Method for detecting bluetongue virus based on RAA-CRISPR / Cas13a-nucleic acid test strip

Abstract

The invention discloses a method for detecting bluetongue virus based on RAA-CRISPR / Cas13a, and belongs to the technical field of virus detection. According to the detection method, isothermal amplification is carried out on a non-structural protein NS3 gene of BTV by using an RAA technology, and the BTV is detected by combining the specific nucleic acid cutting capability of CRISPR / Cas13a. The sequence of the upstream primer for detecting the bluetongue virus is as shown in SEQ ID NO: 1, the sequence of the downstream primer is as shown in SEQ ID NO: 2, and the sequence of the specific crRNA is as shown in SEQ ID NO: 3. By utilizing the primer and the specific crRNA, accurate detection of bluetongue virus can be realized, and the primer and the specific crRNA are simple to operate, high in sensitivity and strong in specificity, are suitable for being used in mechanisms or epidemic situations with relatively simple instrument conditions, and are crucial to detection of BTV and prevention of bluetongue.

Description

Technical Field

[0001] The present invention relates to the technical field of rapid virus detection, and particularly relates to a method for detecting bluetongue virus based on RAA-CRISPR / Cas13a-nucleic acid test strip. Background Art

[0002] Bluetongue (BT) is a non-contact infectious disease of ruminants caused by Bluetongue virus (BTV) with insects (Culicoides) as the transmission vector. Its susceptible animals are ruminants such as sheep, goats, cattle and deer. The main manifestations are fever, highly congested oral and nasal mucosa, lip edema, followed by gangrenous rhinitis, oral mucosal ulcers, hoof inflammation and skeletal muscle deformation. BTV can also be vertically transmitted to affect the reproductive ability of female animals, causing abortion, stillbirth and abnormal fetal development, etc. In addition, BTV is widely prevalent in various parts of South Africa, and 29 BTV serotypes have been discovered. This region is severely threatened by BTV due to its large number of sheep, uneven distribution and wide range, and the existence of a large number of unvaccinated, clinically drug-resistant local sheep breeds and wild ruminant species. Therefore, the control, rapid diagnosis and timely monitoring of BTV are crucial.

[0003] Currently, methods such as virus isolation, immunoenzymatic staining, AC-ELISA, plaque assay, RT-PCR, etc. are usually used to detect whether ruminants are infected with BTV. However, these methods are relatively complex in operation, have a large workload, and require a high experimental environment, which is not conducive to the rapid detection of sudden diseases at the grass-roots level. Therefore, establishing a simple and rapid detection method for BTV can more effectively make up for the deficiencies of existing methods. Summary of the Invention

[0004] To solve the problems existing in the prior art, the present invention provides a method for detecting bluetongue virus based on RAA-CRISPR / Cas13a. By using the primers and specific crRNA of the present invention, the visual detection of bluetongue virus can be realized, and the operation is simple, the sensitivity is high, and the specificity is strong, which provides a basis for the rapid, simple and accurate diagnosis of BTV and meets the needs of clinical detection.

[0005] To achieve the above invention purpose, the embodiments of the present invention adopt the following technical solutions:

[0006] A nucleic acid molecule composition for detecting bluetongue virus based on RAA-CRISPR / Cas13a, characterized in that it includes an RAA primer pair and specific crRNA; the sequences of the RAA primer pair are as follows:

[0007] Upstream primer BTV-RAA-F: 5'-TAATACGACTCACTATAGTCAAACGTCATGTTAATGAACAGATTCTCC-3' (SEQ ID NO:1)

[0008] Downstream primer BTV-RAA-R: 5'-TATGAAAGTCGCACCTAGATTTACCACTCC-3' (SEQ ID NO:2);

[0009] The sequence of the specific crRNA is as follows:

[0010] 5'-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGAUUUAGACUCUUAAACCACUGCGGUAU-3' (SEQ ID NO:3).

[0011] Compared with the prior art, the nucleic acid molecule composition for detecting bluetongue virus provided by the present invention combines RAA, CRIAPR / Cas13a and a nucleic acid test strip. RAA primers and specific crRNAs are designed according to the conserved sequence of the NS3 gene of BTV. Using these primers and specific crRNAs, bluetongue virus can be accurately detected, and there is no cross-amplification reaction with foot-and-mouth disease virus (FMDV), bovine viral diarrhea virus (BVDV), peste des petits ruminants virus (PPRV), sheep pox virus (SPPV), epizootic hemorrhagic disease virus of deer (EHDV), etc., showing strong specificity; the minimum detection limit for BTV is 10 4 copies / μL, enabling early and rapid diagnosis of BTV. At the same time, the detection accuracy is high, the detection time is significantly shortened, and no special instruments and professional operators are required, making it suitable for use in institutions with relatively simple instrument conditions or at the epidemic site, and can better meet the clinical detection needs, which is of great significance for the prevention and control of BTV diseases.

[0012] Preferably, the 5' end of the upstream primer is provided with a T7 promoter.

[0013] The sequence of the T7 promoter is: TAATACGACTCACTATAG (SEQ ID NO:6).

[0014] The present invention also provides the application of the nucleic acid molecule composition described in any one of the above in the non-diagnostic detection of bluetongue virus.

[0015] The present invention also provides a general detection system for rapid detection of bluetongue virus, which comprises the nucleic acid molecule composition described in any one of the above.

[0016] Preferably, the general detection system further includes Cas13a protein, a reagent or kit for reverse transcription, and a reagent or kit for RAA amplification.

[0017] The present invention also provides the application of the above general detection system in the non-diagnostic detection of bluetongue virus.

[0018] The present invention also provides a method for detecting bluetongue virus using the above detection system. The specific operation is as follows:

[0019] S1, Extract the genomic RNA of bluetongue virus as a transcription template and reverse transcribe it into cDNA.

[0020] S2, Perform RAA amplification on the reverse transcription product using the primer pair consisting of the upstream primer BTV-RAA-F and the downstream primer BTV-RAA-R of the detection system.

[0021] S3, Add the RAA amplification product to the CRISPR-Cas13a system for incubation; the CRISPR-Cas13a system includes the specific crRNA in the detection system.

[0022] S4, Use a nucleic acid test strip to detect the incubation product of CRISPR-Cas13a.

[0023] The above method for detecting bluetongue virus has a short time consumption, simple operation, and intuitive reaction results. It can be used for the rapid detection of bluetongue virus, greatly reducing the prevention and control difficulty of BTV, and is crucial for the prevention of BTV diseases.

[0024] Preferably, in S2, the RAA amplification system includes the following reagents and dosages: 25 μL of basic buffer, 2 μL each of the upstream primer and the downstream primer, 15 μL of DNA template, 2.5 μL of magnesium acetate solution, and make up to 50 μL with purified water; among them, the concentrations of the upstream primer and the downstream primer are both 10 μmol / L.

[0025] Preferably, in S3, the CRIPSR-Cas13a system includes the following reagents and dosages: 3 μL of 25 mmol / L NTPbuffer mix, 2 μL of 40 U / μL RNase inhibitor, 1 μL of 2 μmol / L cas13a, 1 μL of 10 μmol / L crRNA, 0.25 μL of 4 μmol / L RNA double-labeled probe, 0.5 μL of 5000 U / mL T7 RNA polymerase mix, 0.5 μL of 1 mol / L magnesium chloride solution, 0.5 μL of 1 mol / L HEPES buffer, 10.25 μL of enzyme-free and sterile water, and 1 μL of RAA amplification product.

[0026] The above preferred reaction conditions can further improve the detection efficiency of Bluetongue virus.

[0027] Preferably, the reaction temperature for RAA amplification in 9.S2 is 39 °C, and the reaction time is 30 min.

[0028] Preferably, in 10.S3, the incubation temperature is 37 °C, and the incubation time is 30 min.

[0029] Furthermore, when using a nucleic acid test strip to detect the CRISPR-Cas13a incubation product, if a red band appears in the quality control area of the test strip and no red band appears in the detection area, it is indicated as positive. A positive result indicates that the amplified product contains the nucleic acid fragment to be detected; if two red bands appear on the test strip, one in the quality control area and one in the detection area, it is negative. A negative result indicates that the amplified product does not contain the detection fragment.

[0030] The present invention designs specific crRNA and RAA primers according to the relatively conserved sequence of Bluetongue virus. When crRNA recognizes the target sequence, it activates the Cas13a protein to cleave the reporter probe. With the use of a nucleic acid test strip to read the detection result, the purpose of simple, efficient, and visual detection of BTV is achieved. The RAA-CRISPR / Cas13a-nucleic acid test strip method provided by the present invention can achieve effective amplification of the target gene under the condition of 39 °C for 30 min. The test results can be judged by visual observation of the nucleic acid test strip; it has good specificity and no cross-amplification reaction with Foot-and-Mouth Disease Virus (FMDV), Bovine Viral Diarrhea Virus (BVDV), Peste des Petits Ruminants Virus (PPRV), Sheep Pox Virus (SPPV), and Epizootic Hemorrhagic Disease Virus of Deer (EHDV), etc.; the lowest detection limit for BTV is 10 4 copies / μL, which can achieve early and rapid diagnosis of BTV; it has good repeatability and stability; the clinical detection coincidence rate reaches 80%, and it can be used for the clinical rapid diagnosis and disease purification of Bluetongue disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 is a schematic flow chart of the present invention.

[0032] Figure 2 is a diagram showing the primer screening results in Example 1 of the present invention; where M: marker, 1: positive control, 2: combination of BTV-RAA-F1 and BTV-RAA-R1, 3: combination of BTV-RAA-F2 and BTV-RAA-R2, NC: negative control.

[0033] Figure 3It is the specific test result diagram of the RAA-CRISPR / Cas13a-nucleic acid test strip method in Example 2 of the present invention; among them, 1-7 are BTV, EMDV, BVDV, PPRV, SPPV, EHDV and negative control respectively.

[0034] Figure 4 It is the sensitivity test result diagram of the RAA-CRISPR / Cas13a-nucleic acid test strip method in Example 3 of the present invention; among them, a and b are the RAA amplification electrophoresis diagram and the nucleic acid test strip detection result diagram respectively; in a, M: marker, 1-10 are 10 9 -10 1 copies / μL plasmid template and negative control; in b, 1-10 are 10 9 -10 1 copies / μL plasmid template detection result and negative control.

[0035] Figure 5 It is the repeatability test result diagram of the RAA-CRISPR / Cas13a-nucleic acid test strip method in Example 4 of the present invention; among them, 1-3: 10 9 copies / μL, 4-6: 10 7 copies / μL, 7-9: 10 5 copies / μL are plasmid templates, and NC is the negative control. Detailed implementation manners

[0036] In order to make the purpose, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described here are only used to explain the present invention and are not used to limit the present invention.

[0037] In order to better illustrate what is provided in the embodiments of the present invention, further illustrative examples will be given below through embodiments.

[0038] Example 1

[0039] 1. Materials and methods

[0040] 1.1 Virus samples and kits

[0041] Baby hamster kidney 21 cells (BHK-21), primary ovine pulmonary microvascular endothelial cells, virus samples infected with BTV for 8h, 10h, 12h, 18h, 24h, BTV-NS3 plasmid standard, foot-and-mouth disease virus (FMDV), bovine viral diarrhea virus (BVDV), peste des petits ruminants virus (PPRV), sheep pox virus (SPPV) and epizootic hemorrhagic disease virus of deer (EHDV) inactivated nucleic acid samples are stored in this laboratory.

[0042] The viral nucleic acid extraction kit was purchased from Beijing Quanshijin Biotechnology Co., Ltd., the viral reverse transcription kit was purchased from Nanjing Novogene Biotechnology Co., Ltd., the RAA nucleic acid amplification kit (basic type) was purchased from Hangzhou Zhongce Biotechnology Co., Ltd., the CRISPR / Cas13aDNA detection kit (two-step method) (liquid) (constant temperature-test strip type) was purchased from Shenzhen Yizhi Biotechnology Co., Ltd., and the nucleic acid test strips (nucleic acid test strips-elimination method (for CRISPR SHERLOCK)) were purchased from Shenzhen Yizhi Biotechnology Co., Ltd.; RAA amplification primer pairs and crRNA were commissioned to BGI Liuhe Biotechnology Co., Ltd. for synthesis.

[0043] The conventional PCR instrument is a product of Bio-Rad; the real-time fluorescence quantitative PCR instrument is a product of Hangzhou Biori Technology Co., Ltd. (China); and the DK-8D electric constant temperature water bath is a product of Shanghai Senxin Experimental Instrument Co., Ltd.

[0044] 1.2 Plasmid and nucleic acid extraction

[0045] The DNA of the BTV-NS3 plasmid standard was extracted using a plasmid extraction kit and stored at -20°C for future use; the nucleic acids of BTV, EMDV, BVDV, PPRV, SPPV, and EHDV were extracted using a viral genome DNA / RNA extraction kit, and BTV, EMDV, BVDV, PPRV, and EHDV were reverse transcribed into cDNA and stored at -20°C for future use.

[0046] 1.3 Design of primers and crRNA

[0047] Two pairs of specific RAA primers were designed according to the NS3 gene sequence of bluetongue virus, BTV-RAA-F1 (SEQ ID NO: 1), BTV-RAA-R1 (SEQ ID NO: 2), BTV-RAA-F2 (SEQ ID NO: 4), and BTV-RAA-R2 (SEQ ID NO: 5). The primer sequences designed by adding the T7 RNA polymerase initiation sequence (TAATACGACTCACTATAG, SEQ ID NO: 6) to the 5' end of the upstream primer are shown in Table 1. RAA amplification primers and crRNA were synthesized by BGI Liuhe Biotechnology Co., Ltd.

[0048] Table 1 Primers and probes

[0049]

[0050] Using the BTV plasmid standard as a template, RAA amplification was performed. The reaction system was 50 μL, including 25 μL of basic buffer, 2 μL each of the upstream primer and the downstream primer, 15 μL of DNA template, 2.5 μL of magnesium acetate solution, and purified water was added to make up to 50 μL. Amplification was carried out at 39 °C for 30 min. The amplification product was purified with 50 μL of extraction solution (phenol:chloroform:isoamyl alcohol = 25 μL:24 μL:1 μL), and the result was observed by 1% agarose gel electrophoresis to screen out the best primer pair. The results are as Figure 2 shown.

[0051] The results showed that the amplification efficiency of the BTV-RAA-F1 / R1 primer combination was higher than that of BTV-RAA-F2 / R2. Therefore, BTV-RAA-F1 / R1 was selected as the best primer.

[0052] 1.4 Detection system for detecting bluetongue virus Establishment of a method for detecting bluetongue virus

[0053] The above detection system for bluetongue virus includes an RAA reaction system and a CRISPR / Cas13a-nucleic acid test strip reaction system.

[0054] RNA of the virus to be detected was extracted as a template and reverse transcribed into cDNA. A 50 μL RAA reaction system was prepared: 25 μL of basic buffer, 2 μL each of the upstream primer and the downstream primer, 15 μL of DNA template, 2.5 μL of magnesium acetate solution, and purified water was added to make up to 50 μL. It was placed in a common PCR instrument and subjected to isothermal amplification reaction at 39 °C for 30 min.

[0055] A 20 μL CRISPR-Cas13a system was prepared: 3 μL of 25 mmol / L NTP buffer mix, 2 μL of 40 U / μL RNase inhibitor, 1 μL of 2 μmol / L cas13a, 1 μL of 10 μmol / L crRNA, 0.25 μL of 4 μmol / L RNA double-labeled probe, 0.5 μL of 5000 U / mL T7 RNA polymerase mix, 0.5 μL of 1 mol / L magnesium chloride solution, 0.5 μL of 1 mol / L HEPES buffer, 10.25 μL of enzyme-free and sterile water, and 1 μL of RAA amplification product. The above reactants were fully mixed and incubated at 37 °C for 30 min. Subsequently, the binding pad end of the Cas13a-specific nucleic acid test strip was inserted into the reaction tube, and the quality control line and the detection line were observed under natural light to interpret the result. According to the interpretation result, it was determined whether the sample to be detected contained bluetongue virus.

[0056] When there is only one red band in the quality control area, the recorded result is positive. When two bands appear on the test strip, one in the quality control area and the other in the test area, the recorded result is negative.

[0057] Table 2 Primers and specific crRNA

[0058] Primer Name Primer Sequence (5'-3') BTV-RAA-F TCAAACGTCATGTTAATGAACAGATTCTCC BTV-RAA-R TATGAAAGTCGCACCTAGATTTACCACTCC BTV-crRNA GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGAUUUAGACUCUUAAACCACUGCGGUAU

[0059] Example 2

[0060] Specificity test

[0061] Using primers BTV-RAA-F, BTV-RAA-R and specific crRNA, with the DNA of SPPV and the cDNA of EMDV, BVDV, PPRV, EHDV and the BTV-NS3 plasmid standard as templates, ddH 2 O was used as the negative control, and RAA-CRISPR / Cas13a-nucleic acid test strip detection was carried out. The detection results were observed to verify the specificity of the reaction.

[0062] The detection results are as Figure 3 shown. It can be seen from the figure that only the amplification product with the BTV-NS3 plasmid standard as the template can observe a red line on the test strip that meets the positive judgment standard, and two red lines of the negative judgment standard appear on the corresponding test strips of the other viruses. It is proved that the RAA-CRISPR / Cas13a-nucleic acid test strip detection method has good specificity for detecting BTV.

[0063] Example 3

[0064] Sensitivity test

[0065] 3.1 Extract plasmid

[0066] Use a plasmid miniprep kit to extract the plasmid.

[0067] Calculate the number of DNA copies contained in the plasmid per unit volume according to Moore's law:

[0068] Plasmid copy number (copies / μL) = [governance concentration (g / μL) × 10 23 / {[vector length (bp) + fragment length (bp) × 660 g / mol]}

[0069] The standard plasmid was diluted to 10 9 -10 1 copies / μL by 10-fold dilution method and stored at -20 °C for later use.

[0070] 3.2 Sensitivity test

[0071] Using diluted BTV-NS3 standard plasmids at different concentrations (10 9 -10 1 copies / μL) as templates, with ddH 2 O as the negative control, the RAA-CRISPR / Cas13a-nucleic acid test strip detection method was used to determine the lowest detection limit.

[0072] The sensitivity evaluation results showed that the lowest limit of RAA amplification was 10 1 copies / μL, and the lowest detection limit of the RAA-CRISPR / Cas13a-nucleic acid test strip detection method was 10 4 copies / μL. The results are as Figure 4 shown.

[0073] Example 4

[0074] Repeatability test

[0075] Using the above RAA-CRISPR / Cas13a-nucleic acid test strip detection method, with BTV standard plasmids at different concentrations (10 9 copies / μL, 10 7 copies / μL, 10 5 copies / μL) as templates, each concentration was repeated 3 times, and ddH 2 O was set as the negative control to test the repeatability of the test method. The results are as Figure 5 shown.

[0076] The results of the repeatability test showed that the standard treatments at different concentrations were all positive, and the control group was negative, indicating that the detection method had good repeatability and stability.

[0077] Example 5

[0078] Clinical sample detection

[0079] Using the qPCR method and the RAA-CRISPR / Cas13a-nucleic acid test strip detection method respectively, 15 samples of baby hamster kidney 21 cells (BHK-21) infected (infected for 8h, 10h, 12h, 18h, 24h respectively, 3 samples for each type of cell) and 15 samples of primary sheep pulmonary microvascular endothelial cells infected (infected for 8h, 10h, 12h, 18h, 24h respectively, 3 samples for each type of cell). Based on the qPCR method, the coincidence rate of the two methods was calculated. The results are shown in Table 3.

[0080] Coincidence rate (%) = (total number of positive samples + total number of negative samples in the two methods being compared) / total number of samples

[0081] Table 3 Detection results of clinical samples

[0082]

[0083] According to the test results of clinical samples by BTV, 12 positive samples were detected by the RAA-CRISPR / Cas13a-nucleic acid test strip detection method, and the coincidence rate with the qPCR method was 80%, indicating that the RAA-CRISPR / Cas13a-nucleic acid test strip detection method has accurate detection ability and can be used for clinical detection.

[0084] In summary, through the designed primer and specific crRNA combination, the present invention has established a detection method for Bluetongue virus (RAA-CRISPR / Cas13a-nucleic acid test strip). This method can rapidly amplify at 39 °C, and the detection of the target gene can be completed 30 minutes after the reaction. The detection result can be observed within 3 - 5 minutes after dropping the reaction product onto the nucleic acid test strip. Moreover, the method has strong specificity, high sensitivity, the lowest detection limit can reach 10 4 copies / μL, good accuracy, and compared with the conventional qPCR, it has a relatively simple detection instrument, shorter time consumption, rapid detection, realizes the rapid nucleic acid amplification detection of BTV, and provides a reliable guarantee for the early clinical detection and epidemiological investigation of BTV.

[0085] The above are only the embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, or improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A nucleic acid molecule composition for detecting bluetongue virus based on RAA-CRISPR / CasI3a, characterized in that: It includes a RAA primer pair and a specific cr RNA; the sequence of the RAA primer pair is as follows: Upstream primer BTV-RAA-F: 5′-TCAAACGTCATGTTAATGAACAGATTCTCC-3′; Downstream primer BTV-RAA-R: 5′-TATGAAAGTCGCACCTAGATTTACCACTCC-3′; The sequence of the specific crRNA is: 5'-GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGAUUUAGACUCUUAAACCACUGCGGUAU-3'.

2. Use of the nucleic acid molecule composition according to claim 1 in non-diagnostic detection of bluetongue virus.

3. A universal detection system for detecting bluetongue virus, characterized in that: The invention comprises the nucleic acid molecule composition according to claim 1.

4. The universal detection system according to claim 3, characterized in that: The detection system also includes Cas13a protein, a reagent or kit for reverse transcription, and a reagent or kit for RAA amplification.

5. Use of the universal detection system according to claim 3 or 4 in non-diagnostic detection of bluetongue virus.

6. A method for detecting bluetongue virus using the universal detection system according to claim 3 or 4, characterized in that: The specific operations are: S1, extract the genomic RNA of bluetongue virus as a transcription template and reverse transcribe it into cDNA; S2, performing RAA amplification on the reverse transcription product using a primer pair consisting of an upstream primer BTV-RAA-F and a downstream primer BTV-RAA-R of the detection system; S3, adding the RAA amplification product to the CRISPR-Cas13a system for incubation; the CRISPR-Cas13a system includes the specific crRNA in the detection system; S4, use nucleic acid test strips to detect the incubation products of CRISPR-Cas13a.

7. The method for detecting bluetongue virus according to claim 6, characterized in that: In S2, the RAA amplification system includes the following reagents and amounts: 25 μL of basic buffer, 2 μL of upstream primer and downstream primer respectively, 15 μL of DNA template, 2.5 μL of magnesium acetate solution, and purified water supplemented to 50 μL; wherein the concentrations of the upstream primer and downstream primer are both 10 μmol / L.

8. The method for detecting bluetongue virus according to claim 6, characterized in that: In S3, the CRIPSR-Cas13a system includes the following reagents and dosages: 25mmol / L NTP buffer mix 3μL, 40U / μL RNase inhibitor 2μL, 2μmol / L cas13a 1μL, 10μmol / L crRNA 1μL, 4μmol / L RNA dual-labeled probe 0.25μL, 5000U / mL T7RNA polymerase mix 0.5μL, 1mol / L magnesium chloride solution 0.5μL, 1mol / L HEPES buffer 0.5μL, enzyme-free sterile water 10.25μL and RAA amplification product 1μL.

9. The method for detecting bluetongue virus according to claim 6, characterized in that: The reaction temperature for RAA amplification in S2 was 39°C and the reaction time was 30 min.

10. The method for detecting bluetongue virus according to claim 6, characterized in that: In S3, the incubation temperature is 37° C. and the incubation time is 30 min.

Images