Construction and application of Cas9 gene editing system in Erigeron breviscapus

Abstract

The present invention discloses a method for constructing and applying a Cas9 gene editing system for Erigeron breviscapus, comprising the following steps: selecting an Erigeron breviscapus EbPDS gene sequence and designing a target site, amplifying a target fragment using a PGTR plasmid as a template, connecting the fragment to an expression vector PV58-Cas9 by homologous recombination, infecting an Erigeron breviscapus leaf explant in a suspension infection solution containing PV58-Cas9-EbPDS Agrobacterium, and then culturing the explant in a Erigeron breviscapus co-culture medium, a delayed screening medium, and a screening medium, respectively, to obtain newly generated callus tissue. The advantages of the present invention are: (1) the gene editing system constructed with the recombinant plasmid PV58-Cas9-EbPDS is efficient and feasible; (2) the EbPDS gene is successfully applied to CRISPR / Cas9-mediated genome editing, and individuals with a specific genotype can be quickly screened out by observing whether the offspring plants show an albinism phenotype, thereby providing an important means for gene function research and gene editing breeding in Erigeron breviscapus.

Description

Technical Field

[0001] The present invention belongs to the field of genetic breeding technology, and in particular relates to a method for constructing and applying a CRISPR / Cas9 gene editing system for Erigeron breviscapus. Background Art

[0002] The CRISPR / Cas9 gene editing system specifically recognizes target sequences adjacent to the PAM (NGG) motif and cleaves 3 nt upstream. Simultaneously, it cleaves 3 to 8 nt upstream of the PAM region, forming a double-strand break (DSB). Subsequently, the body repairs the damaged DNA through its own repair mechanisms, such as homologous and nonhomologous recombination, resulting in the formation of indels (including deletions and insertions). Genome editing technology is a powerful tool for studying gene function and for targeted genetic modification. With the rapid development of CRISPR / Cas9 technology in recent years, genome editing has become increasingly important in crop breeding. Desirable traits are often associated with multiple genes or multiple loci within a gene, necessitating the construction of multi-target CRISPR / Cas9 vector systems capable of simultaneously editing two or more loci. For example, knocking out the OsAAP3 gene in japonica rice significantly increased tiller number, thereby improving grain yield. Knocking out the gene encoding granule-bound starch synthase (GBSS) in potato resulted in the selection of amylopectin-producing potatoes.

[0003] CRISPR / Cas9 technology is an emerging genome editing technology, but effective CRISPR / Cas9 editing systems have yet to be established in most medicinal plants. Researchers typically use the reporter gene PDS (phytoene desaturase) or other specific target genes to verify the effectiveness and feasibility of CRISPR / Cas9 editing systems. The PDS gene is a key gene in plant chlorophyll synthesis. Editing this gene can cause albinism in green tissues, making it a common marker gene for CRISPR / Cas9 gene editing. In recent years, researchers have constructed CRISPR / Cas9 knockout vectors for the PDS gene and, through Agrobacterium tumefaciens infection, have achieved complete or chimeric albinism in several medicinal plants, including Rehmannia glutinosa, Rehmannia glutinosa, Chinese yam, and Hemerocallis fulva. The establishment of a CRISPR / Cas9 editing system for the PDS gene could provide a reference for gene editing in other medicinal plants and a basis for the verification and identification of other functional genes. In recent years, researchers have applied CRISPR / Cas9 vector construction systems to plants, including those based on gene gun transformation and Agrobacterium transformation. However, a CRISPR / Cas9-mediated gene editing system in Erigeron breviscapus has not yet been reported, limiting the study of gene function. Summary of the Invention

[0004] In response to the above problems, the purpose of the present invention is to provide an efficient and feasible method for constructing a CRISPR / Cas9 gene editing system in Erigeron breviscapus.

[0005] To achieve the above object, the technical solution adopted by the present invention is:

[0006] A method for constructing a CRISPR / Cas9 gene editing system in Erigeron breviscapus, comprising the following steps:

[0007] First, based on phylogenetic tree homology analysis, we selected the EbPDS gene from Erigeron breviscapus, which has high homology to the tobacco NtPDS gene. Target sites were designed based on the sequence. Using the target site design website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), we designed two EbPDS gene target sites, T1 and T2. PCR amplification primers were then designed based on the target sites.

[0008] After synthesizing target site PCR primers, the EbPDS gene was amplified using the PGTR plasmid as a template. The amplification system was as follows: 15 μl of Novai 2× Rapid Taq Master Mix, 0.3 μl of Primer F (10 μM), 0.3 μl of Primer R (10 μM), 1.5 μl of PGTR template, and 30 μl of water. The reaction procedure was 95°C for 3 minutes, followed by 35 cycles of 95°C for 20 seconds, 55°C for 20 seconds, and 72°C for 10 seconds, followed by 72°C for 3 minutes and 25°C for 1 second. The PV58-Cas9 vector was digested with KpnI, and the fragment was recovered using a gel-back kit. The amplified EbPDS gene fragment was then ligated into the expression vector PV58-Cas9 by homologous recombination to generate the recombinant plasmid PV58-Cas9-EbPDS.

[0009] The nucleotide sequence of the EbPDS gene is shown in SEQ ID NO: 1.

[0010] The present invention also provides a protein encoded by the EbPDS gene, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0011] In addition, when the EbPDS gene fragment undergoes homologous recombination with the vector PV58-Cas9, the EbPDS gene needs to be amplified and recovered using PCR amplification primers with homology arms.

[0012] The present invention also provides a genetically modified engineered bacterium, which contains the above-mentioned recombinant plasmid or the genome of the genetically modified bacterium is integrated with the above-mentioned exogenous EbPDS gene.

[0013] Preferably, the genetically modified bacteria are Escherichia coli DH5α strain and Agrobacterium tumefaciens EHA105 strain.

[0014] The recombinant plasmid PV58-Cas9-EbPDS was transformed into Escherichia coli DH5α via electroporation. Colony PCR screening and plasmid extraction were performed for Sanger sequencing to confirm successful vector construction. The recombinant plasmid PV58-Cas9-EbPDS was then transformed into Agrobacterium tumefaciens EHA105, and positive clones were screened by colony PCR. Genetic engineering was then performed to obtain PV58-Cas9-EbPDS Agrobacterium.

[0015] The leaf explants of Erigeron breviscapus were placed in an infection solution containing PV58-Cas9-EbPDS Agrobacterium for infection, and then cultured in Erigeron breviscapus co-culture medium, recovery medium, and screening medium in sequence to obtain transgenic newly proliferated transgenic callus tissue;

[0016] The preparation method of the PV58-Cas9-EbPDS Agrobacterium infection liquid comprises the following steps: adding a positive Agrobacterium single colony containing the recombinant plasmid PV58-Cas9-EbPDS to 5 mL of LB culture medium containing 40-65 mg / ml kanamycin and 40-70 mg / ml rifampicin, culturing overnight at 28°C and 200 rpm on a shaking table, aspirating 500 μL of the bacterial liquid into 50 mL of LB liquid culture medium containing 40-65 mg / ml kanamycin and 40-70 mg / ml rifampicin, culturing at 28°C and 200 rpm on a shaking table, and collecting the bacteria by centrifugation at 5000 rpm at room temperature for 8 minutes when the bacterial liquid becomes turbid and the OD value reaches 1-2, discarding the supernatant, adding the resuspension liquid in an ultra-clean workbench, and centrifuging and diluting the OD600 value to 0.2-0.3 to prepare the infection liquid.

[0017] Preferably, the amplification system is: Novae 2× Rapid Taq Master Mix 15 μl, Primer F (10 μM) 0.3 μl, Primer R (10 μM) 0.3 μl, PGTR template 1.5 μl, and water added to 30 μl;

[0018] The amplification reaction program was as follows: 95°C for 3 min; 95°C for 20 s, 55°C for 20 s, 72°C for 10 s, 35 cycles; 72°C for 3 min; 25°C for 1 s.

[0019] Preferably, before extracting the plasmid, colony PCR verification is performed using primers EbPDS-U26-F and EbPDS-inf-T2as-R.

[0020] Preferably, the PV58-Cas9-EbPDS Agrobacterium transformation and culture method is: 70 μL of bacterial solution is applied to an LB plate containing Kan and Rif, and the plate is inverted and cultured in a 28° C. incubator for 2 to 3 days.

[0021] Another object of the present invention is to provide an application of the PV58-Cas9-EbPDS Agrobacterium in the propagation of Erigeron breviscapus.

[0022] The present invention also provides a method for propagating Erigeron breviscapus using PV58-Cas9-EbPDS Agrobacterium, comprising the following steps: placing an Erigeron breviscapus leaf explant in an infection solution containing PV58-Cas9-EbPDS Agrobacterium, infecting the explant, and then culturing the explant in a Erigeron breviscapus co-culture medium, a delayed screening medium, and a screening medium, respectively, to obtain newly generated callus tissue that has been successfully genetically modified. The newly generated callus tissue is then subjected to a bud initiation medium, a bud differentiation medium, and a rooting medium, respectively, to obtain a transgenic plant.

[0023] Preferably, the method for preparing the infection solution comprises the following steps: adding PV58-Cas9-EbPDS Agrobacterium to LB culture medium supplemented with 40-65 mg / ml kanamycin and 40-70 mg / ml rifampicin, shaking at 28°C overnight, waiting for the bacterial solution to become turbid and having an OD value of 1-2, centrifuging and diluting to an OD600 value of 0.2-0.3 to prepare an infection solution, adding AS to prepare a suspended infection solution; the infection solution comprises: MS basal culture medium, 30 g / L sucrose, and 10-40 g / L glucose.

[0024] Preferably, the method for preparing the Erigeron breviscapus explant comprises the following steps:

[0025] (1) Planting sterile seedlings: inoculate the sterilized Erigeron breviscapus seeds into MS basal medium, seed germination medium, and rooting medium in sequence to obtain sterile seedlings;

[0026] (2) Preparing Erigeron breviscapus explants; placing the sterile seedlings in Erigeron breviscapus callus culture medium for culture, pre-culturing for one day to obtain Erigeron breviscapus leaf explants, and then using the leaf explants for transgenic infection.

[0027] Preferably, the Breviscapus co-culture medium comprises: MS, 0.004 mg / mL 6-BA, 0.0005 mg / mL TDZ, 0.002 mg / mL NAA, 3% sucrose, 0.8% agar, and 100 μmol / L AS; the co-culture is dark culture at a temperature of 22-25° C. for 2 days;

[0028] The delayed screening culture medium comprises: MS, 0.004 mg / mL 6-BA, 0.0005 mg / mL TDZ, 0.002 mg / mL NAA, 3% sucrose, 0.8% agar, and 0.27 mg / mL Tmt; the delayed screening culture conditions are: cultured in a light-treated culture room at 25° C. for 14 days;

[0029] The screening culture medium comprises: MS, 0.002 mg / mL 6-BA, 0.005 mg / mL TDZ, 0.001 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, and 10 mg / L Hyg; and the screening culture conditions are: 25° C. light culture for 2-4 weeks.

[0030] Preferably, the bud initiation medium comprises: SH, 0.001 mg / mL 6-BA, 0.001 mg / mL NAA, 0.08 g / L AD, 0.05 g / L GIu, 2 g / L CH, 3% sucrose, 0.8% agar, 0.27 mg / ml Tmt, 5 mg / L Hyg; cultured at 25°C under light;

[0031] The bud differentiation medium comprises: MS, 0.0005 mg / mL KT, 0.0003 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, 5 mg / L Hyg; cultured at 25°C under light;

[0032] The rooting medium comprises: MS, 0.1 mg / L NAA, 1% sucrose, 0.8% agar, and 0.27 mg / ml Tmt.

[0033] The present invention has the following beneficial effects:

[0034] (1) The gene editing system constructed with the recombinant plasmid PV58-Cas9-EbPDS is efficient and feasible; (2) The EbPDS gene was successfully applied to CRISPR / Cas9-mediated genome editing, effectively knocking out the plant alkene desaturase (PDS) gene. In plant breeding and variety improvement, the albinism trait can be used as a distinct marker. By observing whether the offspring plants show the albinism phenotype, individuals with a specific genotype can be quickly screened, accelerating the breeding process. This invention provides an important means for studying gene function and gene editing breeding in Erigeron breviscapus, and also has the potential to be widely used in the genetic transformation and genome editing genetic improvement of other medicinal plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 Schematic diagram of the construction of the Cas9 gene editing system in Erigeron breviscapus;

[0036] Figure 2 This is the vector map of the vector PV58-Cas9;

[0037] Figure 3 This is the vector map of the recombinant plasmid PV58-Cas9-EbPDS;

[0038] Figure 4 Schematic diagram of PV58-Cas9-EbPDS Agrobacterium knockout of target genes;

[0039] Figure 5 Regeneration of albino shoots of Erigeron breviscapus transformed with PV58-Cas9-EbPDS Agrobacterium;

[0040] Figure 6 PCR detection of PV58-Cas9-EbPDS Agrobacterium transgenic plants; DETAILED DESCRIPTION

[0041] The present invention will be further described below in conjunction with specific embodiments. It should be noted that the description of these embodiments is intended to facilitate understanding of the present invention and does not constitute a limitation of the present invention. In addition, the technical features involved in the various embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

[0042] Example 1

[0043] A method for constructing a Cas9 gene editing system in Erigeron breviscapus, comprising the following steps:

[0044] First, based on phylogenetic tree homology analysis, the EbPDS gene from Erigeron breviscapus, which has high homology to the tobacco NtPDS gene, was selected. Target site design was performed based on the sequence. Using the target site design website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), two EbPDS gene target sites, T1 and T2, were designed (Table 1). PCR amplification primers were designed based on the target sites (Table 2). After synthesizing the target site PCR amplification primers, the EbPDS gene was amplified using the PGTR plasmid as a template. The steps involved amplification and recovery of the candidate gene, homologous recombination, Agrobacterium transformation, bacterial culture solution testing, preparation of transgenic infection fluid, Agrobacterium-mediated genetic transformation of Erigeron breviscapus, PCR testing of PV58-Cas9-EbPDS transgenic plants, and analysis of the gene editing sites in these plants. The steps for each stage are as follows:

[0045] (1) Construction of phylogenetic tree

[0046] First, a BLAST search was performed using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) to download the amino acid sequence of the NtPDS gene. Then, a BLAST search was performed using the Erigeron breviscapus plant database (http: / / cucurbitgenomics.org / ) to download the sequences of PDS-related genes in Erigeron breviscapus. These sequences were imported into MEGA7 software, and a phylogenetic tree was constructed using the neighbor-joining (NJ) method.

[0047] (2) Selection and design of EbPDS gene target sites

[0048] Based on homology analysis, the EbPDS gene from Erigeron breviscapus, which has high homology to the tobacco NtPDS, was selected. Based on the EbPDS gene sequence information and sequence alignment results, and in conjunction with the target site design website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), two EbPDS gene target sites, T1 and T2, were designed (Table 1). PCR amplification primers were designed based on the target sites (Table 2).

[0049] Table 1 EbPDS target site sequences

[0050] Target site name Sequence (5'—3') EbPDS-T1 ACGCCCACCTAAGCCATTGA EbPDS-T2 GCAAAGTACTTGGCTGATGC

[0051] Table 2 PCR amplification primers for EbPDS target site

[0052] Primers Sequence (5'—3') EbPDS-T1-F TTCCCGGCTGGTGCAACGCCCACCTAAGCCATTGAGTTTTAGAGCTAGAAATAGCAAGT EbPDS-T2-R TTCTAGCTCTAAAACGCATCAGCCAAGTACTTTGCTGCACCAGCCGGGAAT EbPDS-U26-F TGTCCCAGGATTAGAATGATTAGGC EbPDS-inf-T2as-R TTCTAGCTCTAAAACGCATCAGCCAAGTACTTTGC

[0053] (3) Gene amplification and recovery

[0054] After synthesizing target site PCR primers, gene amplification was performed using the PGTR plasmid as a template using DNA polymerase (Phanta). The amplification system was as follows: 15 μl of Novay 2× Rapid Taq Master Mix, 0.3 μl of Primer F (10 μM), 0.3 μl of Primer R (10 μM), 1.5 μl of PGTR template, and 30 μl of water. The reaction program was 95°C for 3 minutes, followed by 35 cycles of 95°C for 20 seconds, 55°C for 20 seconds, and 72°C for 10 seconds, followed by 72°C for 3 minutes and 25°C for 1 second. After completion of the PCR amplification process, the length of the amplified gene band was confirmed by 1.2% agarose gel electrophoresis to confirm that the amplified gene band was consistent with that of the target gene. The PCR product was detected by agarose gel electrophoresis and the band was similar in length to that of the target gene, indicating good amplification. The target gene was then purified using a gel extraction kit from GenStar. The recovered concentration was determined using the NanoDrop 2000 instrument and the samples were stored in a -20°C refrigerator.

[0055] (4) Construction and identification of gene recombination vectors

[0056] A. Vector linearization: The PV58-Cas9 vector plasmid was double-digested with the nuclease Kpnl to obtain the linearized vector PV58-Cas9 ( Figure 2 The product was purified and recovered using the EZNA® CyclePureKit from Omega, and its concentration was measured and stored in a -20°C refrigerator for later use.

[0057] B. Gene recombination: The target gene amplified using the ready-to-use seamless cloning enzyme kit of Sangon Biotech (Shanghai) Co., Ltd. was ligated and recombined with the linearized vector PV58-Cas9. The ligation and transformation methods used were recombination ligation and heat shock transformation, and the transformed strain was E. coli (DH5α) competent.

[0058] PCR assay for bacterial solution C: Eight single colonies were randomly selected from the transformation medium in a clean bench and incubated in 20 μl of ddH2O. 3 μl of each colony was used as template for PCR amplification. The PCR reaction system used was 2xTaq Master Mix (Nanjing Novozymes Biotechnology Co., Ltd.). The PCR program was 95°C for 3 minutes, 95°C for 30 seconds, 55°C for 15 seconds, and 72°C for 30 kb for 35 cycles. After 72°C for 5 minutes, the PCR product was analyzed on 1% agarose gel. Agarose gel electrophoresis revealed distinct bands between 750 and 500 bp, closely matching the target fragment (506 bp), consistent with the expected result. The bacterial solution was then sent to Qingke for sequencing, which showed successful gene ligation with no mutations. The single colony was selected as a positive strain, indicating successful assembly. The culture was preserved using 50% glycerol and bacterial solution at a volume ratio of 1:1.

[0059] The reference sequence of the amplified product is as follows (underlined is the primer sequence, boxed is the target site sequence, and double underlined is the PAM site):

[0060] GTGTCGACTATCCAAGACCAGACCTTGATAACACCTCTAATTTCTTGGAAGCTGCTTA TTTGTCTTCTA CCTTCCGAGCT TCTCCACGCCCACCTAAGCCATTGA AGG TTGTAATTGCTGGTGCAGGTAAAACCTTCATACTTATACTGCTCATTATATTGTCTTTTAAGTCGCTTTTGTTTGAGAATTTGATACTGCCACATCTGATAGATAACCAAATGATACTTCAAGTGTTCAAGTGTATCCCCAATGATCTTTTTATGCCACATACTAACATCTGCTCTATTTTGCTATCCCGCTTACTTTTGCAAACTTCGCATATGCAGGTCTCGCTGGTTTATCAACTGCAAAGTACTTGGCTGATGC CGG TCACAAGCCAATTCTGCTAGAA GCAAGGGATGTTCTTGGTGG AAAGGTAGCCGATTTTTAAGAAATTACCATAGGATTAGAAGTCCT

[0061] (5) Plasmid vector extraction and Agrobacterium EHA105 transformation

[0062] Vector plasmid extraction: The vector plasmid containing the recombinant plasmid PV58-Cas9-EbPDS was extracted using the ready-to-use Steadure plasmid extraction kit from Wuhan Eric Biotechnology Co., Ltd. ( Figure 3 ). The plasmid was extracted from the positive clones with correct alignment in E. coli.

[0063] Transformation of Agrobacterium tumefaciens EHA105: Transfer 50 μL of competent Agrobacterium tumefaciens EHA105 to a 1.5 mL centrifuge tube, add 5 μL of the correctly aligned plasmid, and mix thoroughly by pipetting. The culture should then rest on ice for 5 minutes, snap-freeze in liquid nitrogen for 5 minutes, heat shock at 37°C for 5 minutes, and then cool on ice for 5 minutes. Add 700 μL of antibiotic-free liquid LB medium and resuspend in a shaker at 28°C, 200 rpm, for 3 hours. Spread 70 μL of the bacterial suspension onto an LB plate containing 50 mg / L Kan and 25 mg / L Rif. Incubate the plate upside down at 30°C for 2–3 days. Pick a single colony and test for the target gene using PCR.

[0064] (6) Preparation of infection solution

[0065] A single positive Agrobacterium colony containing the recombinant plasmid PV58-Cas9-EbPDS was added to 5 mL of LB liquid medium containing Kan (50 mg / ml) and Rif (50 mg / ml), and cultured overnight at 28°C and 200 rpm. 500 μL of the bacterial solution was added to 50 mL of LB liquid medium containing Kan (50 mg / ml) and Rif (50 mg / ml), and cultured at 28°C and 200 rpm to a bacterial solution OD value of 1. The bacteria were collected by centrifugation at 5000 rpm at room temperature for 8 min, the supernatant was discarded, and the resuspension was added to the clean bench to prepare the infection solution so that the OD value was 0.2.

[0066] (7) Agrobacterium-mediated genetic transformation of Erigeron breviscapus

[0067] The leaf explants of Erigeron breviscapus were placed in the prepared infection solution containing PV58-Cas9-EbPDS Agrobacterium and vacuum transformation treatment was carried out in sequence. The infection time was 30 minutes. It was necessary to first vacuum pressurize at 0.7 kPa for 15 minutes, then take it out and shake it, and then pressurize it for 15 minutes. After the infection, the infection solution was poured out, and the leaf explants were placed on sterile filter paper to absorb the moisture. The leaf explants were then transferred to the Erigeron breviscapus co-culture medium MS + 0.004 mg / mL 6-BA + 0.0005 mg / mL TDZ + 0.002 mg / mL NAA + 3% sucrose + 0.8% agar + 100 μmol / L AS. The co-culture was dark culture, the culture temperature was 22-25 ° C, and the culture time was 2 days.

[0068] After two days of co-cultivation, leaf explants were inoculated onto delayed selection medium (MS) supplemented with 0.004 mg / mL 6-BA, 0.0005 mg / mL TDZ, 0.002 mg / mL NAA, 3% sucrose, 0.8% agar, and 0.27 mg / mL Tmt. The culture was then placed in a light-incubation room at 25°C for 14 days. Unbrown calli after delayed selection were transferred to selection medium (MS supplemented with 0.002 mg / mL 6-BA, 0.005 mg / mL TDZ, 0.001 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, and 10 mg / L Hyg) and continued to be cultured in the light. Newly generated calli with successful transfection were observed after approximately three weeks. First, the selected callus tissue was inoculated into the bud initiation medium SH + 0.001mg / mL 6-BA + 0.001mg / mL NAA + 0.08g / L AD + 0.05g / L GIu + 2g / L CH + 3% sucrose + 0.8% agar + 0.27mg / ml Tmt + 5mg / L Hyg, and placed in a light culture room at 25℃. After about 3 weeks, small buds will be seen growing on the surface of the callus tissue ( Figure 5 The entire callus with sprouts was inoculated into a shoot differentiation medium (MS) supplemented with 0.0005 mg / mL KT, 0.0003 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, and 5 mg / L Hyg. The shoots developed into seedlings. The seedlings were then transferred to a rooting medium (MS) supplemented with 0.1 mg / L NAA, 1% sucrose, 0.8% agar, and 0.27 mg / mL Tmt to obtain transgenic Erigeron breviscapus plants.

[0069] (8) PCR detection of PV58-Cas9-EbPDS Agrobacterium transgenic plants

[0070] After the leaf explants of Erigeron breviscapus were infected with PV58-Cas9-EbPDS Agrobacterium, they were screened and grown in a screening medium containing Hyg. After the screening-differentiation process, they grew into young shoots. The young shoots obtained by Hyg screening and differentiation were taken, DNA was extracted for PCR detection, and specific primers were designed before and after the target sequence of gene editing.

[0071] EbPDS-F: ggagtgagtacggtgtgcTTTGTCTTCTACCTTCCGAGCT;

[0072] EbPDS-R: gagttggatgctggatggCCACCAAGAACATCCCTTGCPCR;

[0073] PCR amplification was performed with a reaction system of 20 μL. After mixing various components, the PCR reaction was performed. The PCR reaction procedure was as follows: after pre-denaturation at 98°C for 5 minutes, 30 cycles were performed, each cycle consisting of denaturation at 98°C for 5 seconds, annealing at 62°C for 5 seconds, and extension at 72°C for 20 seconds. Finally, extension at 72°C for 1 minute was performed. The PCR product was detected by 1.0% agarose gel electrophoresis, and the target band of 390 bp was obtained, confirming the presence of the transgene in the hygromycin-resistant plants.

[0074] (9) Analysis of gene editing sites in PV58-Cas9-EbPDS Agrobacterium transgenic plants

[0075] The PDS gene is a key gene in the process of plant chlorophyll synthesis. If the PDS gene function is lost, the green tissue of the plant will become albinic. The regenerated albino shoots formed by the PV58-Cas9-EbPDS Agrobacterium gene expression function cannot photosynthesize. Therefore, the regenerated albino shoots formed by the PV58-Cas9-EbPDS Agrobacterium gene expression function show a high degree of dwarfism, reduced leaf area, and growth less than 0.5 cm. A total of 30 plants were regenerated from the PV58-Cas9-EbPDS Agrobacterium-mediated transformation of Erigeron chinensis leaf explants, and 10 regenerated plants showed an albino shoot phenotype. 4 complete albino shoots were detected by PCR, and the 4 albino plants (PDS-1, PDS-2, PDS-3, PDS-4) were subjected to second-generation sequencing and mutation analysis ( Figure 6 ), found that the T1 and T2 target sites and their vicinity in the albino sprouts showed a variety of editing types, including single-base and multi-base deletions, single-base substitutions, etc., with single-base deletions being the main type of T1 target site and multi-base deletions being the main type of T2 target site (Table 3). These results indicate that PV58-Cas9-EbPDS Agrobacterium disrupts the function of the PDS gene through base deletion ( Figure 4 In this study, the PV58-Cas9-EbPDS Agrobacterium tumefaciens mutation efficiency (number of edited plants / number of transformed plants) was 33.3%. This established a highly efficient and feasible Cas9-mediated genome editing protocol in Erigeron breviscapus.

[0076] Table 3 Analysis of Cas9-EbPDS gene editing sites

[0077] Edit Plant Type T1 target T2 target T1 Edit Type T2 Editing Type Editing efficiency WT ACGCCCACCTAAGCCATTGA CTGGTTTATCAACTGCAAAGTACTTGGCTGATGCCGGT -- -- -- Plant 1 (1) ACGCCCACCTAAGCCAT-GA CTGGTTTATCAACTGCAAAGTACTTGGC---TGCCGGT 1D 3D 48.0% Plant 1 (2) ACGCCCACCTAAGCCAT-GA --------------------------------------- 1D 38D 26.0% Plant 1 (3) ACGCCCACCTAAGCC-TTGA CTGGTTTATCAACTGCAAAGTACTTGGC---TGCCGGT 1D 3D 11.8% Plant 1 (4) ACGCCCACCTAAGCCAT-GA CTGGTTTATCAACTGCAAAGTACTTGGCTGATGCCGGT 1D WT 7.67% Plant 1 (5) ACGCCCACCTAAGCC-TTGA --------------------------------------- 1D 38D 6.47%

[0078] Edit Plant Type T1 target T2 target T1 Edit Type T2 Editing Type Editing efficiency WT ACGCCCACCTAAGCCATTGA CTGCAAAGTACTTGGCTGATGCCGGTCAC -- -- -- Plant 2 (1) ACGCCCACCTAAGCCAT-GA CTG----------------------------- CAC 1D 23D 20.26% Plant 2 (2) ACGCCCACCTAAGCCAT-GA CTGCAAAGTACTTGGC-TGCCGGTCAC 1D 3D 14.21% Plant 2 (3) ACGCCCACCTAAGC-TTGA CTGCAAAGTACTTGGC-TGCCGGTCAC 2D 3D 9.70% Plant 2 (4) ACGCCCACCTAA-TTGA CTGCAAAGTACTTGGC-TGCCGGTCAC 4D 3D 9.15% Plant 2 (5) ACGCCCACCTAA-TTGA CTG----------------------------- CAC 4D 23D 8.01% Plant 2 (6) ACGCCCACCTAAGC-TTGA CTG----------------------------- CAC 2D 23D 6.33% Plant 2 (7) ACGCCCACCTAAGCCA-TGA CTGCAAAGTACTTG-GCCGGTCAC 1D 6D 5.83%

[0079] Edit Plant Type T1 target T2 target T1 Edit Type T2 Editing Type Editing efficiency WT ACGCCCACCTAAGCCATTGA CTGCAAAGTACTTGGCTGATGCCGGTCAC -- -- -- Plant 3 (1) ACGCCCACCTAAGCCAT-GA CTGCAAAGTACTTGGC-TGCCGGTCAC 1D 3D 24.60% Plant 3 (2) ACGCCCACCTAAGCCAT-GA ----------------------------------CGGTCAC 1D 22D 13.25% Plant 3 (3) ACGCCCACCTAAGCCAT-GA CTGCAAAGTACTTGGCTGATGCCGGTCAC 1D WT 12.43% Plant 3 (4) ACGCCCACCTAAGCCAT-GA --------------------------------- 1D 31D 11.09% Plant 3 (5) ACGCCCACCTAAGCCAT-GA CTGCAAAG------------TGCCGGTCAC 1D 11D 7.88% Plant 3 (6) ACGCCCACCTAAGCC-TTGA CTGCAAAGTACTTGGC-TGCCGGTCAC 1D 3D 7.23% Plant 3 (7) ACGCCCACCTAAGCC-TTGA ----------------------------------CGGTCAC 1D 22D 5.93%

[0080] Edit Plant Type T1 target T2 target T1 Edit Type T2 Editing Type Editing efficiency WT ACGCCCACCTAAGCCATTGA CTGCAAAGTACTTGGCTGATGCCGGTCAC -- -- -- Plant 4 (1) ACGCCCACCTAAGCC-TGA CTG---------------------------------C 2D 25D 18.02% Plant 4 (2) ACGCCCACCTAAGCCATTGA CTG---------------------------------C WT 25D 13.57% Plant 4 (3) ACGCCCACCTAAGCCATTGA CTG---------------------------------C SNP 25D 13.26% Plant 4 (4) ACGCCCACCTAAGCC-TGA CTG---------------------------------C 2D 25D 7.60% Plant 4 (5) ACGCCCACCTAAGC-TGA CTG------------------------------C 3D 25D 6.07% Plant 4 (6) ACGCCCACCTAAGCCATTGA CTGCAAAGTACTTGGCTGATGCCGGTCAC WT WT 5.26% Plant 4 (7) ACGCCCACCTAAGCCATTGA CTGCAAAGTACTTGGC-TGCCGGTCAC SNP 3D 5.03%

[0081] Example 2

[0082] A method for constructing a Cas9 gene editing system in Erigeron breviscapus, comprising the following steps:

[0083] (1) Construction of phylogenetic tree

[0084] First, a BLAST search was performed using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) to download the amino acid sequence of the NtPDS gene. Then, a BLAST search was performed using the Erigeron breviscapus plant database (http: / / cucurbitgenomics.org / ) to download the sequences of PDS-related genes in Erigeron breviscapus. These sequences were imported into MEGA7 software, and a phylogenetic tree was constructed using the neighbor-joining (NJ) method.

[0085] (2) Selection and design of EbPDS gene target sites

[0086] Based on homology analysis, the EbPDS gene from Erigeron breviscapus, which has high homology to the tobacco NtPDS, was selected. Based on the EbPDS gene sequence information and sequence alignment results, and in conjunction with the target site design website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), two EbPDS gene target sites were designed, and PCR amplification primers were designed based on the target sites.

[0087] (3) Gene amplification and recovery

[0088] After synthesizing target site PCR primers, gene amplification was performed using the PGTR plasmid as a template using DNA polymerase (Phanta). The amplification system was as follows: 15 μl of Novay 2× Rapid Taq Master Mix, 0.3 μl of Primer F (10 μM), 0.3 μl of Primer R (10 μM), 1.5 μl of PGTR template, and 30 μl of water. The reaction program was 95°C for 3 minutes, followed by 35 cycles of 95°C for 20 seconds, 55°C for 20 seconds, and 72°C for 10 seconds, followed by 72°C for 3 minutes and 25°C for 1 second. After completion of the PCR amplification process, the length of the amplified gene band was confirmed by 1.2% agarose gel electrophoresis to confirm that the amplified gene band was consistent with that of the target gene. The PCR product was detected by agarose gel electrophoresis and the band was similar in length to that of the target gene, indicating good amplification. The target gene was then purified using a gel extraction kit from GenStar. The recovered concentration was determined using the NanoDrop 2000 instrument and the samples were stored in a -20°C refrigerator.

[0089] (4) Construction and identification of gene recombination vectors

[0090] A. Vector linearization: Double-digest the PV58-Cas9 plasmid with the nuclease Kpn1 to obtain the linearized vector PV58-Cas9. Purify and recover the linearized vector using Omega's EZNA® CyclePure Kit, determine the concentration, and store at -20°C until ready for use.

[0091] B. Gene recombination: The target gene amplified using the ready-to-use seamless cloning enzyme kit of Sangon Biotech (Shanghai) Co., Ltd. was ligated and recombined with the linearized vector PV58-Cas9. The ligation and transformation methods used were recombination ligation and heat shock transformation, and the transformed strain was E. coli (DH5α) competent.

[0092] PCR assay for bacterial solution C: Eight single colonies were randomly selected from the transformation medium in a clean bench and incubated in 20 μl of ddH2O. 3 μl of each colony was used as template for PCR amplification. The PCR reaction system used was 2xTaq Master Mix (Nanjing Novozymes Biotechnology Co., Ltd.). The PCR program was 95°C for 3 minutes, 95°C for 30 seconds, 55°C for 15 seconds, and 72°C for 30 kb for 35 cycles. After 72°C for 5 minutes, the PCR product was analyzed on 1% agarose gel. Agarose gel electrophoresis revealed distinct bands between 750 and 500 bp, closely matching the target fragment (506 bp), consistent with the expected result. The bacterial solution was then sent to Qingke for sequencing, which showed successful gene ligation with no mutations. The single colony was selected as a positive strain, indicating successful assembly. The culture was preserved using 50% glycerol and bacterial solution at a volume ratio of 1:1.

[0093] (5) Plasmid vector extraction and Agrobacterium EHA105 transformation

[0094] Vector plasmid extraction: The vector plasmid containing the recombinant plasmid PV58-Cas9-EbPDS was extracted using the ready-to-use Steadure plasmid extraction kit from Wuhan Eric Biotechnology Co., Ltd. Plasmids were extracted from the positive clones that were correctly aligned in Escherichia coli.

[0095] Transformation of Agrobacterium tumefaciens EHA105: Transfer 50 μL of competent Agrobacterium tumefaciens EHA105 to a 1.5 mL centrifuge tube. Add 5 μL of the correctly aligned plasmid and pipette to mix thoroughly. Incubate on ice for 5 minutes, quickly freeze in liquid nitrogen for 5 minutes, heat shock at 37°C for 5 minutes, and then place on ice for 5 minutes. Add 700 μL of antibiotic-free liquid LB medium and resuspend in a shaker at 28°C, 200 rpm, for 3 hours. Spread 70 μL of the bacterial suspension onto an LB plate containing 45 mg / L Kan and 20 mg / L Rif. Incubate inverted in a 30°C incubator for 2–3 days. Pick a single colony and test for the target gene using PCR.

[0096] (6) Preparation of infection solution

[0097] A single positive Agrobacterium colony containing the recombinant plasmid PV58-Cas9-EbPDS was added to 5 mL of LB liquid medium containing Kan (40 mg / ml) and Rif (40 mg / ml), and cultured overnight at 28°C and 200 rpm. 500 μL of the bacterial solution was added to 50 mL of LB liquid medium containing Kan (40 mg / ml) and Rif (40 mg / ml), and cultured at 28°C and 200 rpm to a bacterial solution OD value of 1.5. The bacteria were collected by centrifugation at 5000 rpm at room temperature for 8 min, the supernatant was discarded, and the resuspension was added to the clean bench to prepare the infection solution so that the OD value was 0.25.

[0098] (7) Agrobacterium-mediated genetic transformation of Erigeron breviscapus

[0099] The leaf explants of Erigeron breviscapus were placed in the prepared infection solution containing the recombinant plasmid PV58-Cas9-EbPDS and vacuum transformation treatment was carried out in sequence. The infection time was 30 minutes. It was necessary to first vacuum pressurize at 0.7 kPa for 15 minutes, then take it out and shake it, and then pressurize it for 15 minutes. After the infection, the infection solution was poured out, and the leaf explants were placed on sterile filter paper to absorb the moisture. The leaf explants were then transferred to the Erigeron breviscapus co-culture medium MS + 0.004 mg / mL 6-BA + 0.0005 mg / mL TDZ + 0.002 mg / mL NAA + 3% sucrose + 0.8% agar + 100 μmol / L AS. The co-culture was dark culture, the culture temperature was 22-25 ° C, and the culture time was 2 days.

[0100] After two days of co-cultivation, leaf explants were inoculated onto delayed selection medium (MS) supplemented with 0.004 mg / mL 6-BA, 0.0005 mg / mL TDZ, 0.002 mg / mL NAA, 3% sucrose, 0.8% agar, and 0.27 mg / mL Tmt. The culture was then placed in a light-incubation room at 25°C for 14 days. Unbrown calli after delayed selection were transferred to selection medium (MS supplemented with 0.002 mg / mL 6-BA, 0.005 mg / mL TDZ, 0.001 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, and 10 mg / L Hyg) and continued to be cultured in the light. Newly generated calli with successful transfection were observed after approximately three weeks. First, inoculate the selected callus onto a shoot initiation medium (SH) supplemented with 0.001mg / mL 6-BA, 0.001mg / mL NAA, 0.08g / L AD, 0.05g / L GIu, 2g / L CH, 3% sucrose, 0.8% agar, 0.27mg / mL Tmt, and 5mg / L Hyg) and incubate in a light-intensified incubator at 25°C. After approximately three weeks, small buds will appear on the surface of the callus. Inoculate the entire callus with sprouts onto a shoot differentiation medium (MS) supplemented with 0.0005mg / mL KT, 0.0003mg / mL NAA, 3% sucrose, 0.8% agar, 0.27mg / mL Tmt, and 5mg / L Hyg) until the sprouts develop into seedlings. The seedlings were transferred to rooting medium MS, 0.1 mg / L NAA, 1% sucrose, 0.8% agar, and 0.27 mg / ml Tmt to obtain Erigeron breviscapus transgenic plants.

[0101] Example 3

[0102] A method for constructing a Cas9 gene editing system in Erigeron breviscapus, comprising the following steps:

[0103] (1) Construction of phylogenetic tree

[0104] First, a BLAST search was performed using the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) to download the amino acid sequence of the NtPDS gene. Then, a BLAST search was performed using the Erigeron breviscapus plant database (http: / / cucurbitgenomics.org / ) to download the sequences of PDS-related genes in Erigeron breviscapus. These sequences were imported into MEGA7 software, and a phylogenetic tree was constructed using the neighbor-joining (NJ) method.

[0105] (2) Selection and design of EbPDS gene target sites

[0106] Based on homology analysis, the EbPDS gene from Erigeron breviscapus, which has high homology to the tobacco NtPDS, was selected. Based on the EbPDS gene sequence information and sequence alignment results, two EbPDS gene target sites were designed in conjunction with the target site design website http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR. PCR amplification primers were designed based on the target sites.

[0107] (3) Gene amplification and recovery

[0108] After synthesizing target site PCR primers, gene amplification was performed using the PGTR plasmid as a template using DNA polymerase (Phanta). The amplification system was as follows: 15 μl of Novay 2× Rapid Taq Master Mix, 0.3 μl of Primer F (10 μM), 0.3 μl of Primer R (10 μM), 1.5 μl of PGTR template, and 30 μl of water. The reaction program was 95°C for 3 minutes, followed by 35 cycles of 95°C for 20 seconds, 55°C for 20 seconds, and 72°C for 10 seconds, followed by 72°C for 3 minutes and 25°C for 1 second. After completion of the PCR amplification process, the length of the amplified gene band was confirmed by 1.2% agarose gel electrophoresis to confirm that the amplified gene band was consistent with that of the target gene. The PCR product was detected by agarose gel electrophoresis and the band was similar in length to that of the target gene, indicating good amplification. The target gene was then purified using a gel extraction kit from GenStar. The recovered concentration was determined using the NanoDrop 2000 instrument and the samples were stored in a -20°C refrigerator.

[0109] (4) Construction and identification of gene recombination vectors

[0110] A. Vector linearization: Double-digest the PV58-Cas9 plasmid with the nuclease Kpn1 to obtain the linearized vector PV58-Cas9. Purify and recover the linearized vector using Omega's EZNA® CyclePure Kit, determine the concentration, and store at -20°C until ready for use.

[0111] B. Gene recombination: The target gene amplified using the ready-to-use seamless cloning enzyme kit of Sangon Biotech (Shanghai) Co., Ltd. was ligated and recombined with the linearized vector PV58-Cas9. The ligation and transformation methods used were recombination ligation and heat shock transformation, and the transformed strain was E. coli (DH5α) competent.

[0112] PCR assay for bacterial solution C: Eight single colonies were randomly selected from the transformation medium in a clean bench and incubated in 20 μl of ddH2O. 3 μl of each colony was used as template for PCR amplification. The PCR reaction system used was 2xTaq Master Mix (Nanjing Novozymes Biotechnology Co., Ltd.). The PCR program was 95°C for 3 minutes, 95°C for 30 seconds, 55°C for 15 seconds, and 72°C for 30 kb for 35 cycles. After 72°C for 5 minutes, the PCR product was analyzed on 1% agarose gel. Agarose gel electrophoresis revealed distinct bands between 750 and 500 bp, closely matching the target fragment (506 bp), consistent with the expected result. The bacterial solution was then sent to Qingke for sequencing, which showed successful gene ligation with no mutations. The single colony was selected as a positive strain, indicating successful assembly. The culture was preserved using 50% glycerol and bacterial solution at a volume ratio of 1:1.

[0113] (5) Plasmid vector extraction and Agrobacterium EHA105 transformation

[0114] Vector plasmid extraction: The vector plasmid containing the recombinant plasmid PV58-Cas9-EbPDS was extracted using the ready-to-use Steadure plasmid extraction kit from Wuhan Eric Biotechnology Co., Ltd. Plasmids were extracted from the positive clones that were correctly aligned in Escherichia coli.

[0115] Transformation of Agrobacterium tumefaciens EHA105: Transfer 50 μL of competent Agrobacterium tumefaciens EHA105 to a 1.5 mL centrifuge tube. Add 5 μL of the correctly aligned plasmid and pipette to mix thoroughly. Incubate on ice for 5 minutes, quickly freeze in liquid nitrogen for 5 minutes, heat shock at 37°C for 5 minutes, and then place on ice for 5 minutes. Add 700 μL of antibiotic-free liquid LB medium and resuspend in a shaker at 28°C, 200 rpm, for 3 hours. Spread 70 μL of the bacterial suspension onto an LB plate containing 47 mg / L Kan and 30 mg / L Rif. Incubate in an inverted position at 30°C for 2–3 days. Pick a single colony and test for the target gene using PCR.

[0116] (6) Preparation of infection solution

[0117] A single positive Agrobacterium colony containing the recombinant plasmid PV58-Cas9-EbPDS was added to 5 mL of LB liquid culture medium containing Kan (65 mg / ml) and Rif (70 mg / ml), and cultured overnight at 28°C and 200 rpm. 500 μL of the bacterial solution was added to 50 mL of LB liquid culture medium containing Kan (65 mg / ml) and Rif (70 mg / ml), and cultured at 28°C and 200 rpm to a bacterial solution OD value of 2. The bacteria were collected by centrifugation at 5000 rpm at room temperature for 8 min, the supernatant was discarded, and the resuspension was added to the clean bench to prepare the infection solution so that the OD value was 0.3.

[0118] (7) Agrobacterium-mediated genetic transformation of Erigeron breviscapus

[0119] The leaf explants of Erigeron breviscapus were placed in the prepared infection solution containing the recombinant plasmid PV58-Cas9-EbPDS and vacuum transformation treatment was carried out in sequence. The infection time was 30 minutes. It was necessary to first vacuum pressurize at 0.7 kPa for 15 minutes, then take it out and shake it, and then pressurize it for 15 minutes. After the infection, the infection solution was poured out, and the leaf explants were placed on sterile filter paper to absorb the moisture. The leaf explants were then transferred to the Erigeron breviscapus co-culture medium MS + 0.004 mg / mL 6-BA + 0.0005 mg / mL TDZ + 0.002 mg / mL NAA + 3% sucrose + 0.8% agar + 100 μmol / L AS. The co-culture was dark culture, the culture temperature was 22-25 ° C, and the culture time was 2 days.

[0120] After two days of co-cultivation, leaf explants were inoculated onto delayed selection medium (MS) supplemented with 0.004 mg / mL 6-BA, 0.0005 mg / mL TDZ, 0.002 mg / mL NAA, 3% sucrose, 0.8% agar, and 0.27 mg / mL Tmt. The culture was then placed in a light-incubation room at 25°C for 14 days. Unbrown calli after delayed selection were transferred to selection medium (MS supplemented with 0.002 mg / mL 6-BA, 0.005 mg / mL TDZ, 0.001 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, and 10 mg / L Hyg) and continued to be cultured in the light. Newly generated calli with successful transfection were observed after approximately three weeks. First, inoculate the selected callus onto a shoot initiation medium (SH) supplemented with 0.001mg / mL 6-BA, 0.001mg / mL NAA, 0.08g / L AD, 0.05g / L GIu, 2g / L CH, 3% sucrose, 0.8% agar, 0.27mg / mL Tmt, and 5mg / L Hyg) and incubate in a light-intensified incubator at 25°C. After approximately three weeks, small buds will appear on the surface of the callus. Inoculate the entire callus with sprouts onto a shoot differentiation medium (MS) supplemented with 0.0005mg / mL KT, 0.0003mg / mL NAA, 3% sucrose, 0.8% agar, 0.27mg / mL Tmt, and 5mg / L Hyg) until the sprouts develop into seedlings. The seedlings were transferred to rooting medium MS, 0.1 mg / L NAA, 1% sucrose, 0.8% agar, and 0.27 mg / ml Tmt to obtain Erigeron breviscapus transgenic plants.

[0121] In summary, through the study of various examples, it was found that the present invention successfully applied the EbPDS gene of Breviscapus breviscapus to CRISPR / cas9-mediated genome editing, effectively knocked out the plant olefin desaturase (PDS) gene, and the gene editing system constructed by PV58-Cas9-EbPDS Agrobacterium was efficient and feasible ( Figure 1 In the breeding and variety improvement of Erigeron breviscapus, the albinism trait can be used as a clear marker. By observing whether the offspring plants of Erigeron breviscapus show the albinism phenotype, individuals with a specific genotype can be quickly screened out, thus accelerating the breeding process.

[0122] The above description is based on the detailed description of the embodiments of the present invention, but the present invention is not limited to the described embodiments. It is obvious to those skilled in the art that various changes, modifications, substitutions and variations of these embodiments may be made without departing from the principles and spirit of the present invention, and they still fall within the scope of protection of the present invention.

Claims

1. A method for constructing a Cas9 gene editing system in Erigeron breviscapus, characterized in that: The following steps are involved: S1. Select the EbPDS gene from Erigeron breviscapus, design the EbPDS gene target site based on the gene sequence, and design PCR amplification primers based on the target site; S2. Amplify the EbPDS gene using the PGTR plasmid as a template, and connect the EbPDS amplified fragment to the vector PV58-Cas9 by homologous recombination to obtain the recombinant plasmid PV58-Cas9-EbPDS; S3. The constructed recombinant plasmid PV58-Cas9-EbPDS is transformed into Escherichia coli DH5α by electroporation, and then the recombinant plasmid PV58-Cas9-EbPDS is transformed into Agrobacterium EHA105 and cultured. Positive clones are screened by colony PCR to obtain PV58-Cas9-EbPDS Agrobacterium, and leaf explants of Erigeron breviscapus are placed in an infection solution containing PV58-Cas9-EbPDS Agrobacterium for infection; the nucleotide sequence of the EbPDS gene is shown in SEQ ID NO: 1; the amino acid sequence of the protein encoded by the EbPDS gene is shown in SEQ ID NO:

2.

2. The method for constructing the Cas9 gene editing system of Breviscapus breviscapus according to claim 1, characterized in that: Two target sites, T1 and T2, were designed based on the EbPDS gene sequence. The PCR amplification primers for the target sites were EbPDS-T1-F and EbPDS-T2-R. The primer sequences are as follows: EbPDS-T1-F: TTCCCGGCTGGTGCAACGCCCACCTAAGCCATTGAGTTTTAGAGCTAGAAATAGCAAGT EbPDS-T2-R: TTCTAGCTCTAAAACGCATCAGCCAAGTACTTTGCTGCACCAGCCGGGAAT.

3. The construction method according to claim 1, wherein: Before extracting the recombinant plasmid PV58-Cas9-EbPDS, colony PCR verification was performed using primers EbPDS-U26-F and EbPDS-inf-T2as-R. The primer sequences are as follows: EbPDS-U26-F: TGTCCCAGGATTAGAATGATTAGGC EbPDS-inf-T2as-R: TTCTAGCTCTAAAACGCATCAGCCAAGTACTTTGC.

4. The method for constructing the Cas9 gene editing system of Breviscapus breviscapus according to claim 1, characterized in that: The EbPDS gene amplification system is: Novay 2× Rapid Taq Master Mix 15 μl, Primer F 0.3 μl, PrimerR 0.3 μl, PGTR template 1.5 μl, and water is added to 30 μl; the amplification reaction program is: 95°C 3 min; 95°C 20 s, 55°C 20 s, 72°C 10 s, 35 cycles; 72°C 3 min; 25°C 1 s.

5. The method for constructing the Cas9 gene editing system of Breviscapus breviscapus according to claim 1, characterized in that: The vector PV58-Cas9 is a linearized vector PV58-Cas9 obtained by double-digesting the PV58-Cas9 vector plasmid using the nuclease Kpnl.

6. The method for constructing the Breviscapus Cas9 gene editing system according to claim 1, characterized in that: The steps of transforming Agrobacterium are as follows: taking 50 μL of Agrobacterium EHA105 competent cells into a 1.5 mL centrifuge tube, adding 5 μL of correctly aligned plasmid, and mixing by pipetting, and then standing on ice for 5 minutes, quick-freezing with liquid nitrogen for 5 minutes, heat shocking at 37° C. for 5 minutes, and ice bathing for 5 minutes; adding 700 μL of LB antibiotic-free liquid culture medium, and resuscitating at 28° C. and 200 rpm on a shaking table for 3 hours; aspirating 70 μL of bacterial liquid and applying it to an LB plate containing 45-50 mg / L kanamycin and 20-30 mg / L rifampicin, and culturing inverted in a 30° C. incubator for 2-3 days.

7. The method for constructing the Breviscapus Cas9 gene editing system according to claim 1, characterized in that: The preparation method of the infection fluid comprises the following steps: adding PV58-Cas9-EbPDS Agrobacterium to LB culture medium supplemented with 40-65 mg / ml kanamycin and 40-70 mg / ml rifampicin, shaking at 28°C overnight, and centrifuging and diluting the bacterial solution until the turbid OD value reaches 1-2 with a scutellaria suspension to an OD value of 0.2-0.3, and adding AS to obtain the PV58-Cas9-EbPDS Agrobacterium infection fluid; the scutellaria suspension comprises MS basal culture medium, 30 g / L sucrose, and 10-40 g / L glucose.

8. An application of the PV58-Cas9-EbPDS Agrobacterium according to claim 1 in propagating Erigeron breviscapus, characterized in that: The following steps are involved: The leaf explants of Erigeron breviscapus were infected in an infection solution containing PV58-Cas9-EbPDS Agrobacterium, and then cultured in Erigeron breviscapus co-culture medium, delayed screening medium, and screening medium to obtain newly generated callus tissue; the newly generated callus tissue was cultured in a bud initiation medium, a bud differentiation medium, and a rooting medium to obtain transgenic plants; The breviscapus co-culture medium is: MS, 0.004 mg / mL 6-BA, 0.0005 mg / mL TDZ, 0.002 mg / mL NAA, 3% sucrose, 0.8% agar, and 100 μmol / L AS. The co-culture is dark culture at a temperature of 22-25° C. for 2 days. The delayed selection medium is: MS, 0.004 mg / mL 6-BA, 0.0005 mg / mL TDZ, 0.002 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, and the culture conditions are 25°C light culture for 14 days; The screening medium comprises: MS, 0.002 mg / mL 6-BA, 0.005 mg / mL TDZ, 0.001 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, and 10 mg / L Hyg. The culture conditions are 25°C under illumination for 2-4 weeks. The bud initiation medium is: SH, 0.001 mg / mL 6-BA, 0.001 mg / mL NAA, 0.08 g / L AD, 0.05 g / LGIu, 2 g / L CH, 3% sucrose, 0.8% agar, 0.27 mg / ml Tmt, 5 mg / L Hyg; cultured at 25°C in the light; The bud differentiation medium comprises: MS, 0.0005 mg / mL KT, 0.0003 mg / mL NAA, 3% sucrose, 0.8% agar, 0.27 mg / mL Tmt, 5 mg / L Hyg; cultured at 25°C under light; The rooting medium comprises: MS, 0.1 mg / L NAA, 1% sucrose, 0.8% agar, and 0.27 mg / ml Tmt.

Images