Znf467 gene mutant and application thereof

Abstract

The application provides a ZNF467 gene mutant and application thereof, and the mutant sequence is shown as SEQ ID NO. 1. The application discloses a novel 216-292 amino acid truncated mutant of a gene ZNF467 which is specifically enriched in human hematopoietic stem cells. Overexpression of the mutant can significantly improve the homing and transplantation efficiency of the human hematopoietic stem cells, and has great significance for the clinical treatment of diseases related to hematopoietic stem cell transplantation.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of bioengineering and biomedicine, and particularly relates to a gene mutant for improving homing and transplantation efficiency of hematopoietic stem cells. BACKGROUND

[0002] Hematopoietic cell transplantation is widely used for treating various malignant and non-malignant blood system diseases and metabolic diseases, and is a relatively mature and effective clinical stem cell treatment method at present. Hematopoietic stem cells (HSCs) play a core role in the process of hematopoietic cell transplantation. Since the proportion of functional HSCs in all blood cells is very low, regardless of bone marrow, peripheral blood or umbilical cord blood sources, especially for the application scenario of HSCs that need to be genetically engineered, the limited number of HSCs is the main obstacle to more extensive and effective application in clinical treatment. Exploring new strategies to improve the transplantation potential of HSCs is conducive to solving the source of HSC donors, accelerating the process of hematopoietic system recovery and immune reconstruction after transplantation, and has important scientific significance for expanding the application range of HSC transplantation and improving the clinical treatment effect and survival rate of patients.

[0003] Improving the transplantation potential of HSCs can target the three key steps of collection, in vitro expansion and homing of HSCs. The general definition of HSC homing is the process of HSC migration and residence in a specific microenvironment or niche in the body. In the physiological state, HSCs that colonize the microenvironment maintain a steady balance of proliferation, self-renewal and differentiation. Our previous research revealed the epigenetic regulation mechanism of the expression of the human umbilical cord blood HSC homing receptor CXCR4. Short-term culture of umbilical cord blood HSCs using glucocorticoids or HDAC5 inhibitors can significantly up-regulate the expression of CXCR4 and improve the homing and long-term transplantation capacity of HSCs. At present, the regulation of human HSC homing mainly focuses on the SDF1 / CXCR4 signal axis. Exploring new genes and molecular mechanisms for regulating human HSC homing is crucial for a comprehensive understanding of the homing and transplantation process of human HSCs and the development of drugs for improving human HSC homing. SUMMARY

[0004] The purpose of the present application is to provide a new gene mutant and its application for improving the homing and long-term transplantation efficiency of human hematopoietic stem cells.

[0005] In order to achieve the above purpose, the present application provides a ZNF467 gene mutant (referred to as npZNF467), and the mutant sequence is shown as SEQ ID NO. 1.

[0006] The ZNF467 gene mutant is a deletion mutant of amino acids 216-292 of ZNF467, and the cDNA sequence is (SEQ ID NO. 1):

[0007]

[0008] The application also provides application of the ZNF467 gene mutant in preparation of a drug for improving homing or transplantation efficiency of hematopoietic stem cells. Experiments show that overexpression of npZNF467 can significantly improve homing and long-term transplantation efficiency of human hematopoietic stem cells, and the npZNF467 gene can be delivered into hematopoietic stem cells by a gene vector such as a lentivirus, liposome transfection, electroporation, an artificial cell delivery vector and the like, or overexpression can be realized by direct phagocytosis of cells through electroporation or addition of a fusion tag. Alternatively, a recombinant protein capable of entering cells is designed to directly activate target gene transcription, improve homing and transplantation efficiency of hematopoietic stem cells, and use a small molecule compound or a monoclonal antibody to target the ZNF467 gene, bind to the 216-299 amino acid sequence of the full-length ZNF467, and induce the full-length ZNF467 to be located to the nucleoplasmic part of the nucleus.

[0009] Hematopoietic stem cell transplantation includes transplantation of hematopoietic stem cells derived from bone marrow, mobilized peripheral blood or umbilical cord blood, and transplantation of gene-edited hematopoietic stem cells.

[0010] The application also provides application of the ZNF467 gene mutant in preparation of a blood system humanized mouse model, and the mouse model is based on use of human CD34 + Hematopoietic stem cell construction. Human CD34 + Hematopoietic stem cell transplantation into an immunodeficient mouse, CD34 + Hematopoietic stem cell transplantation into an immunodeficient mouse, CD34

[0011] The application also provides application of the ZNF467 gene mutant in preparation of a drug for treating diseases related to hematopoietic stem cell transplantation, and the diseases related to hematopoietic stem cell transplantation include leukemia, aplastic anemia, SCID immunodeficiency disease, Fanconi anemia and thalassemia.

[0012] The application has the advantage that a novel gene ZNF467 with an amino acid truncation mutant at 216-292 is specifically enriched in human hematopoietic stem cells, overexpression of the mutant can significantly improve homing and transplantation efficiency of human hematopoietic stem cells, and has great significance for clinical treatment of diseases related to hematopoietic stem cell transplantation. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1ZNF467 is highly expressed in human hematopoietic stem cells. a. RT-PCR shows that ZNF467 is significantly higher expressed in hematopoietic stem cells HSC than in multipotent progenitor cells MPP; b. Single-cell sequencing transcriptome analysis shows that ZNF467 is significantly higher expressed in CD34 + CD133 + ADGRG1 + in cell population; c. RT-PCR shows that ZNF467 is significantly higher expressed in CD34 + CD133 + ADGRG1 + cells than in CD34 + CD133 + ADGRG1 - cells.

[0014] Figure 2 Expression localization of full-length ZNF467 and 216-292 amino acid deletion mutant ZNF467 (npZNF467). a. Distribution of zinc finger ZnF domain and IDR region of full-length ZNF467 and npZNF467; b. Confocal fluorescence microscopy images show intracellular localization of full-length ZNF467 and npZNF467.

[0015] Figure 3 Overexpression of npZNF467 significantly improves the engraftment efficiency of human hematopoietic stem / progenitor cells. a. ZNF467 or npZNF467 was cloned into lentiviral vector for packaging lentivirus to infect human CD34 + cells; b-c. LDA limiting dilution assay analyzes the engraftment efficiency of CD34 + cells in immunodeficient mice NSG after overexpression of ZNF467 and npZNF467, n.s. means not significant; ***p < 0.001.

[0016] Figure 4 Overexpression of npZNF467 significantly improves the homing efficiency of human hematopoietic stem / progenitor cells. a. Flow cytometry of human CD45 cell chimerism in bone marrow of immunodeficient mice 24 mice after transplantation of npZNF467 overexpressed hematopoietic stem / progenitor cells; b. Statistical results show that the homing efficiency of CD34 + cells overexpressing npZNF467 is significantly higher than that of the control group; ***p < 0.001.

[0017] Figure 5 Overexpression of npZNF467 activates the expression of homing genes MMP9 and ICAM1. a. Transcriptome sequencing signal pathway functional annotation enrichment analysis shows that CD34 +Homing-related pathways were significantly upregulated in hematopoietic stem / progenitor cells; b-c. RT-PCR analysis showed that overexpression of npZNF467 significantly upregulated the expression levels of MMP9 and ICAM1.

[0018] Figure 6 Inhibition of MMP9 and ICAM1 blocked the promoting effect of npZNF67 on homing. a-b. Inhibitor of MMP9, JNJ0966, significantly inhibited the homing efficiency upregulated by overexpression of npZNF467; c-d. Anti-ICAM1 antibody treatment significantly blocked the promoting effect of overexpression of npZNF467 on homing of human hematopoietic stem / progenitor cells. DETAILED DESCRIPTION

[0019] The following detailed description of the application is provided for the purpose of understanding the technology of the application. It is understood that the following detailed description is not intended to limit the application, but to help the skilled in the art to understand the application. The materials, reagents, etc. used in the following examples, if not specifically stated, can be obtained commercially.

[0020] Example 1. Preparation of ZNF467(npZNF467) lentivirus with deletion of amino acids 216-292

[0021] Single-cell sequencing transcriptome analysis and quantitative PCR were used to verify the high expression of ZNF467 gene in human HSCs (see Figure 1 ). Fluorescence microscopy was used to confirm the subcellular localization of full-length and npZNF467 in cells (see Figure 2 ). Mutation experiments and confocal microscopy localization experiments showed that overexpression of full-length ZNF467 was localized to the nucleolus, while overexpression of the deletion mutant of ZNF467 with amino acids 216-292 (referred to as npZNF67) lost nucleolus localization and was significantly enriched in the nucleoplasm of the nucleus. The results of the experiments showed that npZNF67 promoted the homing of human cord blood CD34 +Overexpression of npZNF467 in cells, human ZNF467 full-length cDNA was first cloned into GeneCopoeia’s LV165 vector, and the sequence was verified by sequencing. Then, the primer (FR: ATCCATACGGGCGAGAGGCC (SEQ ID NO. 2); RW: AGGCCGCTCGCCGCGGTGGC (SEQ ID NO. 3)) was used to perform PCR experiment to clone the LV165 lentivirus expression vector of 216-292 amino acid deletion mutant ZNF467 (npZNF467). The lentivirus was generated by co-transfecting the above plasmid with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) into Lenti-X 293T cells (Takara, #632180). The lentivirus supernatant was concentrated at 4°C at a speed of 50,000g for 2.5 hours using a Beckman SW-28 swing bucket rotor. The concentrated lentivirus was used to infect umbilical cord blood CD34 + Overexpression of npZNF467 in cells, human ZNF467 full-length cDNA was first cloned into GeneCopoeia’s LV165 vector, and the sequence was verified by sequencing. Then, the primer (FR: ATCCATACGGGCGAGAGGCC (SEQ ID NO. 2); RW: AGGCCGCTCGCCGCGGTGGC (SEQ ID NO. 3)) was used to perform PCR experiment to clone the LV165 lentivirus expression vector of 216-292 amino acid deletion mutant ZNF467 (npZNF467). The lentivirus was generated by co-transfecting the above plasmid with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) into Lenti-X 293T cells (Takara, #632180). The lentivirus supernatant was concentrated at 4°C at a speed of 50,000g for 2.5 hours using a Beckman SW-28 swing bucket rotor. The concentrated lentivirus was used to infect umbilical cord blood CD34 + Overexpression of npZNF467 in cells, human ZNF467 full-length cDNA was first cloned into GeneCopoeia’s LV165 vector, and the sequence was verified by sequencing. Then, the primer (FR: ATCCATACGGGCGAGAGGCC (SEQ ID NO. 2); RW: AGGCCGCTCGCCGCGGTGGC (SEQ ID NO. 3)) was used to perform PCR experiment to clone the LV165 lentivirus expression vector of 216-292 amino acid deletion mutant ZNF467 (npZNF467). The lentivirus was generated by co-transfecting the above plasmid with psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) into Lenti-X 293T cells (Takara, #632180). The lentivirus supernatant was concentrated at 4°C at a speed of 50,000g for 2.5 hours using a Beckman SW-28 swing bucket rotor. The concentrated lentivirus was used to infect umbilical cord blood CD34

[0022] Example 2. Improving human umbilical cord blood hematopoietic stem and progenitor cell transplantation efficiency using npZNF467 overexpression

[0023] Fresh umbilical cord blood CD34 +Cells were cultured in HSC Expansion Medium (Sigma, S0912) + 100 ng / mL Stem Cell Factor (SCF) (R&D Systems, #7466-SC-010 / CF) + 100 ng / mL Thrombopoietin (TPO) (R&D Systems, #288-TP-200 / CF) + 50 ng / mL Fms-like tyrosine kinase 3 ligand (Flt3L) (BioLegend, #710802) + 50 IU / mL Penicillin + 50 pg / mL Streptomycin for 24 hours. The culture condition was 5% O2, 5% CO2. The overnight cultured CD34 + cells were infected with LV165 empty vector, LV165-ZNF467 and LV165-npZNF467 lentivirus respectively according to the method described in Example 1. After 4 days of continuous culture, GFP positive cells were sorted by flow cytometry and cell counting was performed. 10000, 50000, 100000 GFP positive cells of LV165, LV165-ZNF467 and LV165-npZNF467 groups were transplanted into immunodeficient mice irradiated (1.5G) 24 hours in advance via tail vein injection. After 16 weeks of transplantation, the bone marrow of the recipient mice was taken for human CD45 staining to detect the transplantation efficiency and the functional HSC index was calculated using LDA algorithm Figure 3 ). The results of the 16-week bone marrow transplantation experiment found that overexpression of full-length ZNF467 had no significant effect on the transplantation capacity of hematopoietic stem cells, while overexpression of npZNF467 could increase the transplantation efficiency of hematopoietic stem cells by about 13.2 times.

[0024] Example 3. Use of npZNF467 lentivirus to improve the homing efficiency of hematopoietic stem cells

[0025] Umbilical cord blood CD34 + cells were collected and cultured according to the method described in Example 2. The overnight cultured CD34 +Cells. After 4 days of continuous culture, GFP positive cells were sorted by flow cytometry and counted. 500,000 GFP positive cells from LV165 and LV165-npZNF467 groups were transplanted into immunodeficient mice irradiated 24 hours in advance (1.5G) via tail vein injection. The bone marrow of the recipient mice was taken 24 hours after transplantation for human CD45 staining to detect the chimeric ratio and calculate the homing efficiency of hematopoietic stem / progenitor cells Figure 4 The results show that overexpression of npZNF467 can significantly improve the homing efficiency of human hematopoietic stem / progenitor cells.

[0026] Example 4. Activation of homing gene expression in hematopoietic stem cells using npZNF467 lentivirus

[0027] The collection and culture of CD34 + Cells were activated by pre-treatment. CD34 + Cells were infected with LV165 empty vector and LV165-npZNF467 lentivirus according to the method described in Example 1. After 4 days of continuous culture, GFP positive cells were sorted by flow cytometry and counted. 500,000 GFP positive cells from LV165 and LV165-npZNF467 groups were subjected to RNA extraction and reverse transcription experiments, and the expression levels of homing genes MMP9 and ICAM1 were detected by fluorescent quantitative PCR Figure 5 ). Transcriptome sequencing analysis showed that overexpression of npZNF467 significantly activated the expression of homing-related signaling pathway genes in hematopoietic stem / progenitor cells, including core genes MMP9 and ICAM1. 500,000 GFP positive cells from LV165 and LV165-npZNF467 groups were pre-treated with MMP9 inhibitor JNJ096 or anti-ICAM1 neutralizing antibody, and untreated and treated cells were transplanted into immunodeficient mice irradiated 24 hours in advance (1.5G) via tail vein injection. The bone marrow of the recipient mice was taken 24 hours after transplantation for human CD45 staining to detect the chimeric ratio and calculate the homing efficiency of hematopoietic stem / progenitor cells Figure 6 The results show that treatment with MMP9 inhibitor JNJ0966 or ICAM1 neutralizing antibody can significantly block the enhanced homing efficiency of hematopoietic stem / progenitor cells induced by npZNF467 overexpression.

[0028] The above only describes the preferred embodiments of the present application, and it should be noted that those skilled in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the scope of protection of the present application.

Claims

1. The application of the ZNF467 gene mutant in the preparation of humanized mouse models of the blood system, characterized in that, The mutant sequence is shown in SEQ ID NO.1, and the mouse model is based on human CD34. + Hematopoietic stem and progenitor cells were constructed using human CD34 cells overexpressing the ZNF467 gene mutant. + Hematopoietic stem cells were transplanted into immunodeficient mice.

Images