL, 0.6 μL, and 0.8 μL of the probe were added to the reaction system respectively, and the incubation time was set to 15 min. The reaction products were detected with a nucleic acid test strip, and the results of the test strip were as Figure 3 shown. When the probe addition amount was 0.6 μL, the detection line band was the strongest. Therefore, the optimal probe addition amount for the RT-MIRA-LFD method was determined to be 0.6 μL. In subsequent experiments, the probe addition amount for all was 0.6 μL.

[0070] (3) Optimization of the optimal reaction time: Using the positive standard pUC19-PEDV-N at 1×10 5 copies / μL as the template, the incubation time of the system was set to 10 min, 15 min, and 20 min respectively, and the reaction was carried out at 40 °C. The reaction products were detected with a nucleic acid test strip, and the results of the test strip were as Figure 4 shown. When the reaction duration was 10 min, the detection line did not show color. When the reaction was 15 min, the detection line showed color, and when the reaction was 20 min, the detection line band intensity was the strongest. Therefore, the optimal reaction time for the RT-MIRA-LFD method was determined to be 20 min, that is, the optimal incubation time was 20 min.

[0071] 7. Sensitivity analysis of the RT-MIRA-LFD detection system

[0072] Using the RT-MIRA-LFD reaction system constructed above, the sensitivity of the RT-MIRA-LFD detection system was detected. The template used was the positive standard pUC19-PEDV-N. The positive standard was serially diluted 10-fold to obtain samples with copy numbers of 1.67×10 10 , 1.67×10 9 , 1.67×10 8 , 1.67×10 7 , 1.67×10 6 , 1.67×10 5 , 1.67×10 4 , 1.67×10 3 , 1.67×10 2 , 1.67×10 1 , 1.67×10 0 , 1.67×10 -1 as templates. The reaction was carried out at 40 °C for 20 min, and the results of the test strip were as Figure 5 shown. It can be seen that when the concentration was 10 0 Note: The specific copy number values in the text are not fully filled in the original, so there are still some placeholders in the translation. You may need to supplement the complete information according to the actual situation.When the reaction product can be detected. The lowest detection limit of the RT-MIRA-LFD detection system is 1.67 copies / μL, and the detection range is relatively wide, and it can be detected within the copy number range of 1.67 - 1.67×10 10 copies, compared with ordinary PCR, the detection sensitivity is increased by two orders of magnitude.

[0073] 8. Specificity analysis of the RT-MIRA-LFD detection system

[0074] Using the RT-MIRA-LFD reaction system constructed above, the specificity of the RT-MIRA-LFD detection system was detected. Positive samples of PEDV, TGEV, HCoV-OC43, and VSV were detected respectively. The viral genome was extracted according to the method of step 2 to prepare nucleic acid samples. Using its DNA or cDNA as a template, RT-MIRA reaction was carried out, and the test strip results were as Figure 6 shown. It can be seen that only the positive detection line of PEDV amplification is visible, and no amplification is seen in other viruses, indicating that this method has good specificity and does not cross-react with other viruses.

[0075] In summary, the present invention designs two primers and one probe, and constructs a detection method for PEDV by RT-MIRA. This method is simple, rapid and effective, reduces the detection cost while improving the efficiency, and is more suitable for grass-roots laboratories and on-site detection.

[0076] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. An RT-MIRA-LFD primer-probe combination for rapid detection of porcine epidemic diarrhea virus, characterized in that: The RT-MIRA-LFD primer-probe combination includes an upstream primer as shown in SEQ ID NO.5, a downstream primer as shown in SEQ ID NO.7 and a probe as shown in SEQ ID NO.

9.

2. The RT-MIRA-LFD primer-probe combination according to claim 1, characterized in that: The 5' end of the downstream primer is labeled with biotin; the 5' end of the probe is labeled with a FAM group, the 3' end is modified with C3-spacer, and the 31st base from the 5' end is replaced with a dSpacer label.

3. Use of the RT-MIRA-LFD primer-probe combination according to claim 1 or 2 in the preparation of a reagent or kit for rapid detection of porcine epidemic diarrhea virus.

4. An RT-MIRA-LFD kit for rapid detection of porcine epidemic diarrhea virus, characterized in that: The kit comprises the RT-MIRA-LFD primer-probe combination according to claim 1 or 2.

5. The RT-MIRA-LFD kit according to claim 4, characterized in that The RT-MIRA-LFD kit also includes a lateral flow chromatography test strip.

6. A method for detecting porcine epidemic diarrhea virus for non-diagnostic purposes, characterized in that: Reversely transcribe the RNA of the sample to be tested to obtain a nucleic acid sample; Using the nucleic acid sample as a template, performing MIRA amplification using the RT-MIRA-LFD kit according to claim 4 or 5; The MIRA amplification product was detected using lateral flow chromatography test strips and the results were interpreted.

7. The detection method according to claim 6, characterized in that: The reaction system of the MIRA amplification is: 29.4 μL of A Buffer, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream primer, 0.6 μL of 10 μM probe, 5 μL of template, 2.5 μL of B Buffer and 8.5 μL of RNase-free Water.

8. The detection method according to claim 6, characterized in that: The reaction temperature of the MIRA amplification is 36° C.-41° C., and the reaction time is 15-20 min.

9. The detection method according to claim 6, characterized in that: The method for interpreting the results is: when the quality control line and the test line are colored, it indicates that the sample to be tested contains porcine epidemic diarrhea virus; when the quality control line is colored and the test line is not colored, it indicates that the sample to be tested does not contain porcine epidemic diarrhea virus; when both the quality control line and the test line are not colored, it indicates that the lateral flow chromatography test strip is invalid and needs to be retested.

Images