Human genome region 7q33 related to occurrence of acute mountain sickness and application of single nucleotide polymorphic site of human genome region 7q33
Through genome-wide association research, the susceptibility association of genomic region 7q33 and acute alpine disease has been located, which solves the physiological mechanism problem of difficult to explain AMS susceptibility in the prior art, and has achieved screening and reduced risk in individuals susceptible to acute alpine disease.
Patent Information
- Application Number
- CN202510309424.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-17
- Publication Date
- 2025-06-13
AI Technical Summary
The prior art is difficult to effectively explain the physiological mechanism of susceptibility to acute alpine disease (AMS) and cannot fully explain the overall heritability of AMS, especially the lack of correlation between genomic region 7q33 and AMS susceptibility.
By recruiting two cohorts of population, a genome-wide association study was conducted after rapidly rising to high altitude areas. The genomic region 7q33 was located as a susceptible region for acute alpine disease and verified its association in different populations. Specific methods include analysis based on case-control strategy, using polymorphic sites of SNP rs1424442 for susceptibility assessment.
The susceptibility association of genomic region 7q33 with acute alpine disease was successfully determined, providing methods to screen and predict individuals with susceptibility to acute alpine disease, reducing the risk of acute alpine disease in these individuals.
Smart Images

Figure CN120138129A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of the human genomic region 7q33 and its single nucleotide polymorphism sites related to the occurrence of acute mountain sickness. Background Art
[0002] Acute mountain sickness (AMS) is the most common disease in high-altitude areas and usually occurs shortly after a rapid ascent to a hypoxic environment. The incidence of AMS increases with the increase in altitude. At an altitude of 2,850 meters, the incidence is 5.8%; at an altitude of 3,050 meters, the incidence is 2.1%; at an altitude of 3,650 meters, the incidence is 14.8%; at an altitude of 4,559 meters, the incidence is 21.9%.
[0003] The main symptoms of AMS include headache, loss of appetite, nausea, dizziness, fatigue, and insomnia. Although altitude sickness itself is not life-threatening, the disease may develop into more serious conditions such as high-altitude pulmonary edema (HAPE) and high-altitude cerebral edema (HACE), which can be fatal if not treated promptly. With more and more people traveling, working, and exercising in high-altitude areas, altitude sickness has become an important public health problem.
[0004] However, the exact pathophysiology of AMS is still poorly understood. Studies have shown that genetic factors play an important role in the susceptibility to AMS, and certain genotypes are beneficial for rapid adaptation to high-altitude environments. Candidate gene-based association studies have identified several single nucleotide polymorphism (SNP) sites that are significantly associated with the risk of AMS. The genes associated with these SNPs are mainly divided into the following four categories: (a) Hypoxia-inducible factor (HIF) pathway genes, such as EPAS1 (index SNP, rs6756667, rs4953348) and EGLN1 (rs12097901, rs2790859); (b) Genes involved in angiogenesis, vascular permeability, and vascular smooth muscle relaxation, such as VEGFA (rs3025039), eNOS3 (rs1799983) and EDN1 (rs2070699); (c) Heat shock protein (HSP) genes, such as HSPA1A (rs1008438), HSPA1B (rs10661581) and HSPA1L (rs2227956); (d) Genes in the renin-angiotensin system, such as ACE (rs4340) and AGT (rs699).
[0005] However, due to the limited understanding of the physiological mechanisms of susceptibility to AMS, the selection of candidate genes has been restricted. In addition, this method cannot fully explain the overall heritability of AMS. There are currently no reports on the correlation between polymorphisms in the genomic region 7q33 ( BPGM ) and the susceptibility to the occurrence of AMS. Summary of the Invention
[0006] In view of the deficiencies of the prior art, the present invention provides the application of the human genomic region 7q33 and its single nucleotide polymorphism sites related to the occurrence of acute mountain sickness, which can, to a certain extent, help screen individuals carrying the susceptible genes of human acute mountain sickness, predict the susceptibility of humans to acute mountain sickness, screen susceptible individuals of acute mountain sickness, and evaluate the risk of suffering from acute mountain sickness.
[0007] To solve the above technical problems and achieve the above technical effects, the present invention is realized through the following technical solutions: To discover the susceptible genes of new acute mountain sickness, the inventors of the present invention recruited two batches of population cohorts at different times and all reached high altitude areas in a relatively short time. After all participants listened to a comprehensive introduction of the research details, they all provided written informed consent. Among them, on the night of arrival at the plateau, participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 were classified into the case group, while participants without obvious symptoms were classified into the control group. Thus, population cohort 1 included 78 cases and 148 controls, and population cohort 2 included 122 cases and 245 controls. The present invention combined the two population cohorts for joint analysis, adopted a case-control strategy, and carried out a genome-wide association study. Finally, the genomic region 7q33 was successfully located as the susceptible region of acute mountain sickness and was verified separately in the two populations. Further, the inventors of the present invention conducted a more detailed analysis of the genomic region 7q33, thereby proposing various applications and products.
[0008] First, as described above, the present invention analyzed the susceptible genomic regions, susceptible alleles, and susceptible genotypes associated with the occurrence of acute mountain sickness. That is, the C allele of the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33 is the susceptible allele for acute mountain sickness, and the CC genotype is the susceptible genotype for acute mountain sickness. Moreover, the present invention provides an idea for determining the susceptibility of a population or an individual to the occurrence of acute mountain sickness by detecting rs1424442. When the rs1424442 of an individual shows the CC genotype, it indicates that the individual has a higher probability of suffering from acute mountain sickness. The present invention analyzed expression Quantitative Trait Loci (eQTL), and the protective allele T of rs1424442 was significantly associated with the low expression of the BPGM gene in arteries (P = 7.88×10 -8 ). The co-localization results of eQTL and genome-wide association study (GWAS) showed that the posterior probability of co-localization exceeded 90%. These results indicate that BPGM is a major susceptible candidate gene for acute mountain sickness on chromosome 7q33.
[0009] Second, the present invention also analyzed the application method of the single nucleotide polymorphism site rs1424442 in the susceptible genomic region 7q33 associated with the risk of acute mountain sickness in the prevention and control of acute mountain sickness patients. For example, since the present invention confirmed the association between the CC genotype of rs1424442 and the susceptibility to acute mountain sickness, in the prevention and control of acute mountain sickness patients, it is necessary to detect the genotype of rs1424442 for the consulted object to determine whether the object carries the susceptible genotype of acute mountain sickness, that is, the CC genotype of rs1424442. For individuals with the CC genotype of rs1424442, scientific intervention can be carried out, such as suggesting early therapeutic prevention, etc., so as to specifically reduce the occurrence risk of acute mountain sickness in these susceptible populations.
[0010] Furthermore, the present invention also studied a detection method for screening acute mountain sickness patients. The inventors of the present invention completed an association analysis on two populations using a case-control strategy and finally found that rs1424442 was significantly associated with the susceptible risk of acute mountain sickness. Therefore, this detection method can effectively detect susceptible populations of acute mountain sickness.
[0011] Based on the above three aspects of analysis and research, the present invention can provide any of the following uses: 1. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of single nucleotide polymorphism site rs1424442 in human genomic region 7q33 in the preparation of a product for screening or assisting in screening acute mountain sickness susceptible individuals or non-susceptible individuals.
[0012] 2. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of single nucleotide polymorphism site rs1424442 in human genomic region 7q33 in the preparation of a product for detecting or assisting in detecting the susceptibility to acute mountain sickness.
[0013] 3. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of single nucleotide polymorphism site rs1424442 in human genomic region 7q33 in the preparation of a product for detecting or assisting in detecting the risk of acute mountain sickness.
[0014] 4. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of single nucleotide polymorphism site rs1424442 in human genomic region 7q33 in the preparation of a product for evaluating or assisting in evaluating the risk of acute mountain sickness.
[0015] 5. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of single nucleotide polymorphism site rs1424442 in human genomic region 7q33 in the preparation of a product for screening and assisting in screening acute mountain sickness susceptible genotypes or non-susceptible genotypes.
[0016] 6. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in human genomic region 7q33 that are in strong linkage disequilibrium with single nucleotide polymorphism site rs1424442 in the preparation of a product for screening or assisting in screening acute mountain sickness susceptible individuals or non-susceptible individuals.
[0017] 7. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in human genomic region 7q33 that are in strong linkage disequilibrium with single nucleotide polymorphism site rs1424442 in the preparation of a product for detecting or assisting in detecting the susceptibility to acute mountain sickness.
[0018] 8. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in human genomic region 7q33 that are in strong linkage disequilibrium with single nucleotide polymorphism site rs1424442 in the preparation of a product for detecting or assisting in detecting the risk of acute mountain sickness.
[0019] 9. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in the human genomic region 7q33 that are in strong linkage disequilibrium with the single nucleotide polymorphism site rs1424442 in the preparation of a product for assisting in evaluating the risk of acute mountain sickness.
[0020] 10. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in the human genomic region 7q33 that are in strong linkage disequilibrium with the single nucleotide polymorphism site rs1424442 in the preparation of a product for screening and assisting in screening for susceptible genotypes or non-susceptible genotypes of acute mountain sickness.
[0021] 11. A product containing a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33, including: a) A product for detecting single nucleotide polymorphisms or genotypes related to acute mountain sickness; b) A product for identifying or assisting in identifying single nucleotide polymorphisms or genotypes related to acute mountain sickness; c) A product for screening or assisting in screening for patients with acute mountain sickness; d) A product for detecting or assisting in detecting the susceptibility to acute mountain sickness.
[0022] In the above applications and products, the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33 can specifically be the nucleotide type of the single nucleotide polymorphism site rs1424442. The C allele of the single nucleotide polymorphism site rs1424442 is a susceptible allele for acute mountain sickness, and the CC genotype of the single nucleotide polymorphism site rs1424442 is a susceptible genotype for acute mountain sickness. Both the CC genotype or the C allele of the single nucleotide polymorphism site rs1424442 are indicators of susceptibility to acute mountain sickness.
[0023] Specifically, the frequency of the risk allele C of rs1424442 in patients with acute mountain sickness is significantly higher than its frequency in the control sample. Thus, when the genotype of rs1424442 is CC, it can predict that the individual to be tested is susceptible to acute mountain sickness. In addition, the protective allele T of rs1424442 is significantly correlated with the low expression of the BPGM gene in arteries. Therefore, a primer set for detecting rs1424442 can be effectively used to screen for susceptible populations of acute mountain sickness, and further can assist in predicting individuals with acute mountain sickness in a short time, at low cost, and with high accuracy at an early stage, providing a theoretical basis for clinical treatment and prognosis evaluation, etc.
[0024] In the above applications and products, the substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33 contains PCR primers and / or single-base extension primers for amplifying a human genomic DNA fragment including the single nucleotide polymorphism site rs1424442.
[0025] In the above applications and products, the product can be a kit for screening the susceptibility to acute mountain sickness, and the kit contains reagents for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33.
[0026] The reagents include primers and / or probes. The methods of using the reagents include, but are not limited to, TaqMan genotyping and Sequenom genotyping, etc.
[0027] The primers include a forward primer and a reverse primer, wherein, The nucleotide sequence of the forward primer is: AGGCCATTGTTCCATTTCCA (SEQ ID NO:1); The nucleotide sequence of the reverse primer is: CCCAGGAAGTCATAATACCC (SEQ ID NO:2); Using the forward primer and the reverse primer can effectively detect the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33.
[0028] The probes are FAM probes and / or HEX probes, wherein, The nucleotide sequence of the FAM probe is: TGGTTGCAGTGAGCTCTGATCACGCCACT (SEQ ID NO:3); The nucleotide sequence of the HEX probe is: TGGTTGCAGTGAGCTCTGATCACGCCACT (SEQ ID NO:4); Using the FAM probe and / or the HEX probe can effectively detect the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33.
[0029] In the above applications and products, the product can be a device for screening acute mountain sickness patients, and the device includes: A sequencing device for sequencing a predetermined region in the whole genome of a patient to obtain a sequencing result; wherein, the predetermined region is 1 Kb upstream and downstream of rs1424442, whereby more effective sequencing can be performed; A comparison device, connected to the sequencing device, for determining the genotype of rs1424442 based on the obtained sequencing results; An analysis device, connected to the comparison device, for determining the susceptibility risk of acute mountain sickness based on the determined type of rs1424442.
[0030] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention conducts an association analysis between the single nucleotide polymorphism locus rs1424442 in the human genomic region 7q33 and the susceptibility of acute mountain sickness, determines that 7q33 is a susceptibility-related gene region of acute mountain sickness, can be effectively used to screen susceptible populations of acute mountain sickness, and conduct scientific interventions to specifically reduce the risk of acute mountain sickness in these susceptible populations.
[0031] The above description is only an overview of the technical solution of the present invention. In order to be able to more clearly understand the technical means of the present invention and implement it in accordance with the content of the description, the following takes the preferred embodiments of the present invention and describes them in detail in conjunction with the drawings. The specific implementation manners of the present invention are given in detail by the following embodiments and their accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] The drawings described herein are used to provide a further understanding of the present invention, form a part of this application, and the illustrative embodiments and descriptions of the present invention are used to explain the present invention and do not constitute an improper limitation to the present invention. In the drawings: Figure 1 Are the Manhattan plot (a) and quantile plot (b) of the genome-wide association study of the population cohort in Example 1 of the present invention.
[0033] Figure 2 Is the association region map of the region around SNP rs1424442 in Example 2 of the present invention.
[0034] Figure 3 Is the co-localization analysis result map of eQTLs and GWAS association signals at the SNP rs1424442 locus in Example 2 of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0035] The following will describe the preferred embodiments of the present invention in detail with reference to the drawings, so as to more clearly understand the purpose, features and advantages of the invention. It should be understood that the embodiments shown in the drawings are not a limitation to the scope of the present invention, but only to illustrate the essential spirit of the technical solution of the present invention.
[0036] In the following description, certain specific details are set forth in order to provide a thorough understanding of the various disclosed embodiments. However, one of ordinary skill in the art will recognize that the embodiments may be practiced without one or more of these specific details. In other instances, well-known devices, structures, and techniques associated with the present application may not be shown or described in detail so as not to unnecessarily obscure the description of the embodiments.
[0037] Unless the context requires otherwise, throughout the specification and claims, the words "comprise" and variations thereof, such as "comprising" and "having", should be construed in an open, inclusive sense, i.e., as "including, but not limited to".
[0038] References throughout the specification to "one embodiment" or "an embodiment" mean that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of "in one embodiment" or "in an embodiment" throughout the specification need not all refer to the same embodiment. Additionally, the particular features, structures, or characteristics may be combined in any manner in one or more embodiments.
[0039] As used in this specification and the appended claims, the singular forms "a" and "the" include plural referents unless the context clearly dictates otherwise. It should be noted that the term "or" is generally used in its inclusive sense of "and / or" unless the context clearly dictates otherwise.
[0040] Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0041] Example 1 Genome-wide Association Study of Acute Mountain Sickness (AMS) Susceptibility 1. Materials and Methods; 1.1. Research Subjects; The present invention included a total of two population cohorts. The first population cohort (Population Cohort 1) took a train from a low-altitude area to a high-altitude area (altitude 4,600 meters) in May 2022, and a total of 226 participants were recruited; the second population cohort (Population Cohort 2) took a bus from a low-altitude area to a high-altitude area (altitude 4,600 meters) in May 2023, and a total of 367 participants were recruited. After all participants received a comprehensive introduction to the research details, they all provided written informed consent. The present invention collected the sociodemographic information of all participants and drew approximately 2 mL of fasting venous blood from each participant before they ascended to the plateau and stored it in an environment of -80°C. On the night of arrival, each participant filled out the Lake Louise Questionnaire. Participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 were classified into the case group, while participants without obvious symptoms were classified into the control group.
[0042] 1.2, Genotyping, quality control, and imputation analysis; The present invention used the QICCmp DNA Blood Kit to extract genomic DNA from 1 mL of blood. The purified DNA was eluted in 100 μL of elution buffer (pH 8.0). The DNA quality was evaluated by two methods: (1) evaluating DNA degradation and contamination on a 1% agarose gel; (2) measuring the DNA concentration using the Qubit DNA Assay Kit with a Qubit 2.0 fluorometer. The samples were genotyped using the Illumina Infinium Global Screening Array-24 v1.0 BeadChip.
[0043] Subsequently, the present invention performed strict quality control on the samples and single nucleotide polymorphisms (SNPs) to ensure the robustness of the association test. The present invention excluded samples with low call rates (<90%), undetermined gender, close relatives (PI_HAT value greater than 0.2 in PLINK v.1.9), high heterozygosity rates (greater than 3 standard deviations from the mean), or outliers determined by principal component analysis. For SNPs, the present invention excluded SNPs with genotype call rates below 90%, deviation from Hardy-Weinberg equilibrium (control HWE deviation P < 1e-6, case HWE deviation P < 1e-10), minor allele frequencies below 5%, and SNPs located on the XY chromosomes.
[0044] To improve the genomic region coverage, the present invention uses the human genome hg19 and takes the 1000 Genomes Project data as a reference. The present invention uses SHAPEIT (v.4.1.2) and IMPUTE5 (v.1.1.5) to estimate the genotyping data. Finally, SNPs with an information score lower than 0.6 or a minor allele frequency lower than 0.01 are excluded.
[0045] 1.3, Association study The present invention uses the logistic regression model in PLINK v.1.9 for genome-wide association analysis, with gender, age, and the top 10 principal components as covariates. A quantile-quantile plot (Q-Q plot) was generated in R (4.3.1) to evaluate the distribution of P-values and the lambda (λ) inflation factor (genomic inflation factor) was evaluated to detect the presence of systematic bias.
[0046] See Figure 1 As shown in Figure 1 a, the present invention draws Manhattan plots based on population cohort 1, population cohort 2, and the combined human association results. Figure 1 The horizontal line in P a represents the genome-wide significance threshold. Among them, the genome-wide significance threshold for population cohort 1 P = 0.05, the genome-wide significance threshold for population cohort 2 P = 0.05, and the genome-wide significance threshold for the combined human association -5 .
[0047] See Figure 1 As shown in Figure 1 b, the present invention draws quantile plots based on population cohort 1, population cohort 2, and the combined human association results. Figure 1 The slanted line segment in
[0048] The present invention considers that SNPs with P < 5×10 -5 in the combined population and P < 0.05 in population 1 and population 2 are significantly different AMS-susceptible SNPs.
[0049] Subsequently, the present invention used CAVIAR (v.2.2) and FINEMAP (v.1.3.1) for fine-mapping analysis. A set of credible SNPs was determined for each locus, defined as the smallest set of variants that contains all causal variants with a certainty greater than 0.95. Subsequently, the present invention used RegulomeDB (V2) and Haploreg to identify potential functional SNPs.
[0050] 2. Results; 2.1 Results of genome-wide SNP data quality control; To discover the AMS susceptibility regions in the Chinese population, the present invention genotyped SNPs in two population cohorts. Since the same genotyping platform was used for both population cohorts, the present invention performed unified quality control on the genotyping data of these two populations. As shown in Tables 1 and 2, after strict quality control, Population Cohort 1 finally retained 74 cases and 145 controls, as well as 7,010,527 SNPs, Population Cohort 2 finally retained 84 cases and 176 controls, as well as 7,784,294 SNPs, and for the combined cohort, 156 cases and 3,313 controls, as well as 7,047,059 SNPs were finally retained.
[0051] Table 1 Quality control of population samples
[0052] Table 2 SNP quality control process
[0053] 2.2 Association analysis results The present invention performed association analysis on the combined population and verified it by performing association analysis on the two populations separately, thereby identifying the genomic region 7q33 that was significantly associated with AMS ( P < 5×10 -5 , P < 0.05, P < 0.05). In the combined population cohort (Population Cohort 1 + Population Cohort 2), chromosome 7q33 (rs1424442; odds ratio [OR] for the C allele = 2.019; 95% confidence interval [CI] = 1.493 - 2.731; P = 5.11×10 -6 ). In Population Cohort 1, chromosome 7q33 (index SNP rs1424442; ratio of odds [OR] for the C allele = 2.0113; 95% confidence interval [CI] = 1.2602 - 3.2092; P = 3.39×10 -3); in population cohort 2, chromosome 7q33 (rs1424442; odds ratio [OR] of the C allele = 1.691; 95% confidence interval [CI] = 1.123 - 2.546; P = 1.19×10 -2 ). As can be seen from Figure 1 , there are significant differences in allele frequencies at the above - mentioned loci between the case group and the control group.
[0054] Example 2 AMS Susceptibility Gene Mapping Analysis To identify potential AMS susceptibility genes on SNPs, the present invention performed eQTL analysis using 5 publicly available datasets: 1) QTLbase collected genome - wide QTL statistical summaries of many human molecular traits under over 95 tissue / cell types and various biological conditions. This database includes tens of millions of important genotype - molecular trait associations under different conditions; 2) The Genotype - Tissue Expression database (GTEx, version 8), covering 48 tissues (including blood and lung), detecting SNPs by whole - genome sequencing and measuring mRNA expression levels by RNA sequencing; 3) ImmuNexUT, covering 9852 immune cell samples from 416 donors, including 10 different immune - mediated diseases and 28 immune cell types from healthy donors; 4) FIVEx, including eQTL and sQTL data from 16 different studies in the EBI eQTL catalogue; 5) scQTLbase is a comprehensive portal for human single - cell eQTLs, which includes 304 datasets of 57 cell types and 95 cell states.
[0055] These datasets include approximately 16 million SNPs related to gene expression in specific cells, and approximately 690,000 disease - related sc - eQTLs from 3333 traits / diseases. The present invention only focused on protein - coding genes within the 2Mb region (1Mb upstream and downstream) around the SNP, and considered P < 0.001 as statistically significant. See Figure 2 shown, Figure 2 shows the 2Mb region around the index SNP rs1424442 located on chromosome 7q33. The P - values of SNPs in this region were calculated by a logistic regression model (adjusted for age, sex, and the top 10 PCs). The genomic positions are based on the human genome hg19. The P - value of rs1424442 is shown as a diamond. The linkage disequilibrium (LD) values (r2) of other SNPs with the index SNP (rs1424442) are represented by marker colors.
[0056] Figure 2 The results showed that within 1 Mb upstream and downstream of the SNP rs1424442 locus, gene BPGM was included. According to the results of QTLbase2, the protective allele T of rs1424442 was significantly associated with the low expression of the BPGM gene in arteries ( P =7.88×10 -8 ). In the present invention, the R software package coloc (v.5.2.3) was used to perform a co-localization analysis of eQTL and GWAS signals within a 100 kb region centered on the SNP. As shown in Figure 3 , the posterior probability of BPGM was 93.67%. These results indicate that BPGM is a major candidate gene on chromosome 7q33.
[0057] BPGM encodes bisphosphoglycerate mutase, which can produce 2,3-bisphosphoglycerate (2,3-DPG), regulate the oxygen release of hemoglobin, and is also crucial for effective glycolysis and ATP generation under anaerobic conditions. Under acute hypoxic conditions, an increase in 2,3-DPG levels reduces the affinity of hemoglobin for oxygen and promotes oxygen release into tissues. However, excessive production of 2,3-DPG can lead to insufficient oxygen supply in the lungs because the oxygen dissociation curve shifts too far to the right. Although this situation helps metabolic tissues release oxygen, it is harmful to oxygen uptake in the lungs, which can cause a significant decrease in arterial oxygen saturation.
[0058] In summary, both the association study and functional study of the present invention suggest that the AMS susceptibility genes in the region (7q33) where rs1424442 is located include the BPGM gene. The present invention confirms the association between the rs1424442 allele C and AMS susceptibility. In the prevention and control of AMS in the population, the genotypes of rs1424442 should be detected in the counseling objects for scientific intervention to specifically reduce the risk of AMS in these susceptible populations.
[0059] Based on the above analysis results, the present invention can provide any of the following uses: 1. The application of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism locus rs1424442 in the human genomic region 7q33 in the preparation of a product for screening or assisting in screening acute mountain sickness susceptible individuals or non-susceptible individuals.
[0060] 2. The application of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism locus rs1424442 in the human genomic region 7q33 in the preparation of a product for detecting or assisting in detecting the susceptibility to acute mountain sickness.
[0061] 3. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33 in the preparation of a product for detecting or assisting in the detection of the risk of acute mountain sickness.
[0062] 4. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33 in the preparation of a product for evaluating or assisting in the evaluation of the risk of acute mountain sickness.
[0063] 5. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33 in the preparation of a product for screening and assisting in the screening of acute mountain sickness susceptible genotypes or non-susceptible genotypes.
[0064] 6. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in strong linkage disequilibrium with the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33 in the preparation of a product for screening or assisting in the screening of acute mountain sickness susceptible individuals or non-susceptible individuals.
[0065] 7. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in strong linkage disequilibrium with the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33 in the preparation of a product for detecting or assisting in the detection of the susceptibility to acute mountain sickness.
[0066] 8. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in strong linkage disequilibrium with the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33 in the preparation of a product for detecting or assisting in the detection of the risk of acute mountain sickness.
[0067] 9. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in strong linkage disequilibrium with the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33 in the preparation of a product for assisting in the evaluation of the risk of acute mountain sickness.
[0068] 10. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in strong linkage disequilibrium with the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33 in the preparation of a product for screening and assisting in the screening of acute mountain sickness susceptible genotypes or non-susceptible genotypes.
[0069] 11. Products containing substances with polymorphisms or genotypes (i.e., alleles) of the single nucleotide polymorphism locus rs1424442 in the human genomic region 7q33, including: a) Products for detecting single nucleotide polymorphisms or genotypes related to acute mountain sickness; b) Products for identifying or assisting in identifying single nucleotide polymorphisms or genotypes related to acute mountain sickness; c) Products for screening or assisting in screening patients with acute mountain sickness; d) Products for detecting or assisting in detecting the susceptibility to acute mountain sickness.
[0070] In the above applications and products, the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism locus rs1424442 in the human genomic region 7q33 can specifically be the nucleotide type of the single nucleotide polymorphism locus rs1424442. The C allele of the single nucleotide polymorphism locus rs1424442 is the susceptible allele for acute mountain sickness, and the CC genotype of the single nucleotide polymorphism locus rs1424442 is the susceptible genotype for acute mountain sickness. Both the CC genotype or the C allele of the single nucleotide polymorphism locus rs1424442 are indicators of susceptibility to acute mountain sickness.
[0071] Specifically, the frequency of the rs1424442 risk allele C allele in patients with acute mountain sickness is significantly higher than its frequency in the control samples. Thus, if the genotype of rs1424442 is CC, then it can be predicted that the individual to be tested is susceptible to acute mountain sickness. In addition, the protective allele T of rs1424442 is significantly correlated with the low expression of the BPGM gene in arteries. Therefore, the primer set for detecting rs1424442 can be effectively used to screen the susceptible population of acute mountain sickness, and then can assist in predicting individuals with acute mountain sickness in a short time, at low cost, and with high accuracy at an early stage, providing a theoretical basis for clinical treatment and prognosis evaluation, etc.
[0072] In the above applications and products, the substance for detecting the polymorphism or genotype of the single nucleotide polymorphism locus rs1424442 in the human genomic region 7q33 contains PCR primers and / or single-base extension primers for amplifying the human genomic DNA fragment including the single nucleotide polymorphism locus rs1424442.
[0073] In the above applications and products, the product can be a kit for screening the susceptibility to acute mountain sickness, and the kit contains reagents of substances for detecting the polymorphism or genotype of the single nucleotide polymorphism locus rs1424442 in the human genomic region 7q33.
[0074] The reagent includes primers and / or probes. The methods of using the reagent include, but are not limited to, TaqMan genotyping, Sequenom genotyping, etc.
[0075] The primers include forward primers and reverse primers, wherein, The nucleotide sequence of the forward primer is: AGGCCATTGTTCCATTTCCA (SEQ ID NO:1); The nucleotide sequence of the reverse primer is: CCCAGGAAGTCATAATACCC (SEQ ID NO:2); Using the forward primer and the reverse primer can effectively detect the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33.
[0076] The probe is a FAM probe and / or a HEX probe, wherein, The nucleotide sequence of the FAM probe is: TGGTTGCAGTGAGCTCTGATCACGCCACT (SEQ ID NO:3); The nucleotide sequence of the HEX probe is: TGGTTGCAGTGAGCTCTGATCACGCCACT (SEQ ID NO:4); Using the FAM probe and / or the HEX probe can effectively detect the single nucleotide polymorphism site rs1424442 in the human genomic region 7q33.
[0077] In the above applications and products, the product can be a device for screening acute mountain sickness patients, and the device includes: A sequencing device for sequencing a predetermined region in the whole genome of a patient to obtain a sequencing result; wherein, the predetermined region is 1 Kb upstream and downstream of rs1424442, whereby sequencing can be carried out more effectively; A comparison device connected to the sequencing device for determining the genotype of rs1424442 based on the obtained sequencing result; An analysis device connected to the comparison device for determining the susceptibility risk of acute mountain sickness based on the determined type of rs1424442.
[0078] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. Use of a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs1424442 in the human genome region 7q33 in the preparation of a product for screening or assisting in screening of individuals susceptible to or non-susceptible to acute mountain sickness.
2. Use of a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs1424442 in the human genome region 7q33 in the preparation of a product for detecting or assisting in detecting susceptibility to acute mountain sickness.
3. Use of a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs1424442 in the human genome region 7q33 in the preparation of a product for detecting or assisting in detecting the risk of acute mountain sickness.
4. Use of a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs1424442 in the human genome region 7q33 in the preparation of a product for evaluating or assisting in the evaluation of the risk of acute mountain sickness.
5. Use of a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs1424442 in the human genome region 7q33 in the preparation of a product for screening and assisting screening of an acute mountain sickness susceptible genotype or an acute mountain sickness non-susceptible genotype.
6. The use according to any one of claims 1 to 5, characterized in that: The C allele of the single nucleotide polymorphism site rs1424442 is a susceptible allele for acute mountain sickness, and the CC genotype of the single nucleotide polymorphism site rs1424442 is a susceptible genotype for acute mountain sickness.
7. The use according to any one of claims 1 to 5, characterized in that: The material for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs1424442 in the human genome region 7q33 contains PCR primers and / or single base extension primers for amplifying a human genome DNA fragment including the single nucleotide polymorphism site rs1424442.
8. Use of substances for detecting polymorphisms or genotypes of other single nucleotide polymorphism sites in the human genome region 7q33 that are in a strong linkage disequilibrium with the single nucleotide polymorphism site rs1424442 in the preparation of products for screening or assisting in screening individuals susceptible to acute mountain sickness or non-susceptible individuals, or for detecting or assisting in detecting susceptibility to acute mountain sickness, or for detecting or assisting in detecting the risk of acute mountain sickness, or for assisting in evaluating the risk of acute mountain sickness, or for screening and assisting in screening products for acute mountain sickness susceptible genotypes or acute mountain sickness non-susceptible genotypes.
9. A kit for screening susceptibility to acute mountain sickness, characterized in that: A reagent containing a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs1424442 in the human genome region 7q33.
10. The kit according to claim 10, characterized in that: The reagents include primers and / or probes; wherein, The nucleotide sequence of the primer is: AGGCCATTGTTCCATTTCCA, and CCCAGGAAGTCATAATACCC; The nucleotide sequence of the probe is: TGGTTGCAGTGAGCTCTGATCACGCCACT, and / or TGGTTGCAGTGAGCTCTGATCACGCCACT.