SNP molecular marker related to pig semen quality trait gene gnas, primer pair and application thereof

Abstract

The application discloses a SNP molecular marker related to a semen quality trait gene GNAS, a primer pair and application thereof, and relates to the technical field of pig molecular markers. The pig semen quality trait is semen volume, sperm density, effective sperm density, forward motility, sperm deformity rate and sperm motility; the molecular marker is located in the second intron of the pig GNAS gene, has a nucleotide sequence as shown in the sequence table SEQ ID NO. 1, and a g.277G>A base mutation exists at the 277th position of the sequence. The application further provides a primer pair for amplifying the above-mentioned molecular marker and a method for pig breeding by using the above-mentioned molecular marker. The application first discovers that a SNP molecular marker in the pig GNAS gene is related to the semen volume, sperm density, effective sperm density, forward motility, sperm deformity rate and sperm motility of pigs, and therefore can be used for pig marker-assisted selection breeding, realizes early screening of pig semen quality traits, and the screening method is simple and rapid.

Description

Technical Field

[0001] This invention relates to the field of porcine molecular marker technology, specifically to an SNP molecular marker, primer pair, and their application related to the porcine semen quality trait gene GNAS. Background Technology

[0002] China is the world's largest producer and consumer of pork, and has become a major player in the global pork market. Artificial insemination technology plays a crucial role in the development of modern pig farming, serving as an important technical means to improve pork product quality, promote breed improvement, and facilitate large-scale pig farming. The quality of boar semen directly affects the success rate of artificial insemination and the boar's fertility, making it key to successful implementation of artificial insemination in pigs and directly impacting the economic benefits of pig farms. Semen quality traits are of medium to low heritability, and traditional breeding methods are unlikely to effectively improve boar semen quality. Understanding the genetic structure and detecting candidate genes and molecular markers related to semen quality traits can help improve genetic selection and accelerate the genetic process. Currently, there is still a shortage of key genes whose mechanisms of influence on semen quality traits can be utilized and elucidated. Therefore, identifying key molecular genetic markers controlling boar semen quality traits and using them for marker-assisted breeding is of great significance for improving boar semen quality and increasing economic benefits.

[0003] Guanine nucleotide-binding protein (GNAS), or G protein, is a highly complex imprinted expression locus. G proteins play a transduction role in numerous signaling pathways controlled by G protein-coupled receptors (GPCRs). This gene has been found to encode multiple transcriptomorphs of different isoforms, and alternative splicing of its downstream exons produces different forms of stimulatory G protein α subunits. These are key elements in the classic signal transduction pathway that links adenylate cyclases and various cellular responses through receptor-ligand interactions. This gene may participate in cell proliferation, invasion, and migration by regulating multiple signal transduction pathways.

[0004] Studies have shown that alterations in sperm cell quality due to alcohol and nicotine exposure may be related to methylation levels of MEST and GNAS. Other research indicates that DNA methylation may lead to reduced boar semen quality by altering gene expression at the GNAS locus.

[0005] However, the specific molecular mechanism by which the GNAS gene affects the semen quality of boars has not yet been reported. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a SNP molecular marker, primer pair and its application related to the porcine semen quality trait gene GNAS. This invention discovers an SNP in the second intron of the GNAS gene (ensemble number: ENSSSCT00000033038.4) that is associated with porcine semen quality traits and can be used as a molecular marker for screening porcine semen quality traits and for pig breeding.

[0007] In a first aspect, the present invention provides an SNP molecular marker related to the porcine semen quality trait gene GNAS, wherein the porcine semen quality trait includes semen volume, sperm density, effective sperm density, forward motility, sperm abnormality rate, and sperm motility; the molecular marker is located in intron 2 of the porcine GNAS gene (ensemble number: ENSSSCT00000033038.4), and its nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing, wherein there is a G.162 G>A base mutation at position 162bp of the sequence.

[0008] Furthermore, the A or G base polymorphism site at 162 bp in sequence SEQ ID NO.1 exhibits three genotypes: AA, AG, or GG, with the G allele being the dominant allele.

[0009] Secondly, the present invention provides the application of SNP molecular markers as described in the first aspect in the screening of bovine semen quality traits and / or in bovine breeding.

[0010] Thirdly, the present invention provides a primer pair for amplifying the molecular marker as described in the first aspect, the primer pair comprising: the nucleotide sequence of the upstream primer as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer as shown in SEQ ID NO.3.

[0011] Fourthly, the present invention provides the application of primer pairs as described in the third aspect in the screening of bovine semen quality traits and / or in bovine breeding.

[0012] Fifthly, the present invention provides a kit for rapid breeding of pigs using SNP molecular markers as described in the first aspect, comprising primer pairs as described in the third aspect.

[0013] Sixthly, the present invention provides a method for screening boar semen quality traits and / or breeding boars, comprising the following steps:

[0014] S1. Extract genomic DNA from pigs;

[0015] S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification using the primer pair as described in claim 4 to obtain the molecular marker as described in claim 1 and purify it.

[0016] S3. Sequencing analysis was performed on the molecular markers purified in step S2. Individuals carrying the G allele at position 162 bp of the sequence were retained, while individuals carrying the A allele were discarded.

[0017] Furthermore, in step S1, genomic DNA is extracted from the ear margin tissue of the pig to be tested.

[0018] Furthermore, in step S2, the PCR reaction system is 50 μL, and the components of the system are: 100 ng genomic DNA, 25 μL PCR mix, 1 μL each of the above upstream and downstream primers, and ddH2O added to make up to a total volume of 50 μL; the PCR program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; and storage at 4℃.

[0019] Compared with the prior art, the beneficial effects of the present invention include: The present invention is the first to discover that a SNP molecular marker in the porcine GNAS gene is associated with porcine semen quality traits, specifically semen volume, sperm density, effective sperm density, forward motility, sperm abnormality rate, and sperm motility. Therefore, this molecular marker can be used to screen for porcine semen quality traits and for breeding, that is, it provides a new application of a SNP molecular marker in the porcine GNAS gene in marker-assisted breeding for porcine semen quality traits, realizing early screening of porcine semen quality traits, and the screening method is simple and fast. Attached Figure Description

[0020] Figure 1 This is an agarose gel electrophoresis detection image of the PCR product in Example 1 of the present invention, where lane M is the DL1000 Marker, and lanes 1-5 are the amplified fragments from pigs, with a fragment size of 277 bp.

[0021] Figure 2 This is the sequencing map of the g.162 G > A site in Example 1 of the present invention. Detailed Implementation

[0022] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0023] Example 1: Obtaining SNP fragments from the porcine GNAS gene and establishing a method for detecting polymorphic sites.

[0024] 1. Extraction of porcine genomic DNA

[0025] The experimental pig breed used in this application was Large White, and the samples were obtained from Aonong Group. Pig genomic DNA was extracted using the Invitrogen Animal Tissue Genomic DNA Extraction Kit (PureLink™ Pro 96 GenomicDNA Purification Kit, K182104A), following the kit's instructions. The extracted DNA was tested for concentration and quality, and stored at -20°C for later use.

[0026] 2. Obtaining the SNP genetic marker fragment for the porcine GNAS gene

[0027] (1) PCR amplification

[0028] Based on the SNP genetic marker detection sequence in the genomic sequence of the pig GNAS gene, a pair of primers was designed to amplify fragments of polymorphic sites.

[0029] The nucleotide sequence of this SNP genetic marker detection sequence is as follows:

[0030] GTGGGTCACCTCTTAGGCATCTGAGGGGACAGGCCTGTGCTCCAAGGGGTTGGGGGTGGGGGCGGACGAAGGTACTGGGCCCTCTGGCTCTCCCTGCCGTGGCCGCGACTGGAGCGCGCTGCAGCGGGGCGGTGGGGACG GGGAGCAAGCCGGTCCTTACGGGCAGGTGCAGGGAAGGAGAGGCCTGCAGAGGGGAATCCGCCTGCCTCGGCCCTCCGCAGCGTCCTTGTCAGGCTCGGGACCGGGCAGGTGCCTGCAGCCATCTTAGAAGGGAGA, as SEQ. Shown as ID NO.1.

[0031] The designed primers are as follows:

[0032] Upstream primer: 5' GTGGGTCACCTCTTAGGCA 3', as shown in SEQ ID NO.2.

[0033] Downstream primer: 5' TCTCCCTTCTAAGATGGCTGC 3', as shown in SEQ ID NO.3.

[0034] Genomic DNA was extracted from the ear margin tissue of the pigs to be tested as a template, and PCR amplification was performed using the primers designed above. The PCR reaction system was 50 μL, and the components of the system were: 100 ng genomic DNA, 25 μL PCR mix, 1 μL each of the above-mentioned upstream and downstream primers, and ddH2O was added to make up to a total volume of 50 μL.

[0035] The PCR procedure was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃. PCR products were detected by 1.0% agarose gel electrophoresis, and the results are attached. Figure 1 As shown, lane M is the DL1000 Marker, and lanes 1-4 are the amplified fragments from pigs, with a fragment size of 277bp.

[0036] (2) Purification of PCR products

[0037] The PCR amplification products were purified using the Gel Extraction Kit from Shanghai Sangon Biotech Co., Ltd. Specific steps are detailed in the kit's instruction manual.

[0038] 3. Detection of molecular markers using direct sequencing of PCR products.

[0039] The purified PCR product obtained above was sent directly to Beijing Aoke Technology Co., Ltd. for sequencing. The genotype of this locus in the test population was determined based on the sequencing results. Analysis was performed using DNAStar software, and the results are attached. Figure 2 As shown, a G162–A162 allele mutation was found at 162 bp in the sequence shown in SEQ ID NO.1, i.e. g. 162 G > A. The above mutation causes polymorphism of the GNAS gene.

[0040] Example 2: Detection of Polymorphic Distribution of Molecular Markers in Pigs

[0041] In this embodiment, the polymorphism distribution of the g.162 G>A site of the porcine GNAS gene was detected in 195 pigs with the first-parity litter size trait. The detection results are shown in Table 1.

[0042] Table 1. Distribution pattern of polymorphism at the GNAS gene g.162 G > A site.

[0043]

[0044] As shown in Table 1, the GNAS gene at the g.162 G>A site in pigs exhibits three genotypes: AA, AG, and GG. Among them, the GG genotype is more common, and the frequency of the G allele is 84.6%.

[0045] Example 3: Association Analysis of Molecular Markers and Porcine Semen Quality Traits

[0046] To determine whether the porcine GNAS gene g.162 G>A locus is associated with differences in porcine semen quality traits, polymorphism detection was performed using the method established in Example 1. The correlation between different genotypes of this polymorphic locus and semen volume, sperm density, effective sperm density, forward motility, sperm abnormality rate, and sperm motility traits was analyzed. Analysis of variance for different SNP genotype combinations was performed using the GLM program in SAS statistical software (SAS Institute Inc, Version 9.1), and significance tests were conducted. The model used was as follows:

[0047] Y ij = μ+G i +F j +e ijk ;

[0048] Y ij Here, μ represents the phenotypic value, and G represents the mean value. i Genotypic effects (including additive and dominant effects); F j For the comprehensive effect of pig farms; e ijk This is due to the residual effect.

[0049] Association analysis was conducted on different genotypes and semen quality traits in pigs. The statistical analysis results are shown in Table 2.

[0050] Table 2. Association analysis of the GNAS gene g.162 G>A site with porcine semen quality traits.

[0051]

[0052] Note: The trait means in the table are expressed as mean ± standard deviation. Different values ​​for A and B indicate a significant difference (P < 0.05), * indicates a significant difference (P < 0.05), and ** indicates an extremely significant difference (P < 0.01).

[0053] The relationship between semen quality traits was investigated using the GLM program of SAS software to perform association analysis on the tested population. The results are shown in Table 2. In this population, individuals with the AA genotype at the g.162G>A locus of the GNAS gene had lower semen volume, sperm density, effective sperm density, forward motility, and sperm motility traits, and a higher sperm abnormality rate compared to individuals with the AG and GG genotypes. Furthermore, the differences in effective sperm density, forward motility, and sperm motility were statistically significant (P<0.05); the additive effect of forward motility was extremely significant (P<0.01).

[0054] Example 4: Application of GNAS gene SNP molecular markers in screening for semen quality traits and / or in pig breeding

[0055] The SNP marker g.162G>A on the intron of the GNAS gene is significantly associated with bovine semen quality traits, with significant correlations observed in effective sperm density, forward motility, and sperm motility (P<0.05); the additive effect on forward motility is extremely significant (P<0.01). Therefore, this SNP marker can be used to assist in selecting GG or AG individuals with good semen quality during pig breeding. Individuals carrying this dominant allele should be retained in breeding programs, while AA individuals should be culled, thereby improving the production performance of the herd.

[0056] The specific embodiments of the present invention described above do not constitute a limitation on the scope of protection of the present invention. Any other corresponding changes and modifications made in accordance with the technical concept of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. The application of SNP molecular markers in the screening and / or breeding of boar semen quality traits, characterized in that, The quality trait of the porcine semen is the forward motility of the sperm; the molecular marker is located in intron 2 of the porcine GNAS gene, and its nucleotide sequence is shown in SEQ ID NO.

1. At 162 bp of this sequence, there is an A or G base polymorphism site, which can be expressed as AA, AG or GG genotypes, of which the G allele is the dominant allele. The pig is a Large White pig.

2. The application according to claim 1, characterized in that, The primer pair used to amplify the molecular marker includes: the nucleotide sequence of the upstream primer as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer as shown in SEQ ID NO.

3.

3. A method for screening and / or breeding bovine semen quality traits, characterized in that, The quality trait of the bovine semen is the forward motility of the sperm; it includes the following steps: S1. Extract genomic DNA from pigs; S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification using primer pairs to obtain molecular markers and purify them; S3. Sequencing analysis was performed on the molecular markers purified in step S2. Individuals carrying the G allele at position 162bp of the sequence were retained, while individuals carrying the A allele were discarded. The primer pair includes: the nucleotide sequence of the upstream primer as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer as shown in SEQ ID NO.3; The molecular marker is located in intron 2 of the porcine GNAS gene, and its nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing. There is a G.162G>A base mutation at 162bp of this sequence. The pig in question is a Large White pig.

4. The method for screening and / or breeding bovine semen quality traits according to claim 3, characterized in that, In step S1, genomic DNA is extracted from the ear margin tissue of the pig to be tested.

5. The method for screening and / or breeding bovine semen quality traits according to claim 3, characterized in that, In step S2, the PCR reaction system is 50 μL, and the components of the system are: 100 ng genomic DNA, 25 μL PCR mix, 1 μL each of the above upstream and downstream primers, and ddH2O added to make up to a total volume of 50 μL; the PCR program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; store at 4℃.

Images