Application of RAB3B in chordoma

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of RAB3B in chordoma. The invention firstly provides an application of an RAB3B inhibitor in preparation of a product; the product is selected from: 1) a product for reducing the phosphorylation level of the S6 protein; (2) a product for regulating and controlling a PI3K-AKT-mTOR signal channel; and 3) a product for preventing and / or treating chordoma. The invention further provides application of the RAB3B and / or the reagent for detecting the RAB3B in preparation of a chordoma prognosis product or a product for predicting treatment response. By inhibiting RAB3B expression, proliferation of tumor cells of chordoma can be inhibited, the tumor volume of chordoma patients can be reduced, and by quantitatively detecting RAB3B expression in chordoma patient samples, the treatment response of the patients to the mTORC1 inhibitor and the prognosis condition of the patients to chordoma can be accurately predicted.

Description

Technical Field

[0001] This application belongs to the field of biotechnology, and specifically relates to the use of RAB3B in chordoma. Background Art

[0002] Chordoma is a rare tumor originating from the residual tissue of the notochord in the embryonic period, with characteristics such as strong local invasiveness, high recurrence rate, and low sensitivity to radiotherapy and chemotherapy. Its treatment has always faced great challenges. Since chordoma often occurs in anatomically complex sites, such as the neck and sacrococcygeal region, surgical resection often fails to achieve an ideal margin effect, leading to a high local recurrence rate. Currently, although molecular targeted therapy has brought some hope for the treatment of chordoma, there are significant differences in the application effects of targeted drugs clinically. There is an urgent need to develop new targeted drugs and biomarkers that can predict the response and prognosis of patients to specific targeted therapies.

[0003] The mTORC1 signaling pathway plays a key role in tumorigenesis and development. The phosphorylation status of a specific site (S235 / 236) of its downstream effector molecule, the S6 protein, is closely related to cell proliferation, protein synthesis, and cell stemness. In recent years, inhibitors of the mTORC1 signaling pathway (Rapamycin or Dactolisib) have shown certain efficacy in the treatment of various malignant tumors, but there are still problems with inconsistent patient responses in the application of chordoma. Traditional clinical diagnostic methods are difficult to accurately predict the sensitivity of patients to mTORC1 targeted therapy, which to a certain extent limits the formulation and promotion of precision treatment plans. Summary of the Invention

[0004] To solve the defects of the prior art, this application's research shows that the expression of RAB3B in the tissues of chordoma patients is significantly up-regulated, and its high expression shows a close correlation with the phosphorylation level of the S6 protein (S235 / 236) in the mTORC1 signaling pathway, thereby regulating the stemness, proliferation, and migration of tumor cells. Based on this discovery, by inhibiting the expression of RAB3B, the proliferation of tumor cells and the size of the tumor volume can be inhibited. By detecting the expression levels of RAB3B and p-S6 (S235 / 236), it is expected to be an important biomarker for predicting the response of chordoma patients to mTORC1 inhibitor therapy, providing personalized precision treatment plans for patients. This application aims to inhibit the expression of RAB3B through RAB3B inhibitors to achieve the treatment of chordoma, and to achieve personalized precision diagnosis by detecting the expression level of RAB3B in the tissues of chordoma patients, providing theoretical support and practical basis for the clinical development of new chordoma treatment and prognosis strategies.

[0005] The first aspect of this application provides the use of RAB3B inhibitors in the preparation of products selected from:

[0006] 1) A product for reducing the phosphorylation level of S6 protein;

[0007] 2) A product for regulating the PI3K - AKT - mTOR signaling pathway;

[0008] 3) A product for preventing and / or treating chordoma.

[0009] The second aspect of the present application provides a RAB3B inhibitor, and the RAB3B inhibitor is selected from small interfering RNA, short hairpin RNA, or a gene editing system; the nucleotide sequence of the small interfering RNA is as shown in SEQ ID NO.1 - 2, or as shown in SEQ ID NO.3 - 4, or as shown in SEQ ID NO.5 - 6; the targeting sequence of the short hairpin RNA is as shown in SEQ ID NO.7, and the gene editing system includes a guide RNA or a nucleic acid fragment encoding the guide RNA, and the targeting sequence of the guide RNA is as shown in SEQ ID NO.8.

[0010] The third aspect of the present application provides a drug, comprising an effective amount of the RAB3B inhibitor in the use of the first aspect above, or the RAB3B inhibitor of the second aspect above.

[0011] The fourth aspect of the present application provides the use of RAB3B and / or a reagent for detecting RAB3B in the preparation of a product for chordoma prognosis or predicting treatment response.

[0012] The fifth aspect of the present application provides a device for chordoma prognosis or predicting treatment response, and the device includes:

[0013] A data module for obtaining RAB3B expression level data of a sample;

[0014] An analysis module for judging the prognosis or treatment response of a chordoma patient based on the RAB3B expression level data of the sample.

[0015] The sixth aspect of the present application provides a computer - readable storage medium, comprising a computer program, characterized in that when the computer program is run by a processor, it executes a method comprising the following steps:

[0016] Obtain RAB3B expression level data of a sample; based on the RAB3B expression level data of the sample, judge the prognosis or treatment response of a chordoma patient.

[0017] The seventh aspect of the present application provides an electronic terminal, including a memory and a processor, the memory includes a computer program, characterized in that when the computer program is run by the processor, it executes a method comprising the following steps:

[0018] Obtain the RAB3B expression level data of the sample; based on the RAB3B expression level data of the sample, judge the prognosis or treatment response of chordoma patients.

[0019] The eighth aspect of the present application provides a computer program product, including a computer program, and the method of implementing the following steps when the computer program is executed by a processor:

[0020] Obtain the RAB3B expression level data of the sample; based on the RAB3B expression level data of the sample, judge the prognosis or treatment response of chordoma patients.

[0021] The ninth aspect of the present application provides a method for chordoma prognosis or predicting treatment response for non-disease diagnosis and treatment purposes, including: obtaining the RAB3B expression level data of the sample; based on the RAB3B expression level data of the sample, judge the prognosis or treatment response of chordoma patients.

[0022] The beneficial effects of the present application are as follows:

[0023] The present invention first discovers that the expression of RAB3B is significantly up-regulated in the tissues of chordoma patients, and its expression level is closely related to the phosphorylation level of p-S6 (S235 / 236) in the mTORC1 signaling pathway, thereby regulating the proliferation, migration and stemness of tumor cells.

[0024] By inhibiting the expression of RAB3B, the present application can inhibit the proliferation of tumor cells of chordoma and reduce the tumor volume of chordoma patients, providing a new feasible solution for the treatment of chordoma.

[0025] The present application also provides a new detection method, using technical means such as immunohistochemistry, Western blot, quantitative reverse transcription polymerase chain reaction, etc., to quantitatively detect the expression of RAB3B in chordoma patient samples, and compare the detection results with the pre-established standard model or database data, so as to accurately predict the treatment response of patients to mTORC1 inhibitors such as rapamycin and dacomitinib and the prognosis of chordoma. Description of the Drawings

[0026] Figure 1 For the RAB3B / S6 axis in Example 1 to be highly expressed in chordoma tissues and closely related to the prognosis of patients; among them, Figure 1 A to 1B show that RAB3B shows a significant high expression trend in chordoma tissues. On the contrary, the expression of RAB3B in embryonic NP is significantly lower; Figure 1 C is the ROC curve for judging the prognosis of patients by the expression level of RAB3B using 80 samples; Figure 1 D is the ROC curve for verifying the judgment method using an additional 40 samples; Figure 1E-1F shows the relationship between the expression level of RAB3B and the clinical prognosis of patients; Figure 1 G-1J are representative IHC images of each group based on the expression levels of RAB3B and p-S6 (S235 / 236); Figure 1 K-1L show that patients with high expression of both RAB3B and p-S6 (S235 / 236) have significantly shortened PFS and OS and the worst prognosis; conversely, patients with low expression of both RAB3B and p-S6 (S235 / 236) show the longest PFS and OS.

[0027] Figure 2 In Example 2, RAB3B regulates the mTORC1 signaling pathway by mediating site-specific phosphorylation of S6 (S235 / 236); among them, Figure 2 A-2C show the phosphorylation level of the S235 / 236 site of S6 protein in CH22 cells and U-CH2 cells with RAB3B knocked down by siRNA, and there were no significant changes in the phosphorylation status of other related signaling molecules such as ERK, AKT, S6K1; Figure 2 D shows the phosphorylation level of the S235 / 236 site of S6 protein in CH22 cells with RAB3B knocked out by sgRNA, and there were no significant changes in the phosphorylation status of other related signaling molecules such as ERK, AKT, S6K1; Figure 2 E-2F show the phosphorylation level of the S235 / 236 site of S6 protein in CH22 cells and U-CH2 cells with RAB3B knocked down by shRNA, and supplementing amino acids in cells overexpressing RAB3B showed a higher phosphorylation level of S6 protein at the S235 / 236 site than the control group, and vice versa.

[0028] Figure 3 In Example 3, RAB3B enhances the proliferation and tumorigenic ability of chordoma; among them, Figure 3 A-3I show that after knocking out RAB3B in various tumor cell lines, the proliferation ability of chordoma cells decreased significantly; Figure 3 J shows that knocking out RAB3B significantly reduced the tumor volume in nude mice, and the reconstitution experiment could restore the tumorigenic ability of RAB3B.

[0029] Figure 4 In Example 4, targeting the mTORC1 signaling pathway inhibits the growth and tumorigenesis of chordoma; among them, Figure 4 A-4D show that rapamycin and dactolisib significantly inhibited the proliferation of chordoma cells after treatment of CH22 and U-CH2 cells; Figure 4E to 4H indicate that both rapamycin and dactolisib can significantly inhibit the colony formation of CH22 and U-CH2 cells at a concentration of 0.5 nM; Figure 4 I is an orthotopic tibial tumor model in nude mice. It was found that after treatment with rapamycin and dactolisib, the growth of chordoma was significantly inhibited and the tumor volume was significantly reduced; Figure 4 J indicates that the body weight of the mice did not change significantly under any treatment regimen.

[0030] Figure 5 The RAB3B / S6 axis in Example 5 is a predictive indicator for the drug sensitivity of chordoma to mTORC1 inhibitors; among them, Figure 5 A to 5B are the IC50 values of rapamycin in CH22 cells with wild-type RAB3B, overexpressed RAB3B, and knocked-down RAB3B; Figure 5 C to 5E indicate that rapamycin can significantly inhibit the proliferation of tumor cells in CH22 Flag-RAB3B and CH22 WT However, in CH22 sgRAB3B , its inhibitory effect is not obvious.

[0031] Figure 6 The RAB3B / S6 axis in Example 5 is a predictive indicator for the drug sensitivity of chordoma to mTORC1 inhibitors; among them, Figure 6 A to 6B are the IC50 values of dactolisib in CH22 cells with wild-type RAB3B, overexpressed RAB3B, and knocked-down RAB3B; Figure 6 C to 6E indicate that when RAB3B is knocked down, the anti-proliferative effect of cells on dactolisib is significantly weakened. Under the condition of high expression of RAB3B, dactolisib shows a stronger inhibitory effect.

[0032] Figure 7 The RAB3B / S6 axis in Example 6 is for the clinical application of evaluating the sensitivity of chordoma patients to mTORC1 targeted therapy response; among them, Figure 7 A to 7J indicate that both RAB3B and p-S6 (S235 / 236) are highly expressed and co-expressed in patient samples, and at the same time, EGFR is also highly expressed; Figure 7 K is the magnetic resonance imaging of a patient after 5 months of continuous treatment.

[0033] Figure 8 This is a schematic diagram of the method for judging the prognosis or targeted therapy response of chordoma patients based on the RAB3B expression level in chordoma patient samples in this application.

[0034] Figure 9Schematic diagram of the device for judging the prognosis or targeted therapy response of chordoma patients based on the RAB3B expression level in chordoma patient samples.

[0035] Figure 10 Schematic diagram of the electronic terminal of the present application. Detailed implementation manners

[0036] The following uses specific specific examples to illustrate the implementation manners of the present application. Those skilled in the art can easily understand other advantages and effects of the present application from the content disclosed in this specification. The present application can also be implemented or applied through other different specific implementation manners. Various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present application.

[0037] Before further describing the specific implementation manners of the present application, it should be understood that the protection scope of the present application is not limited to the specific implementation manners described below; it should also be understood that the terms used in the embodiments of the present application are for describing specific implementation manners, rather than for limiting the protection scope of the present application; in the specification and claims of the present application, unless otherwise clearly indicated in the text, the singular forms "a", "an", and "the" include the plural forms.

[0038] When the embodiments give a numerical range, it should be understood that unless otherwise specified in the present application, both endpoints of each numerical range and any value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by those skilled in the technical field of the present application. Except for the specific methods, devices, and materials used in the embodiments, according to the knowledge of those skilled in the technical field of the present application and the description of the present application, any methods, devices, and materials similar to or equivalent to the methods, devices, and materials described in the embodiments of the present application can also be used to implement the present application.

[0039] The present application first discovers that the high expression of RAB3B in chordoma patient tissues is closely correlated with the phosphorylation level of S6 protein (S235 / 236) in the mTORC1 signaling pathway, thereby regulating the stemness, proliferation, and migration of tumor cells. Inhibiting the expression level of RAB3B can reduce the proliferation ability of tumor cells and the tumor volume.

[0040] Therefore, the present application first provides the use of RAB3B inhibitors in the preparation of products; the products can be products for reducing the phosphorylation level of S6 protein; can be products for regulating the PI3K-AKT-mTOR signaling pathway; can be products for preventing and / or treating chordoma.

[0041] The S6 protein refers to ribosomal protein S6 (Ribosomal Protein S6, abbreviated as rpS6). It is a component of the small ribosomal subunit. Phosphorylation of the S6 protein refers to the process of adding a phosphate group (-PO3 2- ) to specific amino acid residues of the S6 protein. In this application, the phosphorylation site is Ser235 / 236, which is located at the C-terminus of the S6 protein. Phosphorylation of the S6 protein can be regulated by the mTOR signaling pathway. After mTOR is activated, it phosphorylates S6 kinase (S6K). Reducing the phosphorylation level of the S6 protein means that compared with the blank control group, the product of this application can reduce the phosphorylation modification of specific amino acid residues (such as Ser235 / 236) on the S6 protein and inhibit its phosphorylated state. This application found that phosphorylated S6 protein (p-S6) is a downstream signaling factor of RAB3B, and high expression of RAB3B shows a close correlation with the phosphorylation level of S6 protein (S235 / 236) in the mTORC1 signaling pathway.

[0042] In the PI3K-AKT-mTOR signaling pathway, PI3K (phosphatidylinositol 3-kinase) is an upstream activator of this pathway. It can phosphorylate phosphatidylinositol-4,5-bisphosphate (PIP2) into phosphatidylinositol-3,4,5-trisphosphate (PIP3), thereby providing a binding site for downstream signaling molecules. PI3K can be activated by various cell surface receptors (such as tyrosine kinase receptors, G protein-coupled receptors), and common activators include insulin, growth factors (such as IGF-1), and cytokines; Akt (protein kinase B) is a direct downstream target of PI3K and is an important Ser / Thr protein kinase involved in multiple intracellular signal transduction. Akt is activated by binding to PIP3 and is then phosphorylated by PDK1 (phosphatidylinositol-dependent kinase 1), further activating its kinase activity; mTOR (mammalian target of rapamycin) is a downstream target of Akt and is an important regulatory center in cells, participating in the regulation of protein synthesis, cell growth, and metabolism. mTOR can form two complexes: mTORC1 and mTORC2. mTORC1 is sensitive to the phosphorylation of Akt, while mTORC2 is involved in the further activation of Akt. By activating mTORC1, this pathway promotes cell volume increase and cell cycle progression. mTORC1 enhances protein synthesis and cell growth by phosphorylating S6K and 4E-BP1.

[0043] In this application, the PI3K-AKT-mTOR signaling pathway is more specifically the mTORC1 signaling pathway.

[0044] The prevention refers to taking measures before the occurrence of a disease to prevent its occurrence; or reducing the development and impact of the disease through early detection, diagnosis, and treatment; or reducing the adverse consequences of the already-occurred disease, and improving the quality of life and functional status of the patient through rehabilitation and disease management.

[0045] The treatment refers to a series of methods, techniques, and procedures adopted to relieve the symptoms of the disease, treat the disease itself, improve the health condition of the patient, or enhance the quality of life.

[0046] The chordoma is a rare malignant bone tumor that originates from the residual notochord tissue of the embryo. Classified according to the anatomical location, it includes but is not limited to chordomas of the skull base (including chordomas of the clivus, parasellar chordomas, and intrasellar chordomas), sacral chordomas, and spinal chordomas; classified according to the pathological characteristics, it includes but is not limited to classical chordomas, chondroid chordomas, dedifferentiated chordomas, and poorly differentiated chordomas; it may also include other pathological subtypes such as highly vascular chordomas, polycystic chordomas, and stromal chordomas.

[0047] RAB3B is a small GTP-binding protein belonging to the Rab family and is involved in the regulation of intracellular vesicle trafficking and secretion processes. The RAB3B inhibitor can be a substance that inhibits the activity of RAB3B, a substance that reduces the expression level of RAB3B, a substance that reduces the stability of RAB3B, or a substance that reduces the effective action time of RAB3B.

[0048] The RAB3B activity refers to the specific function or catalytic ability exhibited by the RAB3B gene or protein in vivo or in vitro.

[0049] The RAB3B expression level includes but is not limited to the transcriptional level of RAB3B, the translational level of RAB3B, the content of RAB3B in cells, etc.

[0050] The RAB3B stability refers to the functional state, expression level, and content stability of the RAB3B gene or the RAB3B protein encoded by it in cells, and it is continuously maintained at a certain level.

[0051] The RAB3B effective action time refers to the length of time during which the RAB3B protein exerts its biological function in cells.

[0052] In certain embodiments of the present application, the RAB3B inhibitor can be an RAB3B gene inhibitor or an RAB3B protein activity inhibitor.

[0053] In a specific embodiment of the present application, the RAB3B inhibitor can be a small molecule inhibitor of RAB3B, can be an antibody against RAB3B or an antigen-binding fragment thereof, can be a nucleic acid molecule that reduces the expression of RAB3B, can be a gene editing system that knocks out or mutates the RAB3B gene, or a combination thereof.

[0054] In a specific embodiment of the present application, the nucleic acid molecule that reduces the expression of RAB3B can be an antisense oligonucleotide, double-stranded RNA, short hairpin RNA, small interfering RNA, nucleic acid construct, or nucleic acid composition, or a combination thereof.

[0055] In a certain embodiment of the present application, the nucleic acid molecule that reduces the expression of RAB3B is small interfering RNA (siRNA), and the nucleotide sequence of the small interfering RNA is as shown in SEQ ID NO.1-2, or as shown in SEQ ID NO.3-4, or as shown in SEQ ID NO.5-6.

[0056] siRAB3B(1)F: GGGCUUCAUUCUGAUGUAUTT (SEQ ID NO.1).

[0057] R: AUACAUCAGAAUGAAGCCCTT (SEQ ID NO.2).

[0058] siRAB3B(2)F: CAGCUUGGGUUUGAUUUCUTT (SEQ ID NO.3).

[0059] R: AGAAAUCAAACCCAAGCUGTT (SEQ ID NO.4).

[0060] siRAB3B(3)F: GACCAGACCAUCCCGCAGCTT (SEQ ID NO.5).

[0061] R: GCUGCGGGAUGGUCUGGUCTT (SEQ ID NO.6).

[0062] In another embodiment of the present application, the nucleic acid molecule that reduces the expression of RAB3B is short hairpin RNA (shRNA), and the targeting sequence of the shRNA is as shown in SEQ ID NO.7.

[0063] SEQ ID NO.7: GATGAGTTGCTGCTATTCTTT.

[0064] It is found and proved in this application that siRNA and shRNA can inhibit the proliferation and tumorigenesis of chordoma tumor cells by reducing the expression of RAB3B. Since the nucleic acid molecules that reduce the expression of RAB3B all reduce the expression of RAB3B through the same or similar principles, and it is a conventional technique in the art to design the sequence of the nucleic acid molecule according to the sequence of RAB3B and obtain the nucleic acid molecule, it can be speculated that any nucleic acid molecule designed and synthesized based on the RAB3B sequence and reducing the expression of RAB3B through the same or similar principles can achieve the same effect and fall within the protection scope of this application.

[0065] In a specific embodiment of this application, the gene editing system that knocks out or mutates the RAB3B gene can be the CRISPR-Cas9 gene editing system. The gene editing system that knocks out or mutates the RAB3B gene contains guide RNA (sgRNA) or a nucleic acid fragment encoding guide RNA, and the targeting sequence of the guide RNA is as shown in SEQ ID NO.8.

[0066] SEQ ID NO.8: GTAGTCAAAATTCTGGTCAG.

[0067] The gene editing system that knocks out or mutates the RAB3B gene may also include a Cas protein or a nucleic acid fragment encoding a Cas protein, which is used to cleave the target sequence, and the Cas protein or the nucleic acid fragment encoding a Cas protein can be conventional in the art.

[0068] In a specific embodiment of this application, the product can be a drug or a reagent.

[0069] This application also provides a RAB3B inhibitor, and the inhibitor can be a short hairpin RNA (shRNA), a small interfering RNA (siRNA), or a gene editing system, or a combination thereof, for preparing a product that reduces the phosphorylation level of the S6 protein, preparing a product that regulates the PI3K-AKT-mTOR signaling pathway, and preparing a product for preventing and / or treating chordoma.

[0070] The nucleotide sequences of the small interfering RNA are as shown in SEQ ID NO.1-2, or as shown in SEQ ID NO.3-4, or as shown in SEQ ID NO.5-6.

[0071] The targeting sequence of the short hairpin RNA is as shown in SEQ ID NO.7.

[0072] The gene editing system contains guide RNA or a nucleic acid fragment encoding guide RNA, and the targeting sequence of the guide RNA is as shown in SEQ ID NO.8.

[0073] The present application also provides a drug, comprising an effective amount of the RAB3B inhibitor in the above use, or the above-mentioned RAB3B inhibitor.

[0074] In the present application, the effective amount refers to the amount of a drug compound or composition that causes a measurable clinical, biological, or pharmacological change or response in a biomarker, cell, tissue, system, or patient.

[0075] In the present application, the above products and drugs necessarily contain an effective amount of the RAB3B inhibitor. The RAB3B inhibitor can be used as the only active ingredient in the product, or as one of the active ingredients in the product. The product may also include other substances that can reduce the phosphorylation level of the S6 protein, other substances that can regulate the PI3K-AKT-mTOR signaling pathway, and other substances that can prevent and / or treat chordoma.

[0076] In the present application, the above products and drugs can be single-component substances or multi-component substances.

[0077] In the present application, the dosage forms of the above products and drugs are not limited. For example, they can be one or more of sprays, nasal drops, solutions, granules, aerosols, powder aerosols, tablets, injections, capsules, oral preparations, and injections.

[0078] In the present application, the above-mentioned products and drugs may further include pharmaceutically acceptable excipients or carriers. Pharmaceutically acceptable excipients refer to auxiliary materials that do not affect the efficacy and safety of the main drug component, the RAB3B inhibitor, are non-toxic themselves, do not produce adverse, allergic or other adverse reactions, and should be compatible with the RAB3B inhibitor, that is, they can be blended with it without significantly reducing its effect under normal circumstances. Examples of these excipients include: sterile water or physiological saline, as a solvent or diluent for the drug; stabilizers, used to maintain the stability of the drug and prevent decomposition; antioxidants, such as ascorbic acid, to prevent drug oxidation; buffers: such as phosphates, citric acid, etc., used to maintain the pH value of the drug; excipients, to help form a specific form of the drug, such as tablets, capsules, etc.; preservatives, to prevent the drug from being contaminated by microorganisms during storage; surfactants, such as polyethylene glycol (PEG), Tween (Tween), etc., used to increase the solubility or stability of the drug; binders, used to fix the drug components together; suspending agents, such as ethoxylated isooctadecanol, polyoxyethylene sorbitol, sorbitan esters, microcrystalline cellulose, aluminum methoxide and agar or mixtures of these substances; chelating agents, such as EDTA, used to bind metal ions to prevent drug degradation. In addition, the pharmaceutical preparation may also contain: low molecular weight polypeptides; proteins, such as immunoglobulins, serum albumin, or gelatin; amino acids, such as glycine, glutamic acid, arginine, asparagine and lysine; sugars or carbohydrates, such as polysaccharides and monosaccharides; sugar alcohols, such as sorbitol or mannitol. When preparing an aqueous injection solution, the following may also be used: physiological saline; isotonic solutions containing glucose or other auxiliary drugs; solubilizers, such as alcohols (ethanol), polyols (such as propylene glycol, PEG) and non-ionic surfactants (such as Tween 80, HCO-50); wetting agents; sweeteners; flavoring agents; emulsifiers; suspending agents; fragrances. The types and proportions of these excipients or carriers can be adjusted according to the type and requirements of the final pharmaceutical preparation.

[0079] In the drugs of the present application, the RAB3B inhibitor may be a single active ingredient or may be combined with one or more other active ingredients to form a combined preparation, and there is no conflict in the efficacy and safety between the components. The other active ingredients may be various other drugs for treating chordoma, or other drugs that can reduce the phosphorylation level of S6 protein, or other drugs that can regulate the PI3K-AKT-mTOR signaling pathway. Specific examples may be: imatinib, dasatinib; erlotinib, lapatinib, gefitinib, cetuximab; sorafenib, pazopanib, sunitinib, rapamycin, everolimus, daclisib, etc. The content of each component in the combined preparation is usually a safe and effective amount, and the safe and effective amount can be adjusted based on the actual usage (such as patient weight, application type, disease condition, severity).

[0080] The product and the drug can also be administered simultaneously or sequentially with other drugs for treating chordoma, or other drugs that can reduce the phosphorylation level of S6 protein, or other drugs that can regulate the PI3K-AKT-mTOR signaling pathway, the drugs for treating chordoma.

[0081] This application also provides a method for reducing the phosphorylation level of S6 protein, including administering an effective amount of the RAB3B inhibitor in the above use, or the product in the above use, or the above drug to the subject.

[0082] This application also provides a method for regulating the PI3K-AKT-mTOR signaling pathway, including administering an effective amount of the RAB3B inhibitor in the above use, or the product in the above use, or the above drug to the subject.

[0083] This application also provides a method for treating chordoma, including administering an effective amount of the above RAB3B inhibitor, or the above product, or the above drug to the subject.

[0084] The method for treating chordoma can also be administered simultaneously or sequentially with other methods for treating chordoma, such as surgical treatment, radiotherapy, chemotherapy, and targeted therapy.

[0085] In this application, the subject of the above RAB3B inhibitor, product, and drug can be a mammal, such as but not limited to humans, primates, livestock (such as sheep, cattle, horses, donkeys, pigs), pets (such as dogs, cats), laboratory test animals (such as mice, rabbits, rats, guinea pigs, hamsters), or captured wild animals (such as foxes, deer). Preferably, the subject is a primate, and more preferably, the subject is a human.

[0086] This application finds that the expression level of RAB3B in the tissues of chordoma patients is closely related to the survival period of the patients. By detecting the expression level of RAB3B in the tissues of chordoma patients, the length of their survival period can be predicted and the prognosis of the patients can be judged.

[0087] Therefore, this application also provides the use of RAB3B and / or reagents for detecting RAB3B in the preparation of products for chordoma prognosis or products for predicting treatment response.

[0088] The prognosis refers to the prediction and evaluation of the possible future development trends, outcomes, treatment effects, and patient survival of a disease. Common indicators of prognosis include (1) survival rates: overall survival rate (OS): the time from diagnosis to death from any cause; progression-free survival rate (PFS): the time from the start of treatment to disease progression; recurrence-free survival rate (RFS): the time from the end of treatment to recurrence; (2) disease outcomes: whether the disease remits (such as complete remission, partial remission); whether the disease recurs or metastasizes; functional status: the quality of life of the patient (such as whether they can take care of themselves, whether they can work normally); neurological function recovery (such as limb strength, sensory function).

[0089] The treatment response refers to the changes shown by a patient in aspects such as their disease state, symptoms, signs, or physiological functions after receiving treatment. The treatment response is an important basis for evaluating treatment effects, adjusting treatment plans, and judging disease prognosis. In the specific embodiments of the present application, the treatment response is the treatment response of mTORC1-targeted therapy.

[0090] In the specific embodiments of the present application, the reagent for detecting RAB3B is a reagent for detecting the expression level of RAB3B, and the expression level of RAB3B can be the gene expression level of RAB3B or the protein expression level of RAB3B.

[0091] More specifically, the reagent for detecting RAB3B can be a reagent required for detecting the expression level of RAB3B by immunohistochemistry (IHC), a reagent required for detecting the expression level of RAB3B by Western blot, or a reagent required for detecting the expression level of RAB3B by quantitative reverse transcription polymerase chain reaction. In IHC, the expression level of RAB3B can be measured using the H-score system, and its calculation formula is: H-score = Σpi(i + 1).

[0092] The reagent required for detecting the expression level of RAB3B by immunohistochemistry can be, for example, an IHC kit, including PBS buffer, antigen retrieval solution, endogenous peroxidase blocker, antibody diluent, blocking solution, DAB chromogenic solution, hematoxylin stain, and antibodies, including primary antibodies and secondary antibodies.

[0093] The reagents required for detecting the expression level of RAB3B by Western blot include, but are not limited to, primary antibodies, secondary antibodies, lysis buffer, acrylamide, methylene bisacrylamide, Tris buffer, transfer membrane, transfer buffer, blocking solution, antibody diluent, chemiluminescent substrate, PBS buffer, protein quantification reagent, protein loading buffer, and Coomassie Brilliant Blue staining solution.

[0094] The reagents required for detecting the expression level of RAB3B by quantitative reverse transcription polymerase chain reaction include, but are not limited to, RNA extraction reagents (such as Trizol reagent or RNeasy Mini Kit), reverse transcriptase (such as Superscript II or III reverse transcriptase), reverse transcription primers (such as Oligo(dT) or random primers), dNTP mixture, reverse transcription buffer, TaqMan probe or SYBR Green reagent, primer pairs, qPCR Master Mix, DEPC-treated water, and internal reference gene primers: such as GAPDH or β-actin, for normalization.

[0095] The product is selected from one or more of reagents, kits, test strips, and chips.

[0096] This application also provides a device for chordoma prognosis or predicting treatment response, such as Figure 9 The device includes:

[0097] A data module 11 for obtaining RAB3B expression level data of a sample;

[0098] An analysis module 12 for judging the prognosis or treatment response of a chordoma patient based on the RAB3B expression level data of the sample.

[0099] Specifically, the following method is used to judge the prognosis of a chordoma patient: when the RAB3B expression level data is greater than or equal to the cut-off value, it is judged as poor prognosis; when the RAB3B expression level data is less than the cut-off value, it is judged as good prognosis.

[0100] It should be noted that in the specific embodiments of this application, the division of each module of the device is only a logical function division. In actual implementation, it can be fully or partially integrated into a physical entity, or physically separated. These modules can all be implemented in the form of software called by a processing element; they can also all be implemented in hardware; or some modules can be implemented in the form of software called by a processing element, and some modules can be implemented in hardware. For example, the detection module can be a separately established processing element, or can be integrated in a certain chip. In addition, it can also be stored in the memory in the form of program code and called and executed by a certain processing element to perform the functions of the above database acquisition module. The implementation of other modules is similar. In addition, these modules can be fully or partially integrated together, or can be independently implemented. The processing element mentioned here can be an integrated circuit with signal processing capabilities. In the implementation process, each step of the above method or each of the above modules can be completed by the integrated logic circuit in the processor element or the instructions in software form.

[0101] For example, these modules in the embodiments of the present application may be one or more integrated circuits configured to implement the above methods, such as: one or more application specific integrated circuits (ASICs), or, one or more digital signal processors (DSPs), or, one or more field programmable gate arrays (FPGAs) or graphics processing units (GPUs), etc. Again, when a certain module above is implemented in the form of a processing element scheduler code, the processing element may be a general-purpose processor, such as a central processing unit (CPU) or other processors that can call program code. Again, these modules may be integrated together and implemented in the form of a system-on-a-chip (SOC).

[0102] The present application also provides a computer-readable storage medium, comprising a computer program, wherein the computer program, when run by a processor, executes a method comprising the following steps:

[0103] Obtain the RAB3B expression level data of the sample; based on the RAB3B expression level data of the sample, judge the prognosis or treatment response of chordoma patients.

[0104] In an embodiment of the present application, the computer-readable storage medium may include a read-only memory, a random access memory, an EEPROM, a CD-ROM, or other optical disc storage devices, a magnetic disk storage device, or other magnetic storage devices, a flash memory, a USB flash drive, a mobile hard disk, or any other medium that can be used to store the desired program code in the form of instructions or data structures and can be accessed by a computer. Additionally, any connection may be appropriately referred to as a computer-readable storage medium. For example, if the instructions are sent from a website, a server, or other remote sources using coaxial cables, fiber optic cables, twisted pairs, digital subscriber lines (DSLs), or wireless technologies such as infrared, radio, and microwave, then the coaxial cables, fiber optic cables, twisted pairs, DSLs, or wireless technologies such as infrared, radio, and microwave are included in the definition of the medium. However, it should be understood that the computer-readable storage medium does not include carrier waves, signals, or other transient media, but is intended for non-transient, tangible storage media.

[0105] Specifically, the following method is used to judge the prognosis of chordoma patients: when the RAB3B expression level data is greater than or equal to the cut-off value, it is judged as poor prognosis; when the RAB3B expression level data is less than the cut-off value, it is judged as good prognosis.

[0106] This application also provides an electronic terminal, as Figure 10 shown, which includes a memory and a processor. The memory contains a computer program, and is characterized in that when the computer program is run by the processor, it executes a method including the following steps:

[0107] Obtain the RAB3B expression level data of the sample; based on the RAB3B expression level data of the sample, judge the prognosis or treatment response of chordoma patients.

[0108] Specifically, the following method is used to judge the prognosis of chordoma patients: when the RAB3B expression level data is greater than or equal to the cut-off value, it is judged as poor prognosis; when the RAB3B expression level data is less than the cut-off value, it is judged as good prognosis.

[0109] The schematic diagram of the electronic terminal is as Figure 10 shown. The electronic terminal includes: a processor 21, a memory 22, a communicator 23, a communication interface 24, and a system bus 25; the memory 22 and the communication interface 24 are connected to the processor 21 and the communicator 23 through the system bus 25 to complete mutual communication. The memory 22 is used to store a computer program, the communication interface 24 is used to communicate with other devices, and the processor 21 and the communicator 23 are used to run the computer program so that the terminal executes the above method.

[0110] The system bus 25 can be a Peripheral Component Interconnect (PCI) bus or an Extended Industry Standard Architecture (EISA) bus, etc. This system bus can be divided into an address bus, a data bus, a control bus, etc. For the sake of simplicity, only a thick line is used to represent it in the figure, but it does not mean that there is only one bus or one type of bus.

[0111] The communication interface 24 is used to realize the communication between the database access device and other devices (such as clients, read-write libraries, and read-only libraries).

[0112] The memory 22 may include a Random Access Memory (RAM), and may also include a non-volatile memory, such as at least one disk memory.

[0113] The processor 21 may be a general-purpose processor, including a central processing unit (CPU), a network processor (NP), etc.; it may also be a digital signal processor (DSP), an application specific integrated circuit (ASIC), a field-programmable gate array (FPGA), or other programmable logic devices, discrete gate or transistor logic devices, discrete hardware components.

[0114] The electronic terminal may be a mobile phone, a computer device, a tablet device, a personal digital processing device, a factory back-end processing device, etc.

[0115] This application also provides a computer program product, including a computer program, and the method for implementing the following steps when the computer program is executed by a processor:

[0116] Obtain the RAB3B expression level data of a sample; based on the RAB3B expression level data of the sample, judge the prognosis or treatment response of a chordoma patient.

[0117] Specifically, the following method is used to judge the prognosis of a chordoma patient: when the RAB3B expression level data is greater than or equal to the cut-off value, it is judged as poor prognosis; when the RAB3B expression level data is less than the cut-off value, it is judged as good prognosis.

[0118] This application also provides a method for chordoma prognosis or predicting treatment response for non-disease diagnosis and treatment purposes, as Figure 8 shown, including: obtaining the RAB3B expression level data of a sample; based on the RAB3B expression level data of the sample, judging the prognosis or treatment response of a chordoma patient.

[0119] More specifically, the method includes: a) obtaining a pathological tissue sample of a chordoma patient; b) detecting the expression level of RAB3B in the sample; c) detecting the expression level of p-S6 (S235 / 236) in the sample; d) judging the prognosis and treatment response of the patient to the mTORC1 inhibitor according to the expression levels of the RAB3B and p-S6 (S235 / 236) proteins.

[0120] The pathological tissue sample is a biopsy or resection tissue sample obtained from a chordoma patient before, during, or after surgery.

[0121] The detection of the expression level is carried out by immunohistochemistry, Western blot, quantitative reverse transcription polymerase chain reaction or other conventional detection methods.

[0122] The expression level can be a gene expression level or a protein expression level.

[0123] The mTORC1 inhibitor is Rapamycin or Dactolisib.

[0124] Step d includes determining the sensitivity of the patient to mTORC1-targeted therapy by comparing the detected protein expression levels of RAB3B and p-S6 (S235 / 236) with a pre-established standard model or database.

[0125] The method is for non-disease diagnosis and treatment purposes, such as for assisting in formulating personalized and precise treatment plans for chordoma patients.

[0126] In a specific embodiment of the present application, the RAB3B expression level data of the sample can be, for example, H-score data obtained by immunohistochemical detection and the H-score system.

[0127] In a specific embodiment of the present application, the cut-off value is 4.3. That is, in the device, computer-readable storage medium, electronic terminal, computer program product, and method, the following method is used to judge the prognosis of chordoma patients: when the RAB3B expression level data is greater than or equal to 4.3, it is judged as a positive result (i.e., poor prognosis); when the RAB3B expression level data is less than 4.3, it is judged as a negative result (i.e., good prognosis).

[0128] In a specific embodiment of the present application, the overall survival rate and progression-free survival period of chordoma patients with RAB3B expression level data greater than or equal to 4.3 are both worse than those of chordoma patients with RAB3B expression level data less than 4.3.

[0129] The positive result, i.e., poor prognosis, means that the end point of the patient's 10-year survival is death.

[0130] The negative result, i.e., good prognosis, means that the patient has not died.

[0131] In the present application, the detection object of the above chordoma prognosis product, product for predicting treatment response, device, computer-readable storage medium, terminal, computer program product, and method can be a mammal, such as but not limited to humans, primates, livestock (such as sheep, cattle, horses, donkeys, pigs), pets (such as dogs, cats), laboratory test animals (such as mice, rabbits, rats, guinea pigs, hamsters), or captured wild animals (such as foxes, deer). Preferably, the object is a primate, and more preferably, the object is a human.

[0132] In this application, the term "patient" can also be used interchangeably with "subject", and refers to the group of patients suffering from chordoma.

[0133] The present application will be described below through specific examples. Unless otherwise specified, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt the conventional techniques in the fields of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and related fields in this technical field. These techniques have been well described in the existing literature. For details, see Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, Chromatin (P.M. Wassarman and A.P. Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, Chromatin Protocols (P.B. Becker, ed.) Humana Press, Totowa, 1999, etc. Unless otherwise specified, the instruments, reagents, and materials used in the examples can be obtained through conventional channels.

[0134] Example 1 The RAB3B / S6 axis is highly expressed in chordoma tissues and is closely related to the prognosis of patients

[0135] 1. Materials and methods

[0136] 1.1 Tissue microarray and immunohistochemical analysis: To explore the molecular markers and expression abundance in chordoma and control samples in depth, this study constructed a tissue microarray (TMA) and performed immunohistochemistry (IHC) analysis. The samples for the tissue microarray were collected from Shanghai First People's Hospital, Shanghai Tenth People's Hospital, and the First Affiliated Hospital of Zhengzhou University, including 120 chordoma samples from 75 patients. And the control group was paraffin-embedded embryonic nucleus pulposus samples provided by the First Affiliated Hospital of Zhengzhou University, with a total of 30. All chordoma and control tissue sections were immunohistochemically stained using a Dako kit (Copenhagen), which can ensure the standardization and repeatability of the staining procedure. The antibodies used were all validated antibodies (RAB3B / C, Proteintech, 15774-1-AP; phospho-S6(Ser235 / 236), Cell Signaling Technology, #4858), which can ensure clear and specific labeling of the target. The cell nuclei were counterstained with hematoxylin (Vector Laboratories). The staining results of each section were independently evaluated by two experienced pathologists, which can ensure the objectivity and accuracy of the results. The evaluation mainly used the H-score system, and its calculation formula was: H-score = Σpi(i + 1), as the expression level of RAB3B.

[0137] 1.2 ROC curve plotting: By analyzing the expression of RAB3B in the tissue microarray of 80 patients, the median H-score of RAB3B was 4.3. The median H-score was set as the cut-off value, that is, the samples with an H-score greater than or equal to 4.3 were classified into the high-expression group, and vice versa into the low-expression group. Based on whether the expression of RAB3B in the patients was in the high-expression group or the low-expression group (based on the relationship between the H-score of RAB3B in the patients and the cut-off value of 4.3) as the judgment condition, the outcome endpoint was the survival status of the patients. When it was in the high-expression group (the H-score of RAB3B in the patients was greater than or equal to 4.3), it was judged as poor prognosis, and when it was in the low-expression group (the H-score of RAB3B in the patients was less than 4.3), it was judged as good prognosis. Comparing with the true prognosis of the samples, the complements of the sensitivity (true positive rate) and specificity (true negative rate) (i.e., false positive rate) under this cut-off value were obtained, and an ROC curve was made.

[0138] To judge the clinical value of RAB3B as a prognostic-related indicator for chordoma. In addition, 40 patients were used as an external validation group to verify the accuracy of this judgment method.

[0139] 1.3 Survival analysis: Further analysis was performed based on the expression of RAB3B and p-S6 in the tissue microarray. The median H-score of RAB3B was 4.3, which was used as the cut-off value for judging the prognosis based on the RAB3B expression level. Samples with an H-score greater than or equal to 4.3 were classified into the high-expression group, and those with a lower score were classified into the low-expression group; the median H-score of p-S6 (S235 / 236) was 2.7. We defined high expression as ≥2.7, and those with a value lower than 2.7 were classified into the low-expression group. Further, the Kaplan-Meier survival curve was used for survival analysis to visually display the survival of different experimental groups and provide graphical support and analysis for survival analysis.

[0140] 2. Results: The experimental results are as Figure 1 shown. RAB3B showed a significant high-expression trend in chordoma tissues. Conversely, the expression of RAB3B was significantly lower in embryonic NPs ( Figure 1 A and B); as shown by the results based on the ROC curve ( Figure 1 C), the expression level of RAB3B was closely related to the clinical prognosis of patients. The survival period of chordoma patients with an RAB3B expression level less than 4.3 was longer than that of chordoma patients with an RAB3B expression level greater than or equal to 4.3. The AUC for judging the prognosis of patients based on the RAB3B expression level was 0.791. When the cut-off value was 4.3, the specificity was 0.686 and the sensitivity was 0.897. That is, when the RAB3B expression level was less than 4.3, it was judged as a negative result, indicating that the patient had a good prognosis and did not die. When the RAB3B expression level was greater than or equal to 4.3, it was judged as a positive result, indicating that the patient had a poor prognosis and the endpoint of the 10-year survival of the patient was death.

[0141] The above judgment method was verified by an external validation group, and the obtained ROC curve is as Figure 1 D. The external validation group corroborated the accuracy of the model (AUC: 0.741); when the above cut-off value was used for the above judgment, the specificity was 0.483 at this time; the sensitivity was 1, thus verifying that the above method for judging the prognosis of patients based on the RAB3B expression level had high specificity and sensitivity.

[0142] In addition, Figure 1 E and F showed that patients with low RAB3B expression had a longer progression-free survival (PFS) (p = 1.402e-03) and overall survival (OS) (p = 1.312e-05); based on the RAB3B and p-S6 (S235 / 236) expression levels, representative IHC images of each group are shown in Figure 1G-J; By analyzing the survival data of chordoma patients, we found that the expression levels of RAB3B and p-S6 (S235 / 236) in the tumor tissues of patients had significant prognostic predictive value. Specifically, patients with high expression levels of both RAB3B and p-S6 (S235 / 236) had significantly shorter PFS and OS, and the worst prognosis; on the contrary, patients with low expression levels of both RAB3B and p-S6 (S235 / 236) showed the longest PFS (p = 9.349e-06, Figure 1 K) and OS (p = 8.202e-06, Figure 1 L).

[0143] Example 2 Regulation of the mTORC1 signaling pathway by RAB3B through mediating site-specific phosphorylation of S6 (S235 / 236)

[0144] 1. Materials and methods

[0145] 1.1 The specific steps for knockdown using siRNA were as follows. First, 2×10 5 chordoma cells were seeded in each well of a 6-well plate, and the synthesized human RAB3B siRNA or control siRNA was mixed with Lipofectamine RNAiMax transfection reagent at a ratio of transfection reagent:siRNA = 2:1. Then, 200 μL of medium without serum and other related reagents was further added and mixed evenly. After that, it was left standing in a biosafety cabinet for 15 - 30 min. The standing solution was added to the cell culture dish to be transfected, and the fresh growth medium was changed 24 h after transfection. RNase-free related consumables were used throughout the process.

[0146] The siRNA sequences were:

[0147] siRAB3B(1) F: GGGCUUCAUUCUGAUGUAUTT (SEQ ID NO.1).

[0148] R: AUACAUCAGAAUGAAGCCCTT (SEQ ID NO.2).

[0149] siRAB3B(2) F: CAGCUUGGGUUUGAUUUCUTT (SEQ ID NO.3).

[0150] R: AGAAAUCAAACCCAAGCUGTT (SEQ ID NO.4).

[0151] siRAB3B(3) F: GACCAGACCAUCCCGCAGCTT (SEQ ID NO.5).

[0152] R: GCUGCGGGAUGGUCUGGUCTT (SEQ ID NO.6).

[0153] 1.2 The specific steps for gene editing to knockout RAB3B are as follows: First, to obtain the virus-infected liquid, the operation should be carried out in HEK293T cells with good cell status. One day before the operation, the HEK293T cells should be counted and seeded into a 6-well plate at an appropriate concentration. The next day, the following plasmids are used for virus-packaging transfection: sgCrtl, sgRAB3B, pLVX-empty, and Flag-RAB3B-Rescue, and are co-transfected with the packaging plasmids psPAX2 and pMD2.G at the same time. In addition, PEI and serum-free medium are mixed evenly and added to the 6-well plate containing HEK293T cells after standing. The ratio of the above plasmids to PEI is 1:2. After 48 hours, the virus supernatant is collected and concentrated for infecting related cells such as chordoma. After another 48 hours of infection and further culture, screening drugs such as puromycin are added for screening to obtain the target cell line.

[0154] The targeting sequence of sgRNA: GTAGTCAAAATTCTGGTCAG (SEQ ID NO.8).

[0155] 1.3 Construction of the shRAB3B knockdown cell line: First, to obtain the virus-infected liquid, the operation should be carried out in HEK293T cells with good cell status. One day before the operation, the HEK293T cells should be counted and seeded into a 6-well plate at an appropriate concentration. The next day, the following plasmids are used for virus-packaging transfection: shNC and shRAB3B, and are co-transfected with the packaging plasmids psPAX2 and pMD2.G at the same time. In addition, PEI and serum-free medium are mixed evenly and added to the 6-well plate containing HEK293T cells after standing. The ratio of the above plasmids to PEI is 1:2. After 48 hours, the virus supernatant is collected and concentrated for infecting related cells such as chordoma. After another 48 hours of infection and further culture, screening drugs such as puromycin are added for screening to obtain the target cell line.

[0156] The targeting sequence of shRAB3B: GATGAGTTGCTGCTATTCTTT (SEQ ID NO.7).

[0157] 1.4 Western blot: The transfected cells were first washed with PBS and centrifuged to obtain cell pellets free of impurities. Subsequently, they were lysed using lysis buffer. After 30 minutes of cell lysis, the lysate was centrifuged at 12,000 rpm at 4 °C for 15 minutes to obtain a clarified lysate. Finally, the protein quantification kit was used to determine the sample concentration, and protein buffer was added and the samples were boiled. The proteins in the samples were separated by SDS-PAGE according to their molecular weights, and then the separated proteins were transferred to a PVDF membrane. Next, the membrane was blocked to prevent non-specific antibody binding, incubated with the primary antibody against the target protein, and then incubated with the secondary antibody labeled with an enzyme; finally, protein detection was performed using the Tanon system.

[0158] 1.5 Amino acid starvation and stimulation experiments: Cells at an appropriate density were washed with PBS and then incubated in a specified medium without amino acids for 60 minutes. Then, they were stimulated with amino acids at time points (0, 5, 15, 20 minutes).

[0159] 2. Results: Figure 2 A - C show that after knockdown of CH22 and U-CH2 cells using siRNA of RAB3B, the phosphorylation levels of the S235 / 236 sites of S6 protein in these two types of cells were significantly reduced, while other signal pathway indicators showed no obvious changes; in the CH22 sgRAB3B+Vec cells obtained after knockout of RAB3B in CH22 cells using sgRNA, the only significantly changed indicator in the PI3K-AKT-mTOR signal pathway was the phosphorylation level of S6 protein at the S235 / 236 sites, and no significant changes were observed in other related signaling molecules such as ERK, AKT, S6K1 and their corresponding phosphorylation states ( Figure 2 D); in the amino acid (AA) starvation and stimulation experiments, after knockdown of CH22 cells using shRNA of RAB3B, the control group of CH22 shCtrl cells showed stronger phosphorylation ability of S6 at the S235 / 236 sites than CH22 shRAB3B cells, while supplementation of amino acids in cells overexpressing RAB3B showed a higher phosphorylation level of S6 protein at the S235 / 236 sites than the control group ( Figure 2 E and F).

[0160] Example 3: RAB3B enhances the proliferation and tumorigenic ability of chordoma

[0161] 1. Materials and methods:

[0162] 1.1 Cell proliferation assay: Before starting the experiment, chordoma cells (CH22, U-CH1, U-CH2, MUG-Chor1) were first treated with siRAB3B or control siRNA, or RAB3B was knocked out using the CRISPR / Cas9 technique. The above treatments were the same as in Example 2. Then, the chordoma cell lines were seeded in 96-well plates at a density of 3×10 3 cells per well. And MTT drug addition treatment should be carried out at the specified time points every day to ensure the stability and accuracy of the experimental results. The cell proliferation ability was evaluated by the MTT method. Cell samples were collected every 24 hours and incubated with MTT reagent for 4 hours. After the reaction, dimethyl sulfoxide solution was added to terminate the reaction, and the samples were incubated in the incubator for another 20 minutes. Finally, the absorbance was measured at a wavelength of 490 nm using a microplate reader and statistical analysis was performed.

[0163] 1.2 Colony formation assay: Before starting the experiment, chordoma cells (CH22, U-CH1, U-CH2, MUG-Chor1) were first treated with siRAB3B or control siRNA, or RAB3B was knocked out using the CRISPR / Cas9 technique. The above treatments were the same as in Example 2. Then, the chordoma cell lines were seeded in 6-well plates at a density of 2000 cells per well. All cells were cultured for 2 weeks, and after confirming colony formation under the microscope, they were washed 3 times with PBS to remove impurities in the cells or culture medium. Subsequently, they were fixed with 4% paraformaldehyde for 30 minutes, and finally stained with crystal violet for 12 hours. After confirming successful staining, they were rinsed three times with PBS to wash away non-specific binding areas and reduce the background color. Finally, the stained crystal violet was dissolved in 95% ethanol and diluted tenfold, and the whole reaction time was 10 minutes. Finally, the samples were detected at a wavelength of 570 nm using a microplate reader, and counting and statistical analysis were performed.

[0164] 1.3 Tumor xenograft: To evaluate the in vivo tumorigenic ability of RAB3B in enhancing chordoma, 5×10 6 CH22 cells were resuspended in 50 μL of serum-free RPMI-1640 and injected into the tibia of 5-week-old male nude mice. During the operation, care should be taken to be gentle to reduce the pain of the animals. sgCrtl, sgRAB3B, and the rescued CH22 cell lines were injected respectively. Tumor volume was evaluated by small animal MRI under general anesthesia, and data analysis was performed by two independent researchers using ITK-SNAP 3.6 software. Tumor volume was calculated according to the formula: V = ab 2 / 2. Calculation and statistics were performed using the formula (where V is volume, a is tumor length, and b is tumor width), and tumor tissue samples were preserved in 4% paraformaldehyde solution for subsequent experimental analysis. Finally, the mice were sacrificed by cervical dislocation after anesthesia.

[0165] 2. Results: After knocking out RAB3B, the proliferation ability of chordoma cells showed a significant decrease, and this inhibitory effect was significantly time-dependent, that is, as the experimental time extended, the inhibitory effect on cell proliferation gradually intensified. Moreover, in multiple chordoma cell lines, including CH22, U-CH1, U-CH2, and MUG-Chor1, the above results were also verified by corresponding treatment with siRNA of RAB3B. There was an obvious positive correlation between RAB3B and the proliferation ability of chordoma cells ( Figure 3 A-I); To verify the in vivo effect of RAB3B on chordoma tumorigenesis, in this example, a tumor tibia in situ mouse model based on CH22 cells was constructed. And based on this CH22 cell line tumor tibia in situ model, it was found that knocking out RAB3B could significantly reduce the tumor volume (Tumor volume, TV) in nude mice, while the rescue experiment could restore the tumor-promoting ability of RAB3B (TV of CH22 sgCtrl+Vec : 1.1634 ± 0.1984 cm3; TV of CH22 sgRAB3B+Vec : 0.3215 ± 0.1238 cm3; TV of CH22 sgRAB3B+Flag-RAB3B : 1.2096 ± 0.1805 cm3), see Figure 3 J.

[0166] Example 4: Inhibiting the growth and tumorigenesis of chordoma by targeting the mTORC1 signaling pathway

[0167] 1. Materials and methods:

[0168] 1.1 Cell proliferation experiment: Before starting the experiment, chordoma cells (CH22 and U-CH2) were first seeded in 96-well plates, with 3×10 3 cells per well. The next day, the cells were treated with different concentrations of rapamycin or dactolisib according to the experimental design, and the treatment should be carried out at the specified time points every day to ensure the stability and accuracy of the experimental results. The cell proliferation ability was evaluated by the MTT method. Cell samples were collected every 24 hours and incubated with MTT reagent for 4 hours. After the reaction ended, dimethyl sulfoxide solution was added to terminate the reaction, and then incubated in the incubator for another 20 minutes. Finally, the absorbance was measured at a wavelength of 490 nm using an enzyme-linked immunosorbent assay reader and statistical analysis was performed.

[0169] 1.2 Colony formation assay: Before conducting the experiment, chordoma cells treated with rapamycin and dactolisib at different concentrations for 48 hours should be seeded into 6-well plates, with 500 cells seeded in each well, and replicates should be set up. All cells should be cultured for 2 weeks, and after confirming colony formation under a microscope, they should be washed 3 times with PBS to remove impurities in the cells or culture medium. Subsequently, they should be fixed with 4% paraformaldehyde for 30 minutes, and finally stained with crystal violet for 12 hours. After confirming successful staining, they should be rinsed three times with PBS to wash away non-specific binding areas and reduce the background color. Finally, the stained crystal violet should be dissolved in 95% ethanol and diluted tenfold, with the entire incubation time being 10 minutes. Finally, the samples should be detected at a wavelength of 570 nm using an ELISA reader, and the results should be counted and statistically analyzed.

[0170] 1.3 Tumor xenograft: To evaluate the tumorigenic ability of RAB3B in enhancing chordoma in vivo, 5×10 6 CH22 cells were resuspended in 50 μL of serum-free RPMI-1640 and injected into the tibia of 5-week-old male nude mice. During the operation, care should be taken to be gentle to reduce the pain of the animals. After that, these mice were randomly divided into three groups: PBS group (n = 6), rapamycin group (n = 6), and dactolisib group (n = 6). The tumor-bearing mice started the corresponding treatment on the 8th day after tumor inoculation, and were injected with rapamycin (3.5 mg / kg / day), dactolisib (40 mg / kg / day), or PBS every day for 3 weeks. The tumor volume was evaluated by small animal MRI under general anesthesia, and the data were analyzed by two independent researchers using ITK-SNAP 3.6 software. The tumor volume was calculated according to the formula: V = ab 2 / 2. The calculation and statistics were performed according to the formula (where V is the volume, a is the tumor length, and b is the tumor width), and the tumor tissue samples were preserved in 4% paraformaldehyde solution for subsequent experimental analysis. Finally, the mice were sacrificed by cervical dislocation after anesthesia.

[0171] 2. Results: In the MTT cell proliferation assay, when CH22 and U-CH2 cells were treated with 10 nM dose of rapamycin respectively, the cell proliferation ability decreased significantly, and this inhibitory effect showed time-dependence. At the same time, dactolisib also had a significant inhibitory effect on the proliferation of chordoma cells, and the two showed similar anti-proliferative effects ( Figure 4 A-D). In the cell colony formation assay, both rapamycin and dactolisib could significantly inhibit the colony formation of CH22 and U-CH2 cells at a concentration of 0.5 nM ( Figure 4E-H). To further explore the actual application effects of rapamycin and dactolisib in the treatment of chordoma, in this example, a tibial in-situ tumorigenesis model of nude mice based on CH22 cells was established. In the tibial in-situ tumorigenesis model of nude mice, it was found that after treatment with rapamycin and dactolisib, the growth of chordoma was significantly inhibited and the tumor volume was significantly reduced (control group: 0.9115 ± 0.1842 cm 3 ; rapamycin group: 0.0941 ± 0.0303 cm 3 ; dactolisib group: 0.0869 ± 0.0298 cm 3 )( Figure 4 I). Moreover, the body weight of the mice did not change significantly under any treatment regimen ( Figure 4 J). All these results together indicate that the mTORC1 signaling pathway plays a crucial role in the tumorigenesis process of chordoma, and the treatment method targeting this pathway is expected to become an important strategy for the precision treatment of chordoma in the future.

[0172] Example 5: The RAB3B / S6 axis is a predictive indicator for the sensitivity of chordoma to mTORC1 inhibitor drugs

[0173] 1. Materials and methods:

[0174] 1.1 Cell proliferation experiment: Before starting the experiment, first inoculate chordoma cell lines (shCrtl, shRAB3B, Vec, and Flag-RAB3B) into 96-well plates (the method for obtaining cell lines is the same as in Example 2), with 3×10 3 cells inoculated in each well. The next day, the cells were treated with different concentrations of rapamycin or dactolisib according to the experimental design, and the treatment should be carried out at the specified time points every day to ensure the stability and accuracy of the experimental results. The cell proliferation ability was evaluated by the MTT method. Cell samples were collected every 24 hours and incubated with MTT reagent for 4 hours. After the reaction ended, dimethyl sulfoxide solution was added to terminate the reaction, and then incubated in the incubator for another 20 minutes. Finally, the absorbance value was measured at a wavelength of 490 nm using an enzyme-linked immunosorbent assay reader and statistical analysis was performed.

[0175] 1.2 Cell viability detection experiment: Before starting the experiment, first inoculate wild-type, knockdown-type, and overexpressed CH22 cells of RAB3B into 96-well plates, with 2×10 3Cells. All of the above cells were treated with rapamycin or dactolisib at different concentrations (0 nM to 200 nM) for 48 hours respectively. After 48 hours, the cell status and density should be observed under a microscope first. The cell viability was measured using the CellTiter-Glo kit and quantitatively detected on a microplate reader. It should be noted that the cell viability was detected immediately after adding the kit to ensure the consistency of the experiments between groups as much as possible. By normalizing the relative viability evaluated by the intracellular ATP level and referring to the corresponding untreated control group, the viability of the cells after drug treatment could be obtained. The Graphpad software (version 8.4.3) was used to fit a non-linear regression model to obtain the IC50 value.

[0176] 1.3 Colony formation assay: Before conducting the experiment, CH22 cells with wild-type, knockdown, and overexpression of RAB3B were seeded in 6-well plates with or without treatment with rapamycin and dactolisib, with 2000 cells seeded in each well. All cells were cultured for 2 weeks, and after confirming colony formation under a microscope, they were washed 3 times with PBS to remove impurities in the cells or culture medium. Subsequently, they were fixed with 4% paraformaldehyde for 30 minutes, and finally stained with crystal violet for 12 hours. After confirming successful staining, they were rinsed three times with PBS to wash away non-specific binding areas and reduce the background color. Finally, the stained crystal violet was dissolved in 95% ethanol and diluted tenfold, with the whole action time being 10 minutes. Finally, the samples were detected at a wavelength of 570 nm on a microplate reader, and the results were counted and statistically analyzed.

[0177] 2. Results: In CH22 cells with wild-type RAB3B, the IC50 value of rapamycin was 65.21 nM; in CH22 cells with overexpression of RAB3B, the IC50 value decreased to 43.36 nM (p = 0.0021); while in CH22 cells with knockdown of RAB3B, the IC50 value increased to 83.89 nM (p = 0.0003) ( Figure 5 A and B). Further, in the MTT and colony formation proliferation ability detection experiments, it was found that rapamycin could significantly inhibit the proliferation of tumor cells in CH22 Flag-RAB3B and CH22 WT , but in CH22 shRAB3B , its inhibitory effect was not obvious ( Figure 5C-E). Also, similar to the trend of rapamycin, significant differences were observed in the inhibitory effect of dactolisib on the proliferation of CH22 cells under different RAB3B expression states. In RAB3B wild-type CH22 cells, the IC50 value of dactolisib was 65.49 nM; in RAB3B-overexpressing CH22 cells, its IC50 value decreased to 40.64 nM (p = 0.0003); while in RAB3B-knockdown CH22 cells, its IC50 value increased to 76.82 nM (p = 0.0005)( Figure 6 A and B). By performing colony formation and MTT proliferation ability assays on CH22 cells, it was found that when RAB3B was knocked down in chordoma cells, the anti-proliferative effect of dactolisib on the cells was significantly weakened, suggesting a decrease in its drug sensitivity. On the contrary, under the condition of high RAB3B expression, dactolisib showed a stronger inhibitory effect and a significant decrease in cell proliferation ability. The above results indicate that the expression level of RAB3B directly affects the responsiveness of chordoma cells to dactolisib treatment, further demonstrating the potential of RAB3B as an important biomarker for predicting the treatment response of mTORC1 inhibitors( Figure 6 C-E).

[0178] Example 6: Clinical application of the RAB3B / S6 axis in assessing the sensitivity of chordoma patients to mTORC1-targeted therapy response

[0179] 1. Materials and methods:

[0180] 1.1 Immunohistochemical analysis: To explore in depth the molecular markers and expression abundances in chordoma and control samples, this study conducted immunohistochemical analysis. To more comprehensively evaluate the potential value of RAB3B as a biomarker in predicting the response of chordoma patients to mTORC1 inhibitor treatment, this example retrospectively collected a number of advanced chordoma cases, and all these patients received targeted therapy. By analyzing the clinical data and treatment responses of these cases in detail, this example aimed to explore the correlation between the expression level of RAB3B and the treatment effect of patients. Since there are few clinical cases of using mTORC1 inhibitors for chordoma at present, only one case of an advanced clivus chordoma patient receiving targeted therapy was found in the retrospective analysis. To comprehensively understand the tumor molecular characteristics of this chordoma patient, multi-faceted tests were performed on its tumor samples. First, the key markers p-AKT and p-S6 in the PI3K-AKT-mTOR signaling pathway were detected (phospho-Akt(Ser473), Cell Signaling Technology, #4060; phospho-S6(Ser235 / 236), Cell Signaling Technology, #4858) to evaluate the activity of this signaling pathway. Next, common drug targets such as EGFR, VEGFR, PDGFR, and PD-L1 were detected (EGFR, Abcam, ab52894; VEGFR, Abcam, ab36844; PDGFR, Abcam, ab32570; PD-L1, Abcam, ab205921), and these molecules are often used to develop targeted treatment regimens. At the same time, the immune cell markers CD4 and CD8 were also detected (CD4, Abcam, ab133616; CD8, Abcam, 217344) to understand the immune status in the tumor microenvironment. Finally, the expression level of RAB3B (RAB3B / C, Proteintech, 15774-1-AP) was also detected. The antibodies used were all verified antibodies, which could ensure clear and specific labeling of the target. The cell nuclei were counterstained with hematoxylin (Vector Laboratories). The staining results of each section were independently evaluated by two experienced pathologists, which could ensure the objectivity and accuracy of the results. The evaluation mainly used the H-score system, and its calculation formula was: H-score = Σpi(i + 1).

[0181] 1.2 Magnetic Resonance Imaging: The method of analyzing patient data by magnetic resonance imaging mainly includes three steps: data acquisition, image reconstruction, and quantitative analysis. First, radiofrequency pulses and magnetic field gradients are applied to the patient's body through high-field magnetic resonance scanning to obtain raw signals; subsequently, these raw signals are reconstructed into high-resolution anatomical images using mathematical algorithms such as Fourier transform; finally, through image segmentation, feature extraction, and statistical analysis, the signal intensity, morphology, and functional parameters of different tissues in the image are quantitatively evaluated to accurately identify the lesion area.

[0182] 2. Results: In this example, it was found that both RAB3B and p-S6 (S235 / 236) were highly expressed and co-expressed in the patient sample, and at the same time, EGFR was also highly expressed ( Figure 7 A-J). After 5 months of continuous treatment, magnetic resonance imaging scans showed a significant reduction in the patient's tumor volume, which was consistent with the significant remission of the patient's clinical symptoms ( Figure 7 K). After comprehensively evaluating the patient's treatment effect according to the Response Evaluation Criteria in Solid Tumors Version 1.1 (RECIST 1.1), it was found that the patient's tumor significantly shrank during the treatment process, meeting the evaluation criteria for partial response (PR). In summary, the RAB3B / S6 axis can be used as a potential indicator to predict the response of chordoma patients to mTORC1 inhibitors.

[0183] The above embodiments are only illustrative of the principles and effects of this application and are not intended to limit this application. Any person familiar with this technology can modify or change the above embodiments without departing from the spirit and scope of this application. Therefore, all equivalent modifications or changes made by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed in this application should still be covered by the claims of this application.

Claims

1. Use of a RAB3B inhibitor in the preparation of a product selected from: 1) Products that reduce the phosphorylation level of S6 protein; 2) Products that regulate the PI3K-AKT-mTOR signaling pathway; 3) Products for preventing and / or treating chordoma.

2. The use according to claim 1, characterized in that The RAB3B inhibitor is selected from any one or more of the following: a) Small molecule inhibitors of RAB3B; b) RAB3B antibody or antigen-binding fragment thereof; c) a nucleic acid molecule that reduces the expression of RAB3B; d) Gene editing system to knock out or mutate the RAB3B gene; And / or, the product is selected from medicines and reagents.

3. The use according to claim 2, characterized in that: The nucleic acid molecule that reduces the expression of RAB3B is selected from any one or more combinations of antisense oligonucleotides, double-stranded RNA, short hairpin RNA, small interfering RNA, nucleic acid constructs, or nucleic acid compositions; preferably, the nucleic acid molecule that reduces the expression of RAB3B is a small interfering RNA or a short hairpin RNA; more preferably, the nucleotide sequence of the small interfering RNA is as shown in SEQ ID NO.1-2, or as shown in SEQ ID NO.3-4, or as shown in SEQ ID NO.5-6, and the targeting sequence of the short hairpin RNA is as shown in SEQ ID NO.

7.

4. The use according to claim 2, characterized in that: The gene editing system for knocking out or mutating the RAB3B gene comprises a guide RNA or a nucleic acid fragment encoding the guide RNA; preferably, the targeting sequence of the guide RNA is shown in SEQ ID NO.

8.

5. A RAB3B inhibitor, wherein the RAB3B inhibitor is selected from small interfering RNA, short hairpin RNA, or a gene editing system; the nucleotide sequence of the small interfering RNA is as shown in SEQ ID NO.1-2, or as shown in SEQ ID NO.3-4, or as shown in SEQ ID NO.5-6, the targeting sequence of the short hairpin RNA is as shown in SEQ ID NO.7, the gene editing system comprises a guide RNA or a nucleic acid fragment encoding the guide RNA, and the targeting sequence of the guide RNA is as shown in SEQ ID NO.

8.

6. A medicament comprising an effective amount of the RAB3B inhibitor for use according to any one of claims 1 to 4, or the RAB3B inhibitor according to claim 5.

7. Use of RAB3B and / or reagents for detecting RAB3B in the preparation of a chordoma prognosis product or a product for predicting treatment response.

8. The use according to claim 7, characterized in that The reagent for detecting RAB3B is a reagent for detecting the expression level of RAB3B; preferably, the reagent for detecting RAB3B is selected from a reagent required for detecting the expression level of RAB3B by immunohistochemistry, a reagent required for detecting the expression level of RAB3B by protein immunoblotting, or a reagent required for detecting the expression level of RAB3B by quantitative reverse transcription polymerase chain reaction; more preferably, the reagent for detecting the expression level of RAB3B is a reagent required for detecting the expression level of RAB3B by immunohistochemistry; And / or, the product is selected from one or more of a reagent, a kit, a test paper and a chip; And / or, the therapeutic response is a targeted therapy response; more preferably, the targeted therapy response is an mTORC1 targeted therapy response.

9. A device for prognosis or prediction of treatment response of chordoma, comprising: The data module is used to obtain the RAB3B expression level data of the sample; The analysis module is used to determine the prognosis or treatment response of chordoma patients based on the RAB3B expression level data of the sample.

10. A computer-readable storage medium comprising a computer program, characterized in that: The computer program is executed by a processor to perform a method comprising the following steps: Obtain RAB3B expression level data of the sample; based on the RAB3B expression level data of the sample, determine the prognosis or treatment response of the chordoma patient.

11. An electronic terminal comprising a memory and a processor, wherein the memory contains a computer program, characterized in that: The computer program is executed by a processor to perform a method comprising the following steps: Obtain RAB3B expression level data of the sample; based on the RAB3B expression level data of the sample, determine the prognosis or treatment response of the chordoma patient.

12. A computer program product, comprising a computer program, wherein when the computer program is executed by a processor, the method implements the following steps: Obtain RAB3B expression level data of the sample; based on the RAB3B expression level data of the sample, determine the prognosis or treatment response of the chordoma patient.

13. A method for prognosis or prediction of treatment response of chordoma for non-disease diagnosis and treatment purposes, comprising: Obtain the RAB3B expression level data of the sample; Based on the RAB3B expression level data of the samples, the prognosis or treatment response of chordoma patients is judged.

14. The device according to claim 9, or the computer-readable storage medium according to claim 10, or the electronic terminal according to claim 11, or the computer program product according to claim 12, or the method according to claim 13, characterized in that: The following method is used to judge the prognosis of chordoma patients: when the RAB3B expression level data is greater than or equal to the cutoff value, it is judged as a poor prognosis; when the RAB3B expression level data is less than the cutoff value, it is judged as a good prognosis.

Images