Broad-spectrum avibacterium paragallinarum protective antigen and application thereof

By using the protective antigen protein prepared by parachyx protein p1, parachyx subunit vaccine and polyclonal antibodies were developed, which solved the problem of insufficient cross-protection and severe stress response of traditional vaccines in preventing and controlling infectious rhinitis in chickens, and achieved efficient protection of the three serotypes parachyx parachyx.

CN120136983AActive Publication Date: 2025-06-13YANGZHOU UNIV
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510279285.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-11
Publication Date
2025-06-13
Estimated Expiration
2045-03-11

AI Technical Summary

Technical Problem

Traditional whole-bacterial inactivated vaccines have problems with insufficient cross-protection and severe stress response in preventing and controlling infectious rhinitis in chickens. Due to the mismatch between the vaccine strain and the epidemic strain, cases of immune failure occur frequently.

Method used

The broad-spectrum parachyx protective antigen protein was prepared by using parachyx protein p1, and based on this, a subunit vaccine and polyclonal antibodies were developed to provide a 90% protection rate for the three serotypes parachyx parachyx.

Benefits of technology

This method significantly improves the protection of paracarynx, reduces side effects, and effectively prevents infection of paracarynx.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120136983A_ABST
    Figure CN120136983A_ABST
Patent Text Reader

Abstract

The invention discloses a broad-spectrum avibacterium paragallinarum protective antigen and application thereof, and belongs to the field of prevention and control of poultry infectious diseases. The invention provides an application of an avibacterium paragallinarum protein p1 in preparation of a broad-spectrum avibacterium paragallinarum protective antigen protein. The amino acid sequence of the avibacterium paragallinarum protein p1 is as shown in SEQ ID No. 1. The protective antigen protein has strong immunogenicity and reactogenicity, and a subunit vaccine prepared by using the antigen protein can provide 90% protection rate for avian paragallinarum of three serotypes A, B and C, and can effectively prevent infection of the avian paragallinarum.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a broad-spectrum protective antigen of Avibacterium paragallinarum and its application, belonging to the field of prevention and control of poultry infectious diseases. Background Art

[0002] Infectious coryza in chickens is an acute respiratory disease caused by Avibacterium paragallinarum, mainly manifested as inflammation of the nasal cavity and paranasal sinuses, and facial swelling, which can cause poor growth of growing chickens, a decrease in egg production rate of laying hens, and an increase in mortality. This disease spreads widely worldwide, causing serious economic losses to the chicken farming industry.

[0003] In the context of reducing and eliminating the use of antibiotics, vaccination has become the main strategy for preventing and controlling IC. In the 1960s, Japanese scholars first prepared an inactivated vaccine against serotype A of Avibacterium paragallinarum. With the isolation and prevalence of serotype C strains, a bivalent (A + C) inactivated vaccine was also developed and marketed. In recent years, all three serotypes A, B, and C have been prevalent in China, and a trivalent (A + B + C) inactivated vaccine has been widely used in many farms. However, there is no cross-protection among different serotypes of traditional whole-bacterium inactivated vaccines, and severe stress reactions often occur after vaccination. Secondly, due to reasons such as the mismatch between vaccine strains and prevalent strains, and mutations of bacteria, cases of immune failure frequently occur clinically. Therefore, there is an urgent need for an infectious coryza vaccine for chickens with broad-spectrum protective effects and few side effects. Summary of the Invention

[0004] Object of the Invention: The object of the present invention is to provide an application of Avibacterium paragallinarum protein p1 in the preparation of a protective antigen protein of Avibacterium paragallinarum, as well as a subunit vaccine and polyclonal antibody of Avibacterium paragallinarum prepared based on the above-mentioned protective antigen protein of Avibacterium paragallinarum.

[0005] Technical Solution: The present invention provides an application of Avibacterium paragallinarum protein p1 in the preparation of a broad-spectrum protective antigen protein of Avibacterium paragallinarum, and the amino acid sequence of the Avibacterium paragallinarum protein p1 is shown as SEQ ID No.1.

[0006] SEQ ID NO.1: MKLACPLNFPLKTTALLVISVCSSKALYAEEISSSTEYMAVLPTIDVVTTQETANTKGYVGYEEAQATRNLLTIKEMPQTIDVINIQKNKNYGTNDLSSILEGNAGVDATYDMRGENIYLRGFQADANDIYRDGIRESGQVRRSTANIERVEILKGPSSILYGRSNGGGVINMVSKFANFTTSRNIGVTYGSWNSRSVNLDVNQKINENVAVRLTSELSAAEAYRYGVRSKGRMFSPSISLQSDDGRLQWVGQYTYDYQWRIPDRNPAKSVYDEMGIGYRNSFFRDGDYVDDKLQVWRSDLKYFINDQWLVNWQLAYRQADQDFDHYFAGTYSATDKTLKQSYAWQKTRNKTFTNNITFNGEFDTASLKHKVTIGLDYSQEERHPILAVLRNQKIDPFLSRYQWPARQHPNATVNNRHKAYSTGIFVQDLISLTDNVKVLLGGRYDFYRFNSTNIKQERRDTKGHSFSPNVGVVWEVTPEHTLYASFNRSFSPYGGRSYLGISTDQKDVFNASPEYNQQYEVGIKSDWFNRTLTTTLSAYQLERRNIRYRPNKDILDVWAVRGKDQSKGVELSLLGQLAPKWYIRSSVGWMVAKIKEDKQNPQNNNRTLNNTGNFTSNLFVRYVPVEKFYLETGLTHLGKRYYFNGNQQTILPSFTRVDAMVGYNLNPVNITFAVSNLFNKTYWRSDSMPGNPRSFNLRLTYMF。

[0007] Furthermore, the gene sequence encoding the Avibacterium paragallinarum protein p1 is shown in SEQ ID No.2.

[0008]

[0009] Furthermore, the broad-spectrum Avibacterium paragallinarum protective antigen protein is prepared by the following steps: amplifying the coding gene of the Avibacterium paragallinarum protective antigen protein; introducing the coding gene fragment into an expression vector to obtain a recombinant expression vector; introducing the recombinant expression vector into a protein expression host bacterium to obtain a recombinant bacterium, culturing the recombinant bacterium, inducing protein expression and purifying to obtain the Avibacterium paragallinarum protective antigen protein.

[0010] Furthermore, the primer sequences used for amplifying the coding gene of the Avibacterium paragallinarum protective antigen protein are shown in SEQ ID No.3-4.

[0011] SEQ ID No.3: CTCGGATCCGAGGAAATTTCTTCATCAACAG.

[0012] SEQ ID No.4: CGCGTCGACGAACATATACGTCAAACGCAAATT.

[0013] The present invention also provides an Avibacterium paragallinarum subunit vaccine, and its active ingredient includes the Avibacterium paragallinarum protective antigen protein with the amino acid sequence shown in SEQ ID No.1.

[0014] Furthermore, the final concentration of the Avibacterium paragallinarum protective antigen protein in the Avibacterium paragallinarum subunit vaccine is 500 μg / mL.

[0015] The present invention also provides a polyclonal antibody obtained by immunizing an animal with the above-mentioned Avibacterium paragallinarum subunit vaccine.

[0016] Furthermore, the immunization method used is: after the first immunization by injecting the Avibacterium paragallinarum subunit vaccine into the animal, a booster immunization is carried out 2 weeks later. Each time, 50 μg / animal of the vaccine is injected. The serum is collected 14 days after the booster immunization to obtain the polyclonal antibody.

[0017] Furthermore, the titer of the polyclonal antibody is 1:819200.

[0018] The present invention also provides the application of the above-mentioned polyclonal antibody in the preparation of drugs or preparations for inhibiting / killing Avibacterium paragallinarum.

[0019] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages: The present invention provides an immunoprotective antigen protein against Avibacterium paragallinarum of serotypes A, B, and C. The immunogenicity of this antigen protein is strong. The subunit vaccine prepared using this antigen protein can provide a 90% protection rate for chickens against Avibacterium paragallinarum of serotypes A, B, and C, and can effectively prevent the infection of Avibacterium paragallinarum. Description of the Drawings

[0020] Figure 1 It is the map of the constructed recombinant prokaryotic expression vector pET-32a-p1.

[0021] Figure 2 It is the PCR amplification result of the coding gene of the recombinant protein p1 of the present invention. In the figure, M is the DNA molecular weight standard, and 1 is the target gene fragment.

[0022] Figure 3 It is the SDS-PAGE analysis diagram of the recombinant protein of the present invention. Among them, M is the protein molecular weight standard. 1: Whole bacteria after induction of pET-32a-p1. 2: Supernatant after induction and lysis of pET-32a-p1. 3: Precipitate after induction and lysis of pET-32a-p1.

[0023] Figure 4 It is the SDS-PAGE analysis diagram of the purification of the recombinant antigen protein of the present invention. Among them, M is the protein molecular weight standard. 1: Filtration sample of the recombinant protein through Ni column. 2: Washing sample of the recombinant protein through Ni column. 3, 4: Elution samples of the recombinant protein through Ni column.

[0024] Figure 5 It is the Western-blot detection result of the immune protective antigen protein of the present invention and the positive serum of Avibacterium paragallinarum. Among them, A is the Western-blot detection result of the immune protective antigen protein of the present invention and the positive serum against Avibacterium paragallinarum type A. B is the Western-blot detection result of the immune protective antigen protein of the present invention and the positive serum against Avibacterium paragallinarum type B. C is the Western-blot detection result of the immune protective antigen protein of the present invention and the positive serum against Avibacterium paragallinarum type C. M is the protein molecular weight standard. 1: p1 protein.

[0025] Figure 6 It is the determination result of the bactericidal effect of the polyclonal antibody of the present invention in vitro. Among them, A is the bactericidal effect of the polyclonal antibody against Avibacterium paragallinarum type A. B is the bactericidal effect of the polyclonal antibody against Avibacterium paragallinarum type B. C is the bactericidal effect of the polyclonal antibody against Avibacterium paragallinarum type C.

[0026] Figure 7 It is the determination result of the bacteria excretion amount of the experimental chickens after challenge. Among them, A is the bacteria excretion amount result after challenge with Avibacterium paragallinarum type A. B is the bacteria excretion amount result after challenge with Avibacterium paragallinarum type B. C is the bacteria excretion amount result after challenge with Avibacterium paragallinarum type C.

[0027] Figure 8 It is the clinical symptom score of the experimental chickens after challenge. Among them, A is the clinical symptom score of the experimental chickens after challenge with Avibacterium paragallinarum type A. B is the clinical symptom score of the experimental chickens after challenge with Avibacterium paragallinarum type B. C is the clinical symptom score of the experimental chickens after challenge with Avibacterium paragallinarum type C.

[0028] Figure 9 It is the reference standard for clinical symptom scoring. Among them, 1: 1 point, mild symptoms (mild facial swelling); 2: 2 points, moderate symptoms (moderate facial swelling); 3: 3 points, severe symptoms (severe facial swelling). Detailed implementation manners

[0029] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0030] Example 1 Construction of recombinant prokaryotic expression vector pET-32a-p1

[0031] 1. PCR amplification of p1 nucleic acid sequence

[0032] The gene coding sequence of the immunoprotective antigen protein p1 is shown in Seq ID No.1.

[0033] The upstream and downstream primers were designed according to the base sequence of the coding gene of p1 (Seq ID No.2), and BamH I and Sal I restriction enzyme sites were introduced into the upstream and downstream primers respectively. The primer sequences are shown in Seq ID No.3 - 4, and the primers were synthesized by Nanjing GenScript Biotech Co., Ltd.

[0034] Using the genomic DNA of Avibacterium paragallinarum 2019 / JS80 as a template for PCR amplification.

[0035] Table 1 Reaction system

[0036]

[0037] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 5 min, annealing at 56°C for 30 s, extension at 72°C for 2 min, for 30 cycles; then extension at 72°C for 2 min, and preservation at 4°C. The PCR product was identified by 1% agarose gel electrophoresis, and the target band was recovered using the DNA gel extraction kit from Beijing ComWin Biotech Co., Ltd.

[0038] 2. Enzyme digestion and recovery of PCR product

[0039] The above PCR product was digested with restriction enzymes Sal I and BamH I.

[0040] Table 2 Enzyme digestion system

[0041]

[0042] Reaction conditions: 37°C for 2 h.

[0043] After separating all the enzyme digestion products by 1% agarose gel electrophoresis, use the DNA gel extraction kit from Beijing ComWin Biotech Co., Ltd. to recover the DNA fragments according to the steps in the kit instruction manual. The recovered target DNA fragments can be used immediately or stored at -20°C for later use.

[0044] 3. Digestion and Recovery of Expression Vector

[0045] Double digest the expression vector pET-32a (purchased from Novegen, catalog number 69015) with the restriction endonucleases Sal I and BamH I, and recover the product after agarose gel electrophoresis.

[0046] 4. Ligation of Target Fragment and Vector

[0047] Ligate the target DNA fragment recovered and purified in step 2 and the expression vector pET-32a fragment recovered and purified in step 3 to obtain the recombinant plasmid pET-32a-p1.

[0048] Table 3 Ligation System

[0049]

[0050] Ligation Condition: 25°C for 2 h.

[0051] 5. Transformation and Screening of Clones

[0052] Take 50 μL of Escherichia coli Trans1-T1 competent cells, add 5 μL of the ligation product obtained in step 4 to the competent cells. After ice-bathing for 30 min, heat shock at 42°C for 30 s, then ice-bathe again for 3 min. Add 400 μL of antibiotic-free LB medium, shake culture at 37°C for 1 h, centrifuge at 5000 r / min for 4 min, discard the supernatant, resuspend the cells with 100 μL of medium and spread them on an LB agar plate containing 50 μg / ml ampicillin, and incubate in a 37°C constant temperature incubator for 12 h.

[0053] 6. Enzyme Digestion Identification of Recombinant Plasmid

[0054] Pick a single colony grown on the plate and inoculate it into an LB liquid medium containing 50 μg / mL ampicillin. Incubate it at 37 °C with shaking at 220 rpm for 12 h. Use the bacterial solution as a template, and S.tag and T7ter (the sequences are shown in SEQ ID No.5 - 6, SEQ ID No.5: GAACGCCAGCACATGGAC, SEQ ID No.6: TGCTAGTTATTGCTCAGCGG) as primers for bacterial solution PCR identification. Identify positive clones by agarose gel electrophoresis, collect the positive clone bacteria with the correct band size, and use the plasmid extraction kit of Beijing ComWin Biotech Co., Ltd. to extract the recombinant plasmid. Use Sal I and BamH I to digest and identify the recombinant plasmid. After digestion, the bands of the target fragment and vector fragment with the expected size appear, which is the correct recombinant plasmid. Send the recombinant plasmid with correct double digestion identification for sequencing identification. The map of the recombinant vector pET-32a-p1 is as Figure 1 shown. The PCR identification result is as Figure 2 shown.

[0055] 7. Construction of expression bacteria

[0056] Take 50 μL of competent cells BL21(DE3), add 0.5 μL of the correctly identified recombinant plasmid pET-32a-p1 to the competent cells and mix well. After placing it on ice for 30 min, heat shock at 42 °C for 90 s. After ice bath for 3 min again, add 400 μL of antibiotic-free LB medium and incubate at 37 °C with shaking for 1 h. Centrifuge at 5000 r / min for 4 min, discard the supernatant, resuspend the bacteria with 100 μL of medium and spread it on an LB agar plate containing 50 μg / ml ampicillin, and incubate it in a 37 °C constant temperature incubator for 12 h. Pick a single clone on the plate for culture and identify it by bacterial solution PCR. Mix the correctly identified recombinant bacteria and 60% glycerol in a ratio of 3:1 and store it at -70 °C.

[0057] Example 2 Expression of target gene in Escherichia coli and purification of recombinant protein

[0058] 1. Induced expression of recombinant protein

[0059] Inoculate the positive clone containing the recombinant plasmid pET-32a-p1 into 5 mL of LB liquid medium containing 50 μg / mL ampicillin and incubate it overnight at 37 °C with shaking. Then inoculate it into 5 mL of LB medium with ampicillin resistance at a ratio of 1:100 for culture. When the OD 600 reaches 0.4, add IPTG with a final concentration of 1 mmol / L and continue to culture for 5 h.

[0060] 2. SDS-PAGE electrophoresis analysis of expression products

[0061] Collect the bacteria after inducing at 12,000 r / min for 10 min, ultrasonically lyse for 10 min, then centrifuge to separate the supernatant and precipitate. Add 6×SDS Buffer to each and boil for 10 min to prepare samples for SDS-PAGE.

[0062] Keep the electrophoresis voltage constant at 200 V and run electrophoresis for 90 min. After electrophoresis, remove the gel, stain it with Coomassie Brilliant Blue staining solution for 2 h, and then decolorize it with decolorizing solution until the background is clear.

[0063] The results are as Figure 3 shown. After inducing Escherichia coli containing the positive recombinant plasmid with 1 mmol / L IPTG at 37 °C for 5 h and detecting by SDS-PAGE, a protein target band appears at the expected position, which is consistent with the expected protein size, and the recombinant protein p1 is expressed in both the supernatant and the precipitate.

[0064] 3. Large-scale preparation and purification of recombinant protein

[0065] Inoculate the frozen recombinant expression bacteria into liquid LB medium containing ampicillin resistance at a ratio of 1:100 and culture overnight. After overnight culture, inoculate into 800 mL of liquid LB medium containing ampicillin resistance at the same ratio and culture for about 3 h. When OD 600 reaches 0.4, add IPTG with a final concentration of 1 mmol / L to induce for 5 h. After induction, centrifuge at 8000 r / min for 10 min, discard the supernatant, resuspend the bacteria with PBS, ultrasonically lyse for 30 min, and then centrifuge at 8000 r / min for 10 min. Dissolve the precipitate in LE Buffer at 4 °C overnight. The supernatant after dissolving the inclusion bodies is purified by nickel affinity chromatography column. The specific process is as follows: Pipette 1 mL of the medium into the column to let the medium settle freely, drain the storage solution, add 4 column volumes of equilibration buffer to equilibrate the chromatography medium, add the sample to the equilibrated Ni-NTA resin and let the sample flow out slowly (if necessary, repeat this step 2 - 3 times), wash the packing with equilibration buffer, and elute the target protein with imidazole at different concentrations. Collect the eluted effluent and then perform SDS-PAGE electrophoresis detection ( Figure 4 ), and it can be seen that there is a band at the predicted size position of the target protein.

[0066] Example 3 Characterization analysis of recombinant antigen protein

[0067] 1. Analyze the reactivity of the recombinant antigen protein by Western-blot method

[0068] Inactivated vaccines were prepared using the standard strains of Avibacterium paragallinarum 221 (serotype A), Spross (serotype B), and H-18 (serotype C), respectively, to immunize SPF chickens to obtain positive sera of serotypes A, B, and C. Using these as primary antibodies, the immunoreactivity of the purified p1 protein was verified by Western-Blot.

[0069] The results showed that the p1 protein could react with the positive sera of Avibacterium paragallinarum of the three serotypes A, B, and C, and had good immunoreactivity ( Figure 5 ).

[0070] 2. Preparation of polyclonal antibodies against the recombinant protein

[0071] (1) Preparation of the vaccine and immunization experiment

[0072] Preparation of the recombinant antigen protein vaccine: The recombinant antigen protein p1 was mixed and emulsified with white oil adjuvant at a ratio of 1:2. The concentration of the recombinant antigen protein p1 in the mixed vaccine was 500 μg / mL.

[0073] Immunization method: Sixty 21-day-old SPF chickens (purchased from Boehringer Ingelheim Vetmedica GmbH) were evenly divided into the p1 immunization group and the control group. The p1 immunization group was injected with the subunit vaccine (50 μg / chicken) into the leg muscle. Two weeks later, a booster immunization (50 μg / chicken) was given. Blood was collected from the wing vein 14 days after the booster immunization to isolate the serum, and polyclonal antibodies were obtained.

[0074] (2) Determination of the titer of polyclonal antibodies

[0075] The titer of the antibodies produced after immunization with the p1 protein was determined by the indirect ELISA method. The protein was diluted to 1 μg / mL with the coating buffer. After assembling the enzyme-linked immunosorbent assay (ELISA) plates, 100 μL of the antigen protein was added to each well and incubated overnight at 4°C for coating. After adding 100 μL of PBST to each well, the plates were placed on a shaker and shaken for 5 min for washing, and this was repeated three times. Subsequently, 100 μL of 5% skim milk was added to each well and incubated in a 37°C incubator for 2 h for blocking. The skim milk in the wells was discarded, and the plates were washed three times with PBST. 100 μL of serum was added to each well and incubated at 37°C for 1 h. Subsequently, the liquid in the wells was discarded and the plates were washed three times with PBST. 100 μL of the enzyme-labeled secondary antibody (HRP-rabbit anti-chicken) diluted 1:5000 was added. Incubate at 37°C for 1 h. The secondary antibody in the wells was removed, and the plates were washed 3 times with PBST. After blotting dry, 100 μL of the TMB substrate chromogenic solution was added to each well and incubated at 37°C in the dark for 15 min. 50 μL of the stop solution was added to each well, and immediately the OD 450 value was read using an enzyme-linked immunosorbent assay reader. The results showed that the titer of the polyclonal antibody of the present invention was 1:819200, and it was named p1 polyclonal antibody.

[0076] Example 4 Serum bactericidal experiment

[0077] Avibacterium paragallinarum 2024JS01 (serotype A), 2019JS31 (serotype B), and 2023JS02 (serotype C) were cultured to the logarithmic growth phase, and the bacterial suspension was diluted to 10 5 CFU / mL with the medium. The positive sera of Avibacterium paragallinarum of serotypes A, B, and C, the negative serum of Avibacterium paragallinarum, and the p1 polyclonal antibody were inactivated at 56 °C for 30 min, then 190 μL was added to a 1.5 mL EP tube respectively, and then 10 μL of the bacterial suspension of Avibacterium paragallinarum of serotypes A, B, and C with a concentration of 10 5 CFU / mL was added. After mixing, it was incubated at 37 °C for 30 min, 190 μL of negative serum as the complement source or PBS was added, and after mixing, it was incubated at 37 °C for 60 min. 100 μL was taken and spread on TSA plates, and 3 replicates were made in parallel for each dilution. After culturing for 12 h, the colonies were counted. At the same time, the positive serum of Avibacterium paragallinarum was set as the positive control group, and the negative serum of Avibacterium paragallinarum was set as the negative control group, and the experiment was repeated three times. The results are as Figure 6 shown. The bactericidal efficiency of the polyclonal antibody of the present invention against Avibacterium paragallinarum serotype A was 63.65%, against serotype B was 60%, and against serotype C was 69.8%.

[0078] Example 5 Subunit Vaccine Immunization Challenge Protection Test

[0079] 1. Challenge Test

[0080] The experimental chickens 2 weeks after booster immunization were subjected to a challenge test. The immunized group and the control group were each divided into 3 groups, and were challenged with Avibacterium paragallinarum strains 2024JS01 (serotype A), 2019JS31 (serotype B), and 2023JS02 (serotype C) respectively. The challenge dose was 10 6 CFU / chicken, and the challenge method was intranasal drip. The chickens were continuously observed for one week after challenge, and the clinical morbidity (runny nose, swollen face, etc.) of the experimental chickens was recorded to evaluate the immune protection of the subunit vaccine. The results are shown in Table 4. Within 7 days after challenge, only one chicken in each of the three immunized groups showed symptoms of infectious coryza in chickens, and the score was lower than that of the control group ( Figure 7 ). The scoring criteria are as Figure 9 .

[0081] Table 4 Immunoprotection Rate of Subunit Vaccine

[0082]

[0083]

[0084] Table 4 lists the results of the challenge experiments with different serotypes of *Avibacterium paragallinarum*. The experimental chickens were immunized with the subunit vaccine of the present invention. 14 days after the second immunization, the chickens were challenged with three serotypes of *Avibacterium paragallinarum* respectively. All the chickens in the non-immunized control group developed the disease successively, and the protection rate was 0. Only one chicken in the p1 subunit vaccine immunized group showed rhinitis symptoms after challenge, and the protection rate was 90%. Thus, it can be seen that the subunit vaccine prepared with the immunoprotective antigen protein provided by the present invention has a significant immunization effect and has a broad-spectrum protective effect against three serotypes of *Avibacterium paragallinarum*.

[0085] 2. Determination of the amount of bacteria excreted after challenge

[0086] On the 3rd, 5th, and 7th days after challenge, throat swabs of the experimental chickens in each group were collected for determining the amount of bacteria excreted by the experimental chickens. The HagA gene of *Avibacterium paragallinarum* was amplified (the sequences are shown in SEQ ID No.7-8, SEQ ID No.7: GTAGCGAAGCAGCCAACTTA, SEQ ID No.8: TGGGTTCGCTTCACCATAAC), and ligated to the T3 vector (purchased from Beijing TransGen Biotech Co., Ltd., product number CT301-01) to construct the standard plasmid T3-HagA. After determining the concentration, the corresponding copy number was calculated through the formula. Then the standard plasmid was serially diluted, and the standard curve was constructed by fluorescence quantitative PCR using the standard plasmids with different dilution factors as templates. The copy number calculation formula is Y = -0.3289*X + 10.15.

[0087] The collected swabs were placed in 1.5 mL EP tubes, then 1 mL of sterile PBS was added, and they were shaken with a vortex oscillator. Subsequently, 600 μL was aspirated with a pipette and placed in a new EP tube, centrifuged at 12000 r / min for 10 min, then 500 μL of the supernatant was discarded, and the remaining 100 μL of liquid was boiled at 100 °C for 10 min and centrifuged at 12000 r / min for 10 min. The supernatant was used as the template for fluorescence quantitative PCR. The qPCR system was configured and the program was designed according to the following table (Table 5). The results were compared with the standard curve to convert the copy number of *Avibacterium paragallinarum* in the detected throat swabs.

[0088] Table 5 qPCR reaction system

[0089]

[0090]

[0091] The qPCR reaction program was: 95 °C for 5 min; 95 °C for 10 s; 60 °C for 30 s; 95 °C for 15 s; 60 °C for 60 s; 95 °C for 15 s; the number of cycles was 40 times.

[0092] The results are as Figure 8As shown, the bacterial excretion amounts of all immune groups were lower than those of the control group, and the bacterial excretion amount was significantly lower than that of the control group on the fifth day.

[0093] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. An application of Avibacterium paragallinarum protein p1 in the preparation of a broad-spectrum Avibacterium paragallinarum protective antigen protein, characterized in that: The amino acid sequence of the Avibacterium paragallinarum protein p1 is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The gene sequence encoding the Avibacterium paragallinarum protein p1 is shown in SEQ ID No.

2.

3. The use according to any one of claims 1 to 2, characterized in that: The Avibacterium paragallinarum protective antigen protein is prepared by the following steps: amplifying the coding gene of the Avibacterium paragallinarum protective antigen protein; introducing the coding gene fragment into an expression vector to obtain a recombinant expression vector; introducing the recombinant expression vector into a protein expression host bacterium to obtain a recombinant bacterium, culturing the recombinant bacterium, inducing protein expression and purifying to obtain the Avibacterium paragallinarum protective antigen protein.

4. The use according to claim 3, characterized in that: The primer sequences used to amplify the coding gene of the broad-spectrum Avibacterium paragallinarum protective antigen protein are shown in SEQ ID No. 3-4.

5. A subunit vaccine of Avibacterium paragallinarum, characterized in that: The active ingredients include a broad-spectrum Avibacterium paragallinarum protective antigen protein with an amino acid sequence as shown in SEQ ID No.

1.

6. The Avibacterium paragallinarum subunit vaccine according to claim 5, characterized in that The final concentration of the broad-spectrum A. paragallinarum protective antigen protein in the A. paragallinarum subunit vaccine is 500 μg / mL.

7. A polyclonal antibody, characterized in that The method is obtained by immunizing an animal with the Avibacterium paragallinarum subunit vaccine according to any one of claims 5 to 6.

8. The polyclonal antibody according to claim 7, characterized in that The immunization method used is: the animals are injected with Avibacterium paragallinarum subunit vaccine for the first time and then boosted immunization 2 weeks later, with 50 μg of vaccine injected per animal each time, and serum is collected 14 days after the booster immunization to obtain polyclonal antibodies.

9. The polyclonal antibody according to claim 7, characterized in that The titer of the polyclonal antibody is 1:819200.

10. Use of the polyclonal antibody according to any one of claims 7 to 9 in the preparation of drugs or preparations related to inhibiting / disinfecting Avibacterium paragallinarum.

Citation Information

Patent Citations

  • Chicken infectious rhinitis subunit vaccine and preparing method thereof

    CN106220716A

  • Antigen protein of avibacterium paragallinarum and application of antigen protein

    CN107793473A

  • Artificial C-type avibacterium paragallinarum immunoprotective antigen protein and application thereof

    CN116063414A

  • Recombinant avian infectious coryza vaccine and process for preparing same

    US20120003257A1

  • Rapid differential diagnosis kit for detecting infectious coryza and swollen head syndrome in the poultry farming industry

    WO2019245392A1