A chrysanthemum CyMYB14 gene and its application

By cloning and expressing the CyMYB14 gene of chrysanthemum and combining genetic engineering technology, the problem of chrysanthemum branch regulation is solved, the precise control of the number and plant type of chrysanthemum branch is achieved, and the cultivation of new chrysanthemum varieties is promoted.

CN120137995BActive Publication Date: 2025-08-29BEIJING FORESTRY UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510482767.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2025-08-29
Estimated Expiration
2045-04-17

AI Technical Summary

Technical Problem

The existing breeding methods are difficult to accurately control the number and plant type of chrysanthemum branches, and cannot meet the needs of modern flower industry for high-quality chrysanthemum varieties. The traditional breeding cycle is long and the efficiency is low.

Method used

By cloning and expressing the CyMYB14 gene of chrysanthemum, genetic engineering technology is used to overexpress or inhibit the CyMYB14 gene in chrysanthemum, promoting or inhibiting chrysanthemum branching, and gene regulation is carried out in combination with transcriptome data and virus-induced gene silencing technology.

Benefits of technology

The precise regulation of chrysanthemum branch regulation is achieved, multi-branching and changing plant types are promoted, and reliable genetic resources are provided for the cultivation of new chrysanthemum varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120137995B_ABST
    Figure CN120137995B_ABST
Patent Text Reader

Abstract

The present invention discloses a chrysanthemum CyMYB14 gene and an application thereof, belonging to the technical field of chrysanthemum CyMYB genes. The nucleotide sequence of the CyMYB14 gene and the amino acid sequence of the encoded protein are shown as SEQ ID NO. 1 and SEQ ID NO. 2, respectively. The present invention overexpresses and silences the CyMYB14 gene in chrysanthemum by overexpression and virus-induced gene silencing (VIGS) methods, respectively. Compared with the control, the overexpressed chrysanthemum significantly promotes branching, while the branching of the VIGS plant is inhibited, indicating that the CyMYB14 gene promotes chrysanthemum branching. The present invention provides a new gene for regulating the branching of chrysanthemum, and is of great significance to the cultivation and production of new chrysanthemum varieties with different plant types.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a chrysanthemum CyMYB gene, in particular to a chrysanthemum CyMYB14 gene and application thereof, belonging to the technical field of chrysanthemum CyMYB genes. Background Art

[0002] At present, the improvement of chrysanthemum branching traits mainly relies on traditional breeding methods, such as hybrid breeding and mutagenesis breeding. Although these methods have achieved some results to a certain extent, they have the disadvantages of long cycles, low efficiency, and difficulty in targeted improvement. Moreover, due to the lack of in-depth understanding of the molecular mechanisms regulating chrysanthemum branching, traditional breeding methods are difficult to accurately control the number of branches and plant type, and cannot meet the demand of the modern floriculture industry for high-quality chrysanthemum varieties. Therefore, a chrysanthemum CyMYB14 gene and its application are designed to solve the above problems. Summary of the Invention

[0003] The main purpose of the present invention is to provide a chrysanthemum CyMYB14 gene and application.

[0004] The purpose of the present invention can be achieved by adopting the following technical solutions:

[0005] A chrysanthemum CyMYB14 gene, the nucleotide sequence of the gene is shown as SEQ ID NO.1.

[0006] Preferably, the protein amino acid sequence of the gene is shown as SEQ ID NO.2.

[0007] Preferably, a recombinant bacterium is obtained by introducing a vector containing the chrysanthemum CyMYB14 gene into a host bacterium, and the recombinant bacterium can express the protein encoded by the chrysanthemum CyMYB14 gene.

[0008] Preferably, a vector is provided for the chrysanthemum CyMYB14 gene, which contains the complete coding sequence of the chrysanthemum CyMYB14 gene and can stably exist and express the chrysanthemum CyMYB14 gene in a host cell.

[0009] An application of a chrysanthemum CyMYB14 gene is provided for promoting chrysanthemum branching by overexpressing the chrysanthemum CyMYB14 gene, or inhibiting chrysanthemum branching by inhibiting the expression of the chrysanthemum CyMYB14 gene.

[0010] Preferably, the method for overexpressing the chrysanthemum CyMYB14 gene comprises the following steps:

[0011] Constructing a plant expression vector containing the chrysanthemum CyMYB14 gene;

[0012] The vector is transformed into Agrobacterium, and then transformed into chrysanthemum cells using Agrobacterium-mediated method;

[0013] Then, chrysanthemum plants that overexpress the chrysanthemum CyMYB14 gene were cultivated.

[0014] Preferably, the method for inhibiting the expression of the chrysanthemum CyMYB14 gene comprises using virus-induced gene silencing technology;

[0015] A VIGS vector containing a gene fragment targeting chrysanthemum CyMYB14 was constructed, transformed with Agrobacterium, and then infected into chrysanthemum plants to achieve silencing of the chrysanthemum CyMYB14 gene.

[0016] Beneficial technical effects of the present invention:

[0017] The present invention provides a chrysanthemum CyMYB14 gene and application thereof. Combining transcriptome data, a chrysanthemum CyMYB14 gene is cloned and identified, and bioinformatics analysis is performed.

[0018] Based on qRT-PCR, the expression of chrysanthemum CyMYB14 in different tissues of chrysanthemum, empty vector, overexpression and VIGS in chrysanthemum materials was determined; and the phenotypic analysis of transgenic and VIGS plants was used to verify the function of chrysanthemum CyMYB14.

[0019] The results showed that chrysanthemum CyMYB14 promoted the formation of more branches in various chrysanthemums, laying the foundation for the branching regulation of chrysanthemums, and providing a usable gene for the cultivation of new varieties of chrysanthemums with different plant types. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the CDS sequence amplification map of CyMYB14;

[0021] Figure 2 Figure 1 is a diagram of the conserved domain structure of CyMYB14 protein;

[0022] Figure 3 This is the phylogenetic relationship diagram of CyMYB14 in Creeping Chrysanthemum and MYB14 in other species;

[0023] Figure 4 This is a diagram showing the expression of CyMYB14 in different tissues of chrysanthemum;

[0024] Figure 5 This is the subcellular localization map of CyMYB14;

[0025] Figure 6 The phenotypic comparison between CyMYB14 transgenic plants and wild type plants under tissue culture conditions is shown in the figure. The red arrows point to the axillary buds.

[0026] Figure 7 This is a phenotypic comparison of CyMYB14 transgenic plants and wild type plants under potted cultivation conditions;

[0027] Figure 8 The relative expression levels of CyMYB14 gene-silenced plants and the control group. Different lowercase letters indicate significant differences (P < 0.05).

[0028] Figure 9 The phenotypes of CyMYB14-silenced plants were compared with those of the control group. The red arrows indicate the axillary buds. DETAILED DESCRIPTION

[0029] In order to make the technical solution of the present invention more clear and specific to those skilled in the art, the present invention is further described in detail below with reference to embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0030] Example

[0031] Materials and Methods

[0032] Strains, vectors, and reagents

[0033] DH5α Escherichia coli competent cells and GV3101 Agrobacterium competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd., the pCloneEZ-Blunt / TA TOPO Cloning Kit was purchased from Sino-US Taihe Biotechnology Co., Ltd., and the recombinant plasmid pSuper1300:GFP was preserved in our laboratory.

[0034] EASYspin Plus Plant RNA Rapid Extraction Kit, Agarose Gel Purification and Recovery Kit, and Endotoxin-Free Plasmid Mini- to Medium-Preparation Kit were purchased from Beijing Adelaide Biotechnology Co., Ltd.

[0035] PrimeScript™ II 1st Strand cDNA Synthesis Kit, PrimeSTAR® Max DNA Polymerase, PrimeScript™ FAST RT reagent Kit with gDNA Eraser, TB Green® Premix Ex Taq™ II (Tli RNaseH Plus), and In-Fusion HD Cloning kits were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.

[0036] 2× Rapid Taq Plus Master Mix (Dye Plus) and 2× Rapid Taq Master Mix were purchased from Nanjing Novozymes Biotechnology Co., Ltd. Restriction enzymes Kpn I, Apa I, Xba I, and EcoR I were purchased from New England Biolabs. LB broth and agar were purchased from Beijing Coolaibo Technology Co., Ltd. Kanamycin (Kan) and rifampicin (Rif) were purchased from INALCO. MS medium, sucrose, agar powder, 6-BA, NAA, carbenicillin sodium, cephalosporin sodium, 50× TAE electrophoresis buffer, and hygromycin were purchased from Beijing Biode Biotechnology Co., Ltd. MgCl2, 2-(N-morpholino)ethanesulfonic acid (MES), and acetosyringone (AS) were purchased from Beijing Zhongke Yubo Biotechnology Co., Ltd.

[0037] Full-length gene cloning

[0038] Chrysanthemum leaf buds were used as samples. RNA was extracted and reverse-transcribed into cDNA, which was stored at -20°C until further use. Based on the full-length transcript sequence, full-length primers encompassing the complete CyMYB14 ORF were designed using Primer3Plus and synthesized at Beijing Ruiboxing Biotechnology Co., Ltd. PCR amplification was performed using the cDNA as a template using a high-fidelity enzyme. The amplified product was gel-cleaved and constructed into the pEASY®-Blunt Cloning Vector. The amplified product was then transformed into Escherichia coli DH5α-coated plates. Single colonies were selected and shaken for 12 hours before being sent to Beijing Ruiboxing Biotechnology Co., Ltd. for sequencing and verification.

[0039] Vector construction;

[0040] Using the correctly identified recombinant plasmid as a template, CyMYB14 was amplified with primers containing the corresponding vector linker. After gel recovery, the plasmids were constructed onto the corresponding vectors after enzyme digestion. The plasmids were transformed into Escherichia coli DH5α, single clones were picked, and sequencing was confirmed. The plasmids were then extracted and transformed into Agrobacterium tumefaciens GV3101 competent cells. Plates were spread, single clones were picked, and small shakes were performed for PCR bacterial testing. Qualified transformed single clones were kept for future use.

[0041] subcellular localization;

[0042] Transform the pSuper1300-eGFP and pSuper1300-CyMYB14-eGFP plasmids into competent GV3101 strains and perform transient overexpression using 4-week-old Nicotiana benthamiana plants. The specific steps are as follows:

[0043] a. Spread 100 μL of the GV3101 strain transfected with pSuper1300-eGFP or pSuper1300-CyMYB14-eGFP on LB medium supplemented with Rif and Kan antibiotics and incubate at 28°C until single colonies are clearly visible.

[0044] b. Pick a single colony and pipette it into 1 mL of LB liquid medium. Incubate overnight at 28°C and 200 rpm.

[0045] c. Transfer 0.5 mL of the bacterial suspension to 50 mL of liquid LB medium and incubate at 28°C, shaking at 200 rpm until the OD600 reaches 0.8-1.0.

[0046] d. Centrifuge the resulting bacterial suspension at 5000 rpm for 10 minutes to collect the cells. Resuspend the cells in a resuspension buffer (MS + 10 mM MES + 10 mM MgCl2 + 200 μM acetosyringone) to an OD600 of 0.6. Incubate in the dark for 2–3 hours to obtain the infection medium.

[0047] e. Use a 1 mL disposable syringe to inject the infection solution into the back of the tobacco leaves until a noticeable water stain forms;

[0048] f. Incubate the injected tobacco in the dark at 25°C;

[0049] g. Take photos every 12 hours after injection for 24 hours.

[0050] Chrysanthemum overexpression;

[0051] The CyMYB14 plant expression vector was constructed using the In-Fusion method. Apa Ⅰ and Kpn Ⅰ were selected as restriction sites. Primers (CyMYB14-1300-F: GAAAGCTTCTGCAGGATGGTTAGAGCTCCATGTTG, CyMYB14-1300-R: CCCTTGCTCACCATGTATTTGTGGTAATTCTTCTCC) were designed according to the Takara seamless cloning kit. The CDS sequence of CyMYB14 was constructed into the pSuper1300 vector, and the correct plasmid sequenced by the company was used for subsequent Agrobacterium transformation.

[0052] Basic culture medium: 4.4 g / L MS + 30 g / L sucrose + 7 g / L agar + 1L distilled water, pH = 5.8.

[0053] Preculture medium: 4.4 g / L MS + 30 g / L sucrose + 1 ml 6-BA + 700 μL NAA + 7 g / L agar + 1 L distilled water, pH = 5.8.

[0054] Co-culture medium: 4.4 g / L MS + 30 g / L sucrose + 1 ml 6-BA + 700 μL NAA + 7 g / L agar + 1 L distilled water, pH = 5.8

[0055] Meristematic medium: 4.4 g / L MS + 30 g / L sucrose + 1 ml 6-BA + 700 μL NAA + 7 g / L agar + 1 L distilled water + 4 ml carbenicillin, pH = 5.8

[0056] Differentiation medium: 4.4 g / L MS + 30 g / L sucrose + 1 ml 6-BA + 700 μL NAA + 7 g / L agar + 1 L distilled water + 4 ml carbenicillin + 50 μL hygromycin, pH = 5.8

[0057] Rooting medium: 4.4 g / L MS + 30 g / L sucrose + 7 g / L agar + 1 L distilled water + 4 ml carbenicillin + 50 μL hygromycin, pH = 5.8

[0058] Transformation infection;

[0059] Cut the leaves of 'Pudidanfen' into 0.8-1.0 cm squares and culture them in the culture medium for 1-2 days;

[0060] ② After the pre-culture, the leaf discs were placed in the infection solution for 7 minutes. After the infection, the leaf discs were placed in the co-culture medium for 2 days.

[0061] ③ After the co-cultivation, the leaf disc was placed in the meristematic culture medium for 3 days;

[0062] ④ After the meristem culture is completed, transfer the leaf disc to the differentiation medium and change the medium every 10-15 days;

[0063] ⑤ After adventitious buds are produced on the leaf disc, transfer them to the rooting medium.

[0064] VIGS;

[0065] The full-length plasmid of CyMYB14 from Cyperus rotundus was used as the cDNA template, and the 200-300 bp fragment of the non-conserved domain in the CDS region was selected for silencing fragment primer design (CyMYB14-TRV2-F: TAAGGTTACCGAATTTCAAACAAGTTACAATCAAGTTG, CyMYB14-TRV2-R: ATGGAGGCCTTCTAGACTCGTAAACACATCCACTTGG).

[0066] The PCR amplification system and procedures are described in 2.2.2 (3). After PCR amplification, the product is purified and recovered, followed by transformation and screening of E. coli, and sequencing of the bacterial solution for confirmation before use in transformation.

[0067] Vacuum infiltration instantaneous transformation of creeping chrysanthemum

[0068] ① Take the bacterial liquid with the correct band after PCR identification, expand it in 25 ml of LB liquid medium containing kanamycin and rifampicin, and shake incubate it at 28°C in a shaking incubator for 20-24 hours.

[0069] ② Place the expanded bacterial culture in ① into 300 ml of LB liquid medium containing kanamycin and rifampicin and continue to expand the culture with shaking for 24 hours.

[0070] ③ Centrifuge at 5000 rpm at room temperature for 10 min to collect the bacteria.

[0071] ④ After centrifugation, remove the supernatant, resuspend the bacteria in buffer, adjust the OD600 value of the bacterial solution to OD600 = 2.0, and let it stand at 28℃ for 2-3 hours.

[0072] ⑤ Completely immerse the one-month-old creeping chrysanthemum cuttings in the infection solution and vacuum infiltrate for 20 minutes.

[0073] ⑥ After the vacuum infiltration is completed, wash off the excess bacterial liquid on the surface of the plant and replant it into the substrate.

[0074] ⑦ After the plants have grown for 1-2 months, observe the phenotype and collect statistical data.

[0075] Results and Analysis

[0076] CyMYB4 gene cloning and analysis

[0077] Based on the existing CyMYB14 sequence information in the transcriptome data of the third generation of creeping chrysanthemum, specific primers CyMYB14-F and CyMYB14-R were designed. The full-length CyMYB14 gene was amplified by PCR using cDNA from creeping chrysanthemum stem tissue as a template, and a PCR product of approximately 750 bp was obtained ( Figure 1 The target fragment was purified and recovered, ligated into a TOPO cloning vector, and transformed into competent E. coli cells. Single colonies were then cultured and sent to the company for sequencing. Sequencing results revealed that the CDS region of the CyMYB14 gene was 759 bp long and encoded 252 amino acids. It was completely consistent with the reference sequence, with no base deletions, insertions, or mutations found, indicating that CyMYB14 was successfully cloned.

[0078] The CyMYB14 protein sequence was submitted to the CD-search tool on the NCBI online website (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) for prediction of conserved domains. As shown in the figure, CyMYB14 has a typical MYB conserved domain at the N-terminus, proving that CyMYB14 belongs to the MYB transcription factor family ( Figure 2 To further analyze its structural features, DNAMAN software was used to perform a multiple sequence alignment of the CyMYB14 protein sequence from Echeveria crescentiae with MYB14 protein sequences from Arabidopsis thaliana, Oryza sativa, Helianthus annuus, Artemisia annua, Lactuca sativa, and Populus alba. The alignment revealed that the CyMYB14 protein sequence shared high similarity with the MYB14 protein sequences from these plants in conserved regions. Both proteins contained typical R2R3-MYB domain features, with the R2 domain containing three conserved tryptophan residues (W) and the R3 domain containing two conserved tryptophan residues (W), and their spacing patterns were highly consistent. These results indicate that CyMYB14 belongs to the R2R3-MYB subfamily of the MYB transcription factor family.

[0079] The CyMYB14 protein sequence of C. yantaiense was compared with that of Amborella trichopoda, Aristolochia fimbriata, representative monocot species such as maize (Zeamays) and rice (Oryza sativa), as well as dicot plants such as grape (Vitis vinifera), poplar (Populus trichocarpa), Arabidopsis thaliana, coffee (Coffea arabica), tomato (Solanum lycopersicum), and Asteraceae plants such as lettuce (Lactuca sativa), sunflower (Helianthus annuus), burdock (Arctium lappa), Artemisia tridentata, Artemisia annua, Artemisia argyi, Crossostephium chinense, Chrysanthemumindicum, and Chrysanthemum lavandulifolium and Chrysanthemum indicum'Nankingense' were aligned, and a phylogenetic tree was constructed based on the Neighbor-Joining (NJ) method in MEGA software. Figure 3 Because C. serrata is a tetraploid, four copies of CyMYB14 were identified in its three-generation transcriptome. Phylogenetic analysis showed that CyMYB14 in C. serrata is most closely related to its homologous sequence from C. lavandulifolium and clusters with other Asteraceae species, including C. indicum 'Nankingense'. This clustering indicates a high degree of conservation within the Asteraceae family.

[0080] Analysis of CyMYB14 gene expression pattern

[0081] Total RNA was extracted from the roots, stems, leaves, and buds of the creeping chrysanthemum and reverse transcribed into cDNA. The relative expression levels of the CyMYB14 gene in these tissues were then detected by real-time quantitative PCR (qRT-PCR) and statistically analyzed. Figure 4As shown, CyMYB14 is expressed in the roots, stems, leaves, and buds of C. styraciflua, but its expression levels vary significantly, with the highest expression in the buds, followed by the roots and leaves, and the lowest expression in the stems (buds > roots > leaves > stems). This expression pattern indicates that CyMYB14 expression has clear tissue specificity, with particularly high expression levels in the buds, suggesting that CyMYB14 may play an important role in the growth, development, or physiological regulation of C. styraciflua buds.

[0082] Subcellular localization of CyMYB14 in tobacco

[0083] Subcellular localization results showed that in tobacco leaf epidermal cells transfected with the empty plasmid, the GFP green fluorescence signal was evenly distributed throughout the cell, including the cell membrane and the nucleus. In tobacco leaf epidermal cells transfected with the CyMYB14-GFP recombinant plasmid, the green fluorescence signal was specifically localized only in the nucleus ( Figure 5 ).

[0084] The results showed that CyMYB14 protein was successfully expressed in the epidermal cells of Nicotiana benthamiana leaves and specifically localized in the cell nucleus, and may play its biological function in the cell nucleus as a transcription factor.

[0085] Overexpression of CyMYB14 promotes chrysanthemum branching

[0086] Under tissue culture conditions, obvious axillary bud formation occurred in the transgenic lines, while no axillary bud formation was observed in the wild-type plants ( Figure 6 Two months after hardening and transplanting, the transgenic lines were more lush than the wild type, and the number of branches formed by the elongation of axillary buds was significantly higher than that of the wild type ( Figure 7 ).

[0087] These results indicate that overexpression of CyMYB14 promotes axillary bud formation, thereby enhancing branching ability and subsequently changing the plant architecture of chrysanthemum.

[0088] Silencing CyMYB14 inhibits lateral bud formation in chrysanthemum

[0089] qRT-PCR analysis revealed that the expression level of CyMYB14 was significantly downregulated in gene-silenced plants, indicating that gene silencing was effective ( Figure 8 ).

[0090] Compared with the control group, lateral buds emerged in the wild type three months after transplantation, while axillary buds in the CyMYB14 gene-silenced plants were severely inhibited, further demonstrating the positive regulatory role of CyMYB14 in axillary bud development ( Figure 9 ).

[0091] The present invention cloned and identified a chrysanthemum CyMYB14 gene by combining transcriptome data, and performed bioinformatics analysis.

[0092] The expression of CyMYB14 in different tissues of chrysanthemum was determined based on qRT-PCR; combined with transgenic overexpression and virus-induced gene silencing, it was demonstrated that CyMYB14 promotes the formation of chrysanthemum branches, laying the foundation for the branch regulation of chrysanthemum, and providing a usable gene for the cultivation of new chrysanthemum varieties with different plant types.

[0093] The above is only a further embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes based on the technical solutions and concepts of the present invention within the scope disclosed by the present invention, which fall within the scope of protection of the present invention.

Claims

1. A chrysanthemum CyMYB14 gene, characterized by: The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The protein encoded by the gene according to claim 1.

3. An application of the CyMYB14 gene in chrysanthemum, characterized by: The branching of chrysanthemum is promoted by overexpressing the chrysanthemum CyMYB14 gene according to claim 1, or the branching of chrysanthemum is inhibited by inhibiting the expression of the chrysanthemum CyMYB14 gene.

4. The use according to claim 3, characterized in that: The method for overexpressing the chrysanthemum CyMYB14 gene comprises the following steps: Constructing a plant expression vector containing the chrysanthemum CyMYB14 gene; The vector is transformed into Agrobacterium, and then transformed into chrysanthemum cells using Agrobacterium-mediated method; Then, chrysanthemum plants that overexpress the chrysanthemum CyMYB14 gene were cultivated.

5. The use of the chrysanthemum CyMYB14 gene according to claim 3, characterized in that: Methods for inhibiting the expression of the chrysanthemum CyMYB14 gene include using virus-induced gene silencing technology; A VIGS vector containing a gene fragment targeting chrysanthemum CyMYB14 was constructed, transformed with Agrobacterium, and then infected into chrysanthemum plants to achieve silencing of the chrysanthemum CyMYB14 gene.

Citation Information

Patent Citations

  • Rhodomyrtus tomentosa MYB transcription factor RtMYB1 and application thereof

    CN116410284A

  • Application of chrysanthemum transcription factor CmRAX2 in promoting axillary bud growth or increasing bud number

    CN119120541A