Application of compound Incyclinide in preparation of drug for resisting dengue virus

By using the drug prepared at specific concentrations of the compound Incyclinide, the replication of dengue virus is significantly inhibited, and the problem of lack of effective anti-dengue virus drugs in the prior art has been solved, and new antiviral therapeutic effects have been achieved.

CN120154590AActive Publication Date: 2025-06-17ARMY MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510510926.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2025-06-17
Estimated Expiration
2045-04-23

AI Technical Summary

Technical Problem

There is currently no approved anti-dengue virus-marketing drug, and a new drug for anti-dengue virus is needed.

Method used

The compound Incyclinide is used to prepare drugs that inhibit the replication of dengue virus in cells within a specific concentration range (10-50 μM).

Benefits of technology

The compound Incyclinide can significantly inhibit the replication of dengue virus, show excellent antiviral activity, and is expected to become a new anti-dengue virus drug.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120154590A_ABST
    Figure CN120154590A_ABST
Patent Text Reader

Abstract

The invention provides application of a compound Incyclinide in preparation of a drug for resisting dengue virus, and belongs to the technical field of biological medicine. The dengue virus is a dengue virus of which the serotype is DENV-2. According to the present invention, the antiviral activity experiment determines that the compound Incyclinide can significantly inhibit the dengue virus replication under the conditions of the concentrations of 50 [mu] M, 20 [mu] M and 10 [mu] M, such that the compound Incyclinide has the dengue virus replication inhibition effect, and can be used for preparing the anti-dengue virus drug.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to the use of the compound Incyclinide in the preparation of a drug against dengue virus. Background Art

[0002] Dengue virus (DENV) belongs to the family Flaviviridae. Other important pathogens in this virus genus include Zika virus and yellow fever virus. Dengue virus is a single-stranded positive-sense RNA virus and is mainly transmitted to humans by Aedes aegypti and Aedes albopictus. DENV has four antigenically distinct serotypes (DENV-1 to 4). Infection with DENV in humans usually results in asymptomatic cases or a series of self-limiting symptoms, including fever, rash, etc. However, some patients may develop into fatal dengue hemorrhagic fever / dengue shock syndrome (DHF / DSS).

[0003] Dengue virus enters cells through receptor-mediated endocytosis and releases an approximately 11-kb single-stranded RNA genome into the cytoplasm. The viral genomic RNA contains an open reading frame (ORF) that encodes a single polyprotein, flanked by a capped 5' untranslated region (UTR) and a non-polyadenylated 3' UTR, and serves as a template for the translation of viral precursor proteins. Subsequently, the single polyprotein is co-cleaved and post-translationally processed into three structural proteins (C, prM, and E) and seven non-structural proteins (NS proteins: NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5). The structural proteins are used for the assembly of viral particles, while the non-structural proteins are mainly involved in the synthesis of viral RNA genomes and the further translation process of DENV infection.

[0004] Currently, there are no approved anti-dengue virus drugs on the market. Therefore, it is necessary to provide a new drug for anti-dengue virus. Summary of the Invention

[0005] The purpose of the present invention is to provide the use of the compound Incyclinide in the preparation of a drug against dengue virus.

[0006] To achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0007] The present invention provides the use of the compound Incyclinide in the preparation of a drug against dengue virus, and the structural formula of the compound Incyclinide is:

[0008]

[0009] Preferably, the dengue virus is a dengue virus of serotype DENV-2.

[0010] Preferably, the dengue virus of serotype DENV-2 includes the DV2 NGC strain of dengue virus.

[0011] Preferably, the concentration of the compound Incyclinide in the drug is 10-50 μM.

[0012] The present invention provides the use of the compound Incyclinide in the preparation of a reagent for inhibiting the replication of dengue virus in cells. The structural formula of the compound Incyclinide is:

[0013]

[0014] Preferably, the cells include liver cancer cells.

[0015] Preferably, the liver cancer cells include human alveolar basal epithelial cells of lung cancer.

[0016] Preferably, the human alveolar basal epithelial cells of lung cancer include HUH-7 cells.

[0017] Preferably, the dengue virus is a dengue virus of serotype DENV-2.

[0018] Preferably, the dengue virus of serotype DENV-2 includes the DV2 NGC strain of dengue virus.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] Through antiviral activity experiments, the present invention has determined that the compound Incyclinide can significantly inhibit the replication of dengue virus under the conditions of concentrations of 50 μM, 20 μM, and 10 μM, indicating that the compound Incyclinide has the effect of inhibiting the replication of dengue virus and can be used in the preparation of anti-dengue virus drugs. Description of the Drawings

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained according to the provided drawings without creative efforts.

[0022] Figure 1 It is the inhibitory effect of the compound Incyclinide on the replication of dengue virus type 2 in the supernatant of HUH-7 cells in the embodiment;

[0023] Figure 2 The inhibitory effect of the compound Incyclinide in the examples on the replication of dengue virus type 2 in HUH-7 cells. Detailed implementation mode

[0024] The technical solutions provided by the present invention will be described in detail below in conjunction with the examples, but they should not be construed as limiting the protection scope of the present invention.

[0025] The CAS number of the compound Incyclinide used in the following examples is: 15866-90-7; fetal bovine serum, sodium penicillin, streptomycin and DMEM medium are all purchased from Gibco, USA; PrimeScriptTM RT Reagent Kit and TB Premix Ex Taq TM II are purchased from Takara, Japan. The brand of the fluorescence quantitative PCR instrument is LightCycler96 (Roche, USA), and the brand of the carbon dioxide incubator is CCL-170B-8.

[0026] Example

[0027] The evaluation of the anti-dengue virus function of the compound Incyclinide is carried out as follows:

[0028] 1. Cultivation of human hepatoma cells

[0029] The human hepatoma cells HUH-7 cells are inoculated in a 24-well plate for cultivation at a dosage of 2×10 5 cells per well. The medium used is DMEM medium supplemented with 10% fetal bovine serum, 1% sodium penicillin and 1% streptomycin, and is placed in a carbon dioxide incubator for cultivation.

[0030] 2. Cell treatment

[0031] After the HUH-7 cells are cultured for 24 h, they are divided into four groups, namely the DMSO group, the 50 μM group, the 20 μM group and the 10 μM group. The DMSO group is treated with 0.01% DMSO, and the 50 μM group, the 20 μM group and the 10 μM group are treated with 50 μM, 2 μM and 10 μM of the compound Incyclinide respectively, and the treatment time for each group is 24 h.

[0032] 3. Infection of cells with dengue virus

[0033] The HUH-7 cells after the above treatment were infected with dengue virus (DV2 NGC strain) with an MOI of 0.4. After 2 hours of infection, the supernatant was discarded and the cells were collected. The medium was replaced with 2% FBS medium, and the same drugs as the previous day were added to each group. After 24 hours, the cells and cell supernatants were collected respectively and subjected to real-time quantitative PCR (RT-qPCR) detection.

[0034] 4. Detection of relative gene expression by real-time fluorescence quantitative PCR (RT-qPCR)

[0035] The genomic DNA of the above collected cells was extracted using a tissue / cell rapid extraction kit (BOER, China), and the extraction was carried out strictly according to the instructions. Subsequently, reverse transcription was performed using PrimeScript TM RT Reagent Kit. RT-qPCR was performed using TB Premix Ex Taq TM II and 96. The amplification reaction system used for detection is shown in Table 1, and the reaction conditions are as follows: step1: pre-denaturation at 95°C for 30 s; step2: denaturation at 95°C for 5 s, 60°C for 30 s, for 40 cycles; Step 3: melting curve reaction conditions: gradually heating to 95°C. After the PCR reaction, check whether the melting curve and amplification curve are abnormal, export the experimental data, and calculate the expression level of the target gene using the -ΔΔct method.

[0036] Table 1 Amplification reaction system used for RT-qPCR detection

[0037] Name Volume TBGreen Premix Ex Taq II (Tli RNaseH Plus) (2×) 5 μL 10 μM forward primer (CCGTTCACGACCAGCATAGG, SEQ ID NO.1) 0.5 μL 10 μM reverse primer (TCAGTCATGGCTTCAACGTGGT, SEQ ID NO.2) 0.5 μL Template 2 μL <![CDATA[DNase / RNase-free ddH2O]]> up to 10 μL

[0038] 5. Data analysis

[0039] The above obtained statistical data were analyzed using GraphPad Prism v6.0 software. Unpaired two-tailed Student's t-test was used for inter-group statistical analysis; P≤0.05 indicates significant differences between groups.

[0040] The inhibitory effect of the compound Incyclinide on the replication of dengue virus type 2 in the supernatant of HUH-7 cells is as Figure 1 shown, and the inhibitory effect on the replication of dengue virus type 2 in HUH-7 cells is as Figure 2 shown. It can be seen that compared with the DMSO group, the 50 μM group, 20 μM group, and 10 μM group can all significantly inhibit the replication of dengue virus in the supernatant and cells of HUH-7 cells, indicating that the compound Incyclinide has excellent effects on inhibiting the replication of dengue virus and is expected to become a new anti-dengue virus drug.

[0041] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Use of the compound Incyclinide in the preparation of an anti-dengue virus drug, characterized in that: The structural formula of the compound Incyclinide is:

2. The use according to claim 1, characterized in that The dengue virus is a dengue virus with a serotype of DENV-2.

3. The use according to claim 2, characterized in that The dengue virus with serotype DENV-2 includes DV2NGC strain dengue virus.

4. The use according to claim 1, characterized in that The concentration of the compound Incyclinide in the medicine is 10-50 μM.

5. Use of the compound Incyclinide in the preparation of an agent for inhibiting the replication of dengue virus in cells, characterized in that: The structural formula of the compound Incyclinide is:

6. The use according to claim 5, characterized in that The cells include liver cancer cells.

7. The use according to claim 6, characterized in that The liver cancer cells include lung cancer human alveolar basal epithelial cells.

8. The use according to claim 7, characterized in that The lung cancer human alveolar basal epithelial cells include HUH-7 cells.

9. The use according to claim 5, characterized in that The dengue virus is a dengue virus with a serotype of DENV-2.

10. The use according to claim 9, characterized in that The dengue virus with serotype DENV-2 includes DV2NGC strain dengue virus.

Citation Information

Patent Citations

  • Tetracycline derivatives

    CN119731152A

  • Application of biological material overexpressing IFI16 gene in preparation of drug for resisting dengue virus

    CN119824009A