Application of HPCAL1 as molecular marker in preparation of products for early diagnosis or prognosis evaluation of acute myelogenous leukemia

By introducing HPCAL1 as a molecular marker of AML, the problem of insufficient sensitivity and specificity of existing AML diagnostic methods in early diagnosis is solved, and a higher diagnostic rate and prognostic evaluation ability is achieved, which is suitable for promotion and application in grassroots hospitals.

CN120138145AActive Publication Date: 2025-06-13PEOPLES HOSPITAL OF HENAN PROV +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510164003.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-14
Publication Date
2025-06-13
Estimated Expiration
2045-02-14

AI Technical Summary

Technical Problem

The existing diagnostic methods for acute myeloid leukemia (AML) are insufficient in early diagnosis, and the detection methods are complex, which affects the timing of treatment.

Method used

High calcium binding protein 1 (HPCAL1) was introduced as a new molecular marker, and its significant high expression in AML was verified by differential analysis and quantitative real-time PCR, and a short hairpin RNA (shRNA) expression vector of HPCAL1 was constructed for knockdown experiments to explore its function in THP1 cells.

Benefits of technology

It significantly improves the early diagnosis rate and prognostic evaluation ability of AML, can effectively distinguish high-risk and low-risk patients, and the detection method is relatively simple, which is suitable for promotion and application in grassroots hospitals.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120138145A_ABST
    Figure CN120138145A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of early diagnosis and treatment of diseases, and particularly relates to application of HPCAL1 as a molecular marker in preparation of products for early diagnosis or prognosis evaluation of acute myelogenous leukemia. The invention provides application of high-calcium binding protein 1 as a molecular marker in preparation of products for early diagnosis or prognosis evaluation of acute myelogenous leukemia. The invention also provides application of the high-calcium binding protein 1 gene in preparation of drugs for treating acute myelogenous leukemia. The HPCAL1 is introduced as the molecular marker of the acute myelogenous leukemia, so that the early diagnosis rate and prognosis evaluation capability of the acute myelogenous leukemia are remarkably improved. In addition, the detection method of the HPCAL1 is relatively simple and suitable for popularization and application in primary hospitals, and the clinical cost is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of early diagnosis and treatment of diseases, and particularly relates to the application of HPCAL1 as a molecular marker in the preparation of products for early diagnosis or prognosis evaluation of acute myeloid leukemia. Background Art

[0002] Acute myeloid leukemia (AML) is a serious hematological malignancy with an increasing incidence year by year and poor prognosis. Existing AML diagnostic methods mainly rely on bone marrow cell morphology examination, immunophenotype analysis, and molecular biology detection, etc. However, these methods often have certain limitations in early diagnosis, especially in the early stage of the disease, and it is often difficult to accurately identify. Therefore, finding new biomarkers to improve the early diagnosis rate of AML has become a research hotspot.

[0003] Currently, a variety of biomarkers have been proposed for the diagnosis and prognosis evaluation of AML, such as FLT3, NPM1 mutations, etc. However, the specificity and sensitivity of these markers still need to be improved.

[0004] Although a variety of molecular markers have been applied to the research of AML, the following main problems still exist:

[0005] (1) The sensitivity and specificity of existing markers are insufficient, resulting in a low early diagnosis rate and affecting the treatment opportunity of patients.

[0006] (2) Existing detection methods are complex, with cumbersome operations and limited clinical applications.

[0007] (3) The biological characteristics of AML are complex, with large differences in marker expression among patients, and there is a lack of unified diagnostic criteria. Summary of the Invention

[0008] In order to solve the problem of insufficient accuracy and sensitivity in the early diagnosis of acute myeloid leukemia (AML), the present invention introduces HPCAL1 as a new molecular marker, aiming to improve the early diagnosis rate and prognosis evaluation ability of AML, overcome the limitations of the existing technology, and provide an effective guiding index for clinical treatment.

[0009] For this purpose, the present invention adopts the following technical solutions:

[0010] First, by performing differential analysis on the GSE34184 dataset and the GSE24395 dataset in the GEO database respectively, it is found that high calcium-binding protein 1 (HPCAL1) is significantly highly expressed in the acute myeloid leukemia group.

[0011] Secondly, bone marrow samples from newly diagnosed AML patients were collected and compared with samples from healthy controls. The expression of HPCAL1 was verified by extracting RNA and performing quantitative real-time PCR (qRT-PCR) analysis. The results showed that HPCAL1 was significantly highly expressed in the acute myeloid leukemia group.

[0012] Therefore, HPCAL1 can be used as a molecular marker for the preparation of early diagnosis products for acute myeloid leukemia. Among them, the cDNA sequence obtained by reverse transcription of the mRNA of HPCAL1 is shown in SEQ ID NO:1, and the amino acid sequence of the HPCAL1 protein is shown in SEQ ID NO:2.

[0013] Next, using cell culture techniques, a short hairpin RNA (shRNA) expression vector of HPCAL1 was constructed, and transfection experiments were carried out to explore the function of HPCAL1 in THP1 cells. Subsequently, Western blotting technology was used to detect the protein expression level of HPCAL1, and the effect of HPCAL1 on THP1 cells was evaluated through cell viability and proliferation experiments. The results showed that knockdown of the HPCAL1 gene significantly inhibited the proliferation ability of THP1 cells.

[0014] Therefore, the reagent for knocking down the HPCAL1 gene can be used as an active ingredient for the preparation of drugs for the treatment of acute myeloid leukemia.

[0015] In addition, transcriptome data were downloaded and processed, and methods such as survival analysis, ESTIMATE analysis, differential expression analysis, and gene function and pathway enrichment analysis were used to deeply explore the role of HPCAL1 in AML and its correlation with patient prognosis. The results showed that patients with high expression of HPCAL1 had significantly worse prognoses.

[0016] Therefore, HPCAL1 can be used as a molecular marker for the preparation of acute myeloid leukemia prognosis assessment products.

[0017] Based on the above, the first aspect of the present invention provides: the application of high calcium-binding protein 1 as a molecular marker in the preparation of early diagnosis or prognosis assessment products for acute myeloid leukemia.

[0018] In the second aspect, there is provided the application of a reagent for knocking down the high calcium-binding protein 1 gene as an active ingredient in the preparation of drugs for the treatment of acute myeloid leukemia, specifically by knocking down the high calcium-binding protein 1 gene to inhibit the proliferation of acute myeloid leukemia cells.

[0019] In a third aspect, a product for early diagnosis or prognosis assessment of acute myeloid leukemia is provided, and the product includes a reagent for detecting high calcium-binding protein 1 or a reagent for detecting the high calcium-binding protein 1 gene. The reagent for detecting the high calcium-binding protein 1 gene is a primer specific for amplifying the high calcium-binding protein 1 gene, and the nucleotide sequence of the primer is as follows:

[0020] Forward primer: 5’-CCTTCAGCATGTACGACCTGGA-3’;

[0021] Reverse primer: 5’-GATCTTGTCTGTGCGCTTCTCC-3’.

[0022] In a fourth aspect, a drug for treating acute myeloid leukemia is provided, and its active ingredient is a reagent for knocking down the high calcium-binding protein 1 gene. The reagent is an shRNA sequence targeting HPCAL1, and the shRNA sequence is: 5’-GAACACGGAGTTCACCGACCA-3’ or 5’-GCCGCTTGCACGTATAGATAC-3’.

[0023] The beneficial effects of the present invention are as follows:

[0024] By introducing HPCAL1 as a molecular marker for acute myeloid leukemia, the present invention significantly improves the early diagnosis rate and prognosis assessment ability of AML. The research results show that HPCAL1 is significantly highly expressed in AML patients, and its expression level has a significant correlation with the survival period of patients, and can effectively distinguish high-risk and low-risk patients. In addition, the detection method of HPCAL1 is relatively simple, suitable for popularization and application in primary hospitals, and reduces the clinical cost. Description of the Drawings

[0025] Figure 1 : Expression, diagnostic value and prognostic significance of HPCAL1 in acute myeloid leukemia (AML).

[0026] A: Comparison of HPCAL1 mRNA expression between AML and normal tissues: Analysis of the GSE34184 dataset from Gene Expression Omnibus (GEO) shows that the HPCAL1 mRNA level in AML tissues is significantly higher than that in normal tissues (*, P<0.05).

[0027] B: Comparison of HPCAL1 expression between leukemia stem cells (LSCs) and hematopoietic stem cells (HSCs): Data from the GSE24395 dataset show that the HPCAL1 mRNA expression in LSCs is higher than that in HSCs (*, P<0.05).

[0028] C: Laboratory RT-qPCR analysis: RT-qPCR results of bone marrow samples from 24 AML patients and 24 healthy controls showed higher HPCAL1 mRNA expression in AML samples (***, P<0.001).

[0029] D: ROC analysis of laboratory data: ROC curve analysis indicated that HPCAL1 mRNA expression could effectively distinguish cancerous and normal tissues, with an area under the curve (AUC) of 0.884 (95% CI: 0.782 - 0.985).

[0030] E: ROC analysis of TCGA_GTEx-LAML data: ROC curve analysis using the TCGA_GTEx-LAML dataset showed an AUC of 0.989 (95% CI: 0.979 - 0.999), further validating the diagnostic potential of HPCAL1.

[0031] F: Prognostic significance of HPCAL1 in AML: Kaplan-Meier survival analysis of the TCGA AML dataset showed that higher HPCAL1 mRNA expression was associated with poorer patient prognosis (P = 0.0075).

[0032] Figure 2 : HPCAL1 promotes the proliferation of THP1 cells.

[0033] A: qRT-PCR analysis showed changes in HPCAL1 protein levels in THP1 cells after infection with lentiviruses packaged with independent shRNAs targeting HPCAL1 (shHPCAL1#1 and #2) or control shRNA (shNC). GAPDH was used as a loading control.

[0034] B: Western blotting analysis showed changes in HPCAL1 protein levels in THP1 cells after infection with lentiviruses packaged with independent shRNAs targeting HPCAL1 (shHPCAL1#1 and #2) or control shRNA (shNC). GAPDH was used as a loading control.

[0035] C: CCK-8 assay results showed the effect of HPCAL1 knockdown on the growth of THP1 cells. Cell viability was measured at 1, 2, 3, 4, and 5 days after infection. Data are the mean ± standard deviation of three independent experiments (**, P<0.01).

[0036] D: The EdU experiment demonstrated the effect of HPCAL1 knockdown on DNA synthesis and proliferation in THP1 cells. Cells were fixed and stained after incubation with EdU for 2 hours. The percentage of Edu-positive cells was quantified and shown as the mean ± standard deviation of three independent experiments (**, P<0.01; ***, P<0.001). Detailed implementation manners

[0037] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly described below with reference to the accompanying drawings in the embodiments of the present invention. Apparently, the described embodiments are some but not all of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0038] Example 1

[0039] First, by performing differential analysis on the GSE34184 dataset and the GSE24395 dataset in the GEO database (https: / / www.ncbi.nlm.nih.gov / geo / ) respectively, it was found that HPCAL1 was significantly highly expressed in the acute myeloid leukemia group ( Figure 1 A), and the expression level of HPCAL1 in leukemia stem cells was significantly higher than that in normal hematopoietic stem cells ( Figure 1 B).

[0040] Subsequently, we analyzed clinical acute myeloid leukemia (AML) samples as follows:

[0041] 1. Preparation of patient samples

[0042] The specific steps for sample collection and processing of patients with acute myeloid leukemia (AML) are as follows:

[0043] (1) Sample collection: Bone marrow samples of newly diagnosed AML patients were collected from the Henan Provincial People's Hospital, and all samples were diagnosed according to the World Health Organization (WHO) classification system. At the same time, normal bone marrow samples of healthy controls were collected, and these controls had no history of hematological diseases or other major diseases.

[0044] (2) Lymphocyte separation: Lymphocytes were separated by density gradient centrifugation using Ficoll Hypaque solution.

[0045] This step ensures the acquisition of a highly pure lymphocyte sample for subsequent analysis.

[0046] Ethical compliance: All experiments involving human samples were conducted in accordance with the ethical standards established by Henan Provincial People's Hospital and the National Research Council and approved by the Medical Ethics Committee of Henan Provincial People's Hospital (approval number: 2018-51).

[0047] 2. RNA extraction and qRT-PCR analysis

[0048] After separating lymphocytes, RNA extraction and quantitative real-time PCR (qRT-PCR) analysis were performed to verify the expression of HPCAL1:

[0049] RNA extraction: Total RNA was extracted using Trizol reagent (Servicebio, Wuhan, China) according to the manufacturer's instructions. After extraction, the RNA concentration was quantified using a Nanodrop instrument (Thermo Fisher Scientific, Waltham, MA, USA).

[0050] cDNA synthesis: Complementary DNA (cDNA) templates were synthesized using a cDNA synthesis mixture (Kermey, Zhengzhou, China). Specifically, the reaction solution required for reverse transcription was prepared in an RNase-Free centrifuge tube according to the formula in Table 1. After brief centrifugation, it was placed in a PCR instrument for reverse transcription. Reverse transcription reaction program: 37°C for 2 min (random primers paired with RNA templates and genomic DNA removal), 55°C for 15 min (reverse transcription reaction and rapid inactivation of dsDNase), 85°C for 5 min (reverse transcriptase inactivation).

[0051] Table 1. Reverse transcription reaction system

[0052] Reagent Dosage Total RNA 1μg 5×Reaction Mix 2μL KREnzyme Mix 1.5μL Nuclease-Free Water Make up to 10μL

[0053] qRT-PCR reaction: The qRT-PCR reaction was carried out in a StepOne TM Real-Time PCR system (Thermo Fisher Scientific, Waltham, MA, USA) using a universal SYBR Green supermix (Kermey, Zhengzhou, China). β-actin was used as an internal reference gene, and the relative expression levels of HPCAL1 in acute myeloid leukemia patients and healthy controls were detected by Real-Time PCR reaction to determine the expression differences between the two.

[0054] The nucleotide sequences of the specific amplification primers for HPCAL1 are as follows:

[0055] Forward primer: 5’-CCTTCAGCATGTACGACCTGGA-3’ (SEQ ID NO:3);

[0056] Downstream primer: 5'-GATCTTGTCTGTGCGCTTCTCC-3' (SEQ ID NO: 4).

[0057] The nucleotide sequences of the specific amplification primers for β-actin are as follows:

[0058] Upstream primer: 5'-GACAGGATGCAGAAGGAGATTACT-3';

[0059] Downstream primer: 5'-TGATCCACATCTGCTGGAAGGT-3'.

[0060] The specific amplification primers for HPCAL1 and β-actin were designed and synthesized by General Biosystems (Anhui) Co., Ltd.

[0061] Prepare the Real-time PCR reaction system (10 μL system) according to the ratio in Table 2.

[0062] Table 2. Real-time PCR reaction system

[0063] Reagent Dosage 2×SYBR Green qPCR Premix(Universal) 5μL 10μM Forward Primer 0.2μL 10μM Reverse Primer 0.2μL cDNA Template 1μL Nuclease-Free Water Make up to 10μL

[0064] Perform Real-Time PCR by the two-step method and generate a melting curve. The program settings are shown in Table 3.

[0065] Table 3. Two-step Real-Time PCR reaction program

[0066]

[0067] By collecting bone marrow samples from 24 patients with acute myeloid leukemia and 24 normal controls, and detecting the expression level of HPCAL1 by fluorescence quantification, we found that HPCAL1 was significantly highly expressed in the acute myeloid leukemia group ( Figure 1 C).

[0068] 3. Cell culture and transfection

[0069] This example also carried out cell culture and the construction and transfection of a short hairpin RNA (shRNA) expression vector for HPCAL1.

[0070] THP1 cells are a human acute monocytic leukemia cell line, which is a type of AML cell line and is widely used in immunology and inflammation research. We selected THP1 cells to study the effect of HPCAL1 knockdown on the viability of leukemia cells.

[0071] In the examples, the human monocytic leukemia cell line (THP1) and the human renal epithelial cell line (293T) were provided by Feng Hui Biotechnology Co., Ltd. (Hunan, China). THP1 cells were cultured in RPMI 1640 medium (Biological Industries, Beit Haemek, Israel), while HEK-293T cells were cultured in DMEM medium (Biological Industries, Beit Haemek, Israel), both supplemented with 10% fetal bovine serum (FBS).

[0072] The culture method of THP1 cells is as follows:

[0073] (1) THP1 cells were cultured in RPMI 1640 medium (containing L-glutamine), supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin mixture. They were placed in a 37°C, 5% CO 2 incubator for static culture.

[0074] (2) Daily maintenance: Replace the fresh complete medium every 2 - 3 days to ensure that the cells are in good growth condition.

[0075] (3) Subculture: When the cell density reached approximately 1×10 6 cells / mL, subculture operation was required. Discard the supernatant, add fresh complete medium, and seed the cells into new culture flasks at a ratio of 1:2 or 1:3. Place them back in a 37°C, 5% CO 2 incubator for culture.

[0076] 293T cells are a commonly used tool cell, widely used in gene transfection, virus packaging, and other molecular biology experiments. We selected 293T cells as the tool cell for lentivirus packaging. The culture method of 293T cells is as follows:

[0077] (1) 293T cells were cultured in DMEM (Dulbecco's Modified Eagle Medium) medium, supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin mixture. They were placed in a 37°C, 5% CO 2 incubator for static culture.

[0078] (2) Daily maintenance: Replace the fresh complete medium every 2 - 3 days to ensure that the cells are in good growth condition.

[0079] (3) Passage: When the cell confluence reaches about 80%-90%, passage operation is required. Gently rinse the cell surface with PBS to remove the residual culture medium. Add an appropriate amount of pre-warmed trypsin-EDTA digestion solution, place it in a 37°C incubator for 1-2 minutes until the cells become round and start to detach. Add an equal volume of fresh complete culture medium to terminate the digestion, and gently pipette to make the cells evenly suspended. Transfer the cell suspension to a centrifuge tube and centrifuge at 1200 rpm for 5 minutes. Discard the supernatant, add fresh complete culture medium, and seed the cells into new culture flasks at a ratio of 1:3 or 1:4. Place it back in a 37°C, 5% CO 2 incubator for culture.

[0080] Construction of HPCAL1 knockdown THP1 cell line:

[0081] (1) shRNA design: The shRNA sequences (shHPCAL1#1, shHPCAL1#2) targeting HPCAL1 and the negative control shRNA (shNC) were synthesized by General (Anhui) Biotechnology Co., Ltd. The sequences are shown in the following table:

[0082] Name Sequence(5’-3’) shHPCAL1#1 GAACACGGAGTTCACCGACCA(SEQ ID NO:5) shHPCAL1#2 GCCGCTTGCACGTATAGATAC(SEQ ID NO:6) shNC CAACAAGATGAAGAGCACCAA

[0083] (2) shRNA vector construction:

[0084] ① Double digestion of the vector: Take 1 μg of pLKO.1 vector (General Biotech Co., Ltd., Anhui), add 1 μL of each of the restriction enzymes AgeI and EcoRI, incubate at 37°C for 6 h, and heat inactivate at 80°C for 20 min. Add the digested pLKO.1 vector to 1% agarose gel, electrophorese at 80 V for 30 min, and then cut the gel to recover the cut vector.

[0085] ② Annealing of oligonucleotide fragments: Mix the corresponding sense and antisense strands of each pair of shRNAs according to the system in Table 4, and set the annealing program in a PCR instrument: 37°C for 30 min, 95°C for 5 min, 90°C for 1 min, 85°C for 1 min, and decrease by 5°C every 1 min until 25°C for annealing recombination.

[0086] Table 4. Reaction system for annealing oligonucleotide fragments

[0087] Sense Oligonucleotide Strand(F,100μM) 1μL Antisense Oligonucleotide Strand(R,100μM) 1μL <![CDATA[ddH 2 O]]> 8μL Total 10μL

[0088] ③ Ligation: Dilute the annealed shRNA more than 200 times with ddH 2 O. Prepare the ligation reaction solution according to Table 5 and ligate at room temperature for 4 h.

[0089] Table 5. Ligation reaction system

[0090] EcoRI&AgeI digested pLKO.1 1μL(300ng / μL) oligo duplex 2μL T4 DNA ligase 0.5μL 10×T4 DNA ligase buffer 1μL <![CDATA[ddH 2 O]]> 5.5μL Total 10μL

[0091] ⑥ Transformation: Add the ligated shRNA to competent cells, incubate on ice for 30 min, heat shock at 42 °C for 50 s, add 500 μL of LB medium, culture on a shaker at 37 °C for 1 h, spread on an LB culture plate with ampicillin resistance, and culture overnight in an incubator at 37 °C.

[0092] ⑦ Pick monoclonal colonies: Pick monoclonal colonies into 500 μL of LB liquid medium with ampicillin resistance and culture on a shaker at 37 °C for 5 h.

[0093] ⑧ Sequencing verification: Take a part of the bacterial liquid and send it to Qingke Biotechnology for sequencing. Compare the sequencing results to find the correct clone.

[0094] ⑨ Use a plasmid extraction kit to extract the vector of the correct clone, which is shRNA-pLKO.1. It can be used for subsequent lentivirus packaging.

[0095] (3) Lentivirus packaging

[0096] ① Seed 293T cells into a 6-well plate, with 0.5×10 6 cells per well, and culture overnight so that the cell density can reach about 70 - 80% the next day.

[0097] ② Before transfection, replace the medium in each well of the 6-well plate with the cells with 2 mL of fresh culture medium.

[0098] ③ Prepare the lentivirus packaging systems for shNC, shHPCAL1#1, and shHPCAL1#2 according to Table 6. For each well of cells in the 6-well plate to be transfected, prepare Solution A: 100 μL Medium, 1 μg of shRNA-pLKO.1, 1 μg of packaging plasmid psPAX2; 0.5 μg of packaging plasmid VSVG2. Prepare Solution B: 100 μL Medium, 5 μL of Lipo2000 TM transfection reagent. After leaving Solution A and Solution B at room temperature for 5 min, add Solution A and Solution B and mix them. Leave at room temperature for 20 min and then evenly add them to the corresponding wells.

[0099] ④ After culturing in an incubator at 37 °C and 5% CO 2 for 24 h, collect the culture supernatant, denoted as virus P1. Add fresh medium and continue culturing for 24 h, then collect the culture supernatant, denoted as virus P2.

[0100] (4) Concentrate the virus: Concentrate the virus solution by ultracentrifugation or polyethylene glycol precipitation to improve the infection efficiency.

[0101] (5) Infect THP1 cells with lentivirus

[0102] ① Cell preparation: Ensure that the suspended cells are in good growth condition, free from contamination and have good viability. Determine the cell density using a cell counting chamber or an automatic cell counter and adjust it to a density suitable for infection (usually 0.5 - 1×10 6 cells / mL).

[0103] ② Mixing virus and cells: Calculate the required virus volume according to the desired MOI (multiplicity of infection index) and add it to the cell suspension. Add Polybrene (final concentration 4 - 8 μg / mL) to increase the adsorption ability of lentivirus to the cell membrane. Gently pipette to mix the cells and the virus solution, avoiding violent operation to prevent cell damage.

[0104] ③ Centrifugation to enhance infection: Centrifuge the cell suspension containing the virus at low speed (such as 1000 - 1200 rpm) for 1 - 2 hours, and then continue to incubate overnight.

[0105] ④ Incubation: Place the centrifuged cell plate in an incubator at 37°C and 5% CO 2 for overnight incubation (16 - 24 hours).

[0106] ⑤ Changing the culture medium: After the infection is completed, gently aspirate and discard the old culture medium containing the virus, add an appropriate amount of fresh complete culture medium, and continue to culture the cells.

[0107] ⑥ Antibiotic screening: Start adding 2 μg / mL of puromycin 48 - 72 hours after infection to gradually eliminate the uninfected cells.

[0108] (6) Detection of knockdown efficiency

[0109] ① Extract cell RNA and perform fluorescence quantitative PCR to quantify the mRNA expression level of HPCAL1. The specific steps are the same as above and will not be elaborated here.

[0110] ② Extract total cell protein and perform Western Blot to detect the change in the protein expression level of HPCAL1. The specific steps are the same as above and will not be elaborated here.

[0111] Using the lentivirus system, we successfully constructed THP1 cells with HPCAL1 knockdown, and used qPCR and WB to detect the expression level of HPCAL1 at the mRNA level ( Figure 2 A) and protein level ( Figure 2 B) respectively. The expression level of HPCAL1 in the HPCAL1 knockdown group decreased significantly.

[0112] 4. Cell viability and proliferation assays

[0113] To evaluate the effect of HPCAL1 on THP1 cells, cell viability and proliferation assays were performed. These include:

[0114] Cell viability assessment by CCK-8 method: The cell counting kit-8 (CCK-8, Targetmol, Boston, USA) was used to evaluate cell viability. THP1 cells with HPCAL1 knockdown were seeded in 96-well plates at a density of 2000 cells / well, 10 μL of CCK-8 reagent was added, and the absorbance was measured at a wavelength of 450 nm after 2 hours of incubation.

[0115] Edu assay for cell proliferation: Click TM EdU-647 Cell Proliferation Detection Kit (Beyotime Biotechnology, ShangHai, China) was used for the Edu experiment. THP1 cells with HPCAL1 knockdown were seeded on poly-L-lysine-coated slides at a density of 3×10 5 cells / well, allowed to adhere for 2 hours, then 10 μM of Edu was added and incubated at 37 °C for 2 hours. Subsequently, the cells were fixed with 4% paraformaldehyde, permeabilized with 0.5% Triton X-100 for 10 minutes, washed with PBS, incubated with Click-iT reaction mixture for 30 minutes, and finally stained with Hoechst 33342 (1 μg / mL) for nuclear staining, and the cells were analyzed using a fluorescence microscope.

[0116] By detecting the effect of HPCAL1 on the proliferation ability of THP1 cells through CCK8 ( Figure 2 C) and Edu ( Figure 2 D), we found that knockdown of HPCAL1 significantly inhibited the proliferation ability of THP1 cells.

[0117] 5.ROC curve construction

[0118] To further evaluate the performance of HPCAL1 gene expression as a diagnostic marker for AML, the receiver operating characteristic (ROC) curve can be plotted for analysis. We performed diagnostic value analysis based on the qPCR data of HPCAL1 from the collected clinical samples and the TCGA-GTEx-LAML data respectively.

[0119] (1) Data preparation: Prepare the qPCR data of the collected clinical samples; download the RNAseq data in TPM format of TCGA and GTEx processed by the Toil pipeline (Vivian J et al., 2017) on the UCSC XENA platform (https: / / xenabrowser.net / datapages / ), and extract the acute myeloid leukemia data (70 cases) of TCGA and the corresponding normal tissue data (173 cases) in GTEx.

[0120] (2) Plot the ROC curve: Use the pROC [1.18.0] package to perform ROC analysis on the data, and visualize the results using ggplot2 [3.4.4].

[0121] Diagnostic value analysis: By analyzing the expression levels of HPCAL1 in the samples we collected, we found that HPCAL1 has good diagnostic value for acute myeloid leukemia, with AUC = 0.884 ( Figure 1 D). Through ROC analysis of the acute myeloid leukemia data (70 cases) from TCGA and the corresponding normal tissue data (173 cases) from GTEx, it was also proven that HPCAL1 has good diagnostic value for acute myeloid leukemia, with AUC = 0.989 ( Figure 1 E).

[0122] 6. Survival analysis and differential expression analysis

[0123] Perform survival analysis and differential expression analysis to evaluate the correlation between HPCAL1 gene expression and the prognosis of AML patients.

[0124] The specific steps are as follows:

[0125] Download and process TCGA data: Download and organize the RNAseq data of the STAR pipeline of the TCGA-LAML (acute myeloid leukemia) project from the TCGA database (https: / / portal.gdc.cancer.gov), and extract the data in TPM format and the clinical data.

[0126] Survival analysis preparation: Use R language (version 4.2.2), and load the survival package (version 3.5 - 5) and the survminer package (version 0.4.9). Ensure that all necessary datasets are ready, including the expression levels of the HPCAL1 gene and the survival data of TCGA AML patients.

[0127] Grouping: Use the functions in the survminer package to calculate the optimal cut-off value based on the expression levels of the HPCAL1 gene and the survival data of TCGA AML patients. According to the calculated optimal cut-off value, divide the patients into a high-expression group and a low-expression group.

[0128] Kaplan-Meier survival analysis: Perform Kaplan-Meier survival analysis on the high-expression group and the low-expression group respectively. Use the survminer package to generate Kaplan-Meier survival curves, and add necessary statistical information (such as p-value, hazard ratio, etc.) to evaluate the clinical significance of HPCAL1 gene expression in AML.

[0129] Prognostic value analysis: By performing Kaplan-Meier survival analysis on the acute myeloid leukemia data of the HPCAL1 high-expression group and the low-expression group, we found that patients with high HPCAL1 expression had significantly poorer prognoses ( Figure 1 F).

[0130] Generally speaking, by introducing HPCAL1 as a molecular marker for acute myeloid leukemia, the present invention significantly improves the early diagnosis rate and prognostic assessment ability of AML. HPCAL1 is significantly highly expressed in AML patients, and its expression level has a significant correlation with the survival period of patients, and can effectively distinguish high-risk and low-risk patients. In addition, the detection method of HPCAL1 is relatively simple and suitable for popularization and application in primary hospitals.

[0131] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. Application of high calcium binding protein 1 as a molecular marker in the preparation of products for early diagnosis or prognosis assessment of acute myeloid leukemia.

2. The use according to claim 1, characterized in that: The product includes a high calcium binding protein 1 detection reagent or a high calcium binding protein 1 gene detection reagent.

3. The use according to claim 2, characterized in that: The high calcium binding protein 1 gene detection reagent is a high calcium binding protein 1 gene specific amplification primer, and the nucleotide sequence of the primer is as follows: Upstream primer: 5′-CCTTCAGCATGTACGACCTGGA-3′; Downstream primer: 5′-GATCTTGTCTGTGCGCTTCTCC-3′.

4. The use of reagents for knocking down the high calcium binding protein 1 gene as active ingredients in the preparation of drugs for the treatment of acute myeloid leukemia.

5. The use according to claim 4, characterized in that: The reagent is a shRNA sequence targeting HPCAL1, and the shRNA sequence is: 5'-GAACACGGAGTTCACCGACCA-3' or 5'-GCCGCTTGCACGTATAGATAC-3'.

6. A product for early diagnosis or prognosis assessment of acute myeloid leukemia, characterized in that: Including high calcium binding protein 1 or high calcium binding protein 1 gene detection reagent.

7. The product according to claim 6, characterized in that The high calcium binding protein 1 gene detection reagent is a high calcium binding protein 1 gene specific amplification primer, and the nucleotide sequence of the primer is as follows: Upstream primer: 5′-CCTTCAGCATGTACGACCTGGA-3′; Downstream primer: 5′-GATCTTGTCTGTGCGCTTCTCC-3′.

8. A drug for treating acute myeloid leukemia, characterized in that: Its active ingredient is an agent for knocking down the high calcium binding protein 1 gene.

9. The drug according to claim 8, characterized in that The reagent is a shRNA sequence targeting HPCAL1, and the shRNA sequence is: 5'-GAACACGGAGTTCACCGACCA-3' or 5'-GCCGCTTGCACGTATAGATAC-3'.

Citation Information

Patent Citations

  • Application of HPCAL1 in diagnosis and treatment of colon cancer

    CN118581224A

  • Pancreatic cancer diagnosis assistance method, biomarker for detecting pancreatic cancer, colorectal cancer diagnosis assistance method, and biomarker for detecting colorectal cancer

    EP4484957A1

  • Use of murine genomic regions identified to be involved in tumor developement for the development of anti-cancer drugs and diagnosis of cancer

    US20060122132A1

  • Methods and compositions for identifying minimal residual disease in acute lymphoblastic leukemia

    US20140148354A1