Polypeptide pka15 with immune regulation effect and application thereof

Abstract

The invention discloses a polypeptide pka15 with an immune regulation effect and application of the polypeptide pka15. The polypeptide pka15 provided by the invention has an immune regulation effect, can remarkably reduce the number of macrophages and neutrophils at an inflammation part, and can be used for preparing medicines for relieving and / or treating autoimmune diseases and allergic diseases caused by inflammation. Meanwhile, the polypeptide pka15 can obviously improve the symptoms of IBD, has the effect of improving digestive tract mucosa injury, and can be used for preparing a medicine for relieving and / or treating inflammatory bowel diseases and a medicine for protecting digestive tract mucosa and / or repairing injury; the polypeptide can be synthesized by a biological or chemical method, is easy to prepare in a large scale, can be prepared into polypeptide preparations, is convenient for subsequent clinical application and popularization, and has no toxic or side effect; as a polypeptide preparation, compared with existing glucocorticoid and non-steroidal immunomodulatory drugs, the polypeptide preparation is better in safety, low in drug cost and good in curative effect.

Description

Technical Field

[0001] The present invention relates to the technical field of polypeptides, and particularly relates to a polypeptide pka15 with immunomodulatory efficacy and its application. Background Art

[0002] The immune system plays a crucial role in maintaining life activities. It is mainly responsible for identifying and clearing foreign invaders (such as viruses, bacteria, and parasites) and diseased cells (such as cancer cells) in the body. Through a series of complex cellular and molecular mechanisms, the immune system can distinguish between "self" and "non-self" substances, thereby initiating appropriate immune responses to protect the body from infection and disease. However, when the immune function is too strong or dysregulated, it may lead to various diseases, such as autoimmune diseases and allergic reactions. In these cases, the immune system mistakenly attacks normal cells and tissues, causing inflammation and tissue damage. For example, in rheumatoid arthritis, the immune system attacks the joints, resulting in pain and dysfunction. Allergic reactions, such as asthma and allergic rhinitis, are excessive responses to substances (such as pollen) that should be harmless in the environment.

[0003] Inflammatory Bowel Disease (IBD) is a common immune-inflammatory disease characterized by chronic or recurrent intestinal inflammation. It mainly includes two types: Crohn's Disease (CD) and Ulcerative Colitis (UC). Crohn's disease can affect any part of the digestive tract, from the mouth to the anus; while ulcerative colitis mainly affects the colon and rectum. Since IBD usually does not cause death to patients, but there are still no drugs and methods for cure, IBD is also known as the "cancer that does not kill". IBD not only seriously affects the quality of life of patients, but also brings a significant economic burden. It is estimated that about 6.5 million people worldwide suffer from IBD, and the incidence is increasing. In industrialized countries, the treatment and management costs of IBD can reach billions of dollars annually.

[0004] To regulate the excessive immune response, common treatment methods include glucocorticoids and non-steroidal anti-inflammatory drugs. Although these methods have certain efficacy in relieving the symptoms of autoimmune and inflammatory diseases, they are often accompanied by obvious side effects and low drug safety. Glucocorticoids have powerful anti-inflammatory and immunosuppressive effects, but long-term use may lead to serious side effects, such as metabolic disorders, osteoporosis, immunosuppression, and endocrine disorders. Non-steroidal anti-inflammatory drugs can effectively relieve inflammation and pain, but may cause gastrointestinal discomfort, impaired renal function and other problems.

[0005] Polypeptides are molecules composed of short chains of amino acids and have various biological functions, including acting as hormones, neurotransmitters, and immunomodulators. In the pharmaceutical field, specific polypeptides can be designed to regulate the immune system, with the potential advantages of high selectivity and low toxicity. Compared with traditional drugs, polypeptide drugs are generally more selective because they can precisely target specific cell receptors or molecules, thereby reducing the risk of side effects. The rapid biodegradability of polypeptides also reduces the risk of long-term toxicity. In the field of immunomodulation, this selectivity and low toxicity make polypeptide drugs strong candidates for the development of new immunomodulatory treatment strategies. However, there are currently few effective polypeptide drugs for immune diseases, and there are still significant gaps in the research and development of polypeptide drugs in the field of immune disease treatment. The product lines with clinical value are relatively scarce, so it shows broad industrialization prospects and application value.

[0006] In view of this, the development of new polypeptide immunomodulatory drugs with high specificity and low side effect risk is of great significance for the treatment and / or diagnosis of immune diseases. Summary of the Invention

[0007] Aiming at the deficiencies of the prior art and the actual needs, the purpose of the present invention is to provide a polypeptide pka15 and its application. The polypeptide pka15 is composed of 15 amino acids, has an immunomodulatory effect, can significantly reduce the number of macrophages and neutrophils in the inflammatory site and inhibit the proliferation of macrophages, and at the same time can significantly improve the symptoms of IBD, has the effect of protecting the digestive tract mucosa or improving digestive tract mucosal damage, and can be used to prepare drugs for relieving and / or treating autoimmune diseases and allergic diseases caused by inflammation, such as drugs for relieving and / or treating inflammatory bowel disease and drugs for protecting and / or repairing digestive tract mucosal damage; and its preparation is simple, non-cytotoxic, and it is a polypeptide preparation, which is convenient for subsequent clinical application and promotion, with low drug cost and good curative effect.

[0008] To achieve the above purpose, the present invention provides the following technical solutions:

[0009] In the first aspect, the present invention provides a polypeptide pka15, which has:

[0010] (I) The amino acid sequence shown in SEQ ID NO: 1; or

[0011] (II) An amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 obtained by substituting, deleting, adding, and / or replacing 1 or 2 amino acids on the basis of the amino acid sequence shown in (I); the polypeptide having the amino acid sequence of (II) has the same biological function as the polypeptide pka15 having the amino acid sequence shown in SEQ ID NO: 1.

[0012] In a second aspect, the present invention provides a nucleic acid molecule encoding the polypeptide pka15.

[0013] In some embodiments of the present invention, the nucleic acid molecule has:

[0014] (I) a nucleotide sequence as shown in SEQ ID NO: 2; or

[0015] (II) a complementary nucleotide sequence of the nucleotide sequence as shown in SEQ ID NO: 2; or

[0016] (III) a nucleotide sequence encoding the same protein as the nucleotide sequence of (I) or (II), but different from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or

[0017] (IV) a nucleotide sequence having at least 90% sequence identity with the nucleotide sequence of (I), (II), or (III).

[0018] In a third aspect, the present invention provides a recombinant vector comprising the nucleic acid molecule encoding the polypeptide pka15.

[0019] In a fourth aspect, the present invention provides a host cell comprising the nucleic acid molecule encoding the polypeptide pka15 or the recombinant vector.

[0020] In some embodiments of the present invention, the host cell is a prokaryotic system host cell.

[0021] In some embodiments of the present invention, the prokaryotic system host cell is Escherichia coli.

[0022] In a fifth aspect, the present invention provides a fusion protein having a protein tag linked to the N-terminus and / or C-terminus of the polypeptide pka15 and having the same biological function as the polypeptide pka15.

[0023] In a sixth aspect, the present invention provides the use of the polypeptide pka15, nucleic acid molecule, recombinant vector, or host cell in the preparation of an immunomodulatory preparation, which is a drug for relieving and / or treating autoimmune diseases and allergic diseases caused by inflammation.

[0024] In some embodiments of the present invention, the autoimmune diseases and / or allergic diseases include IBD, psoriasis, dermatitis, etc.;

[0025] In some embodiments of the present invention, the preparation for relieving and / or treating autoimmune diseases and allergic diseases caused by inflammation includes drugs that reduce the number of macrophages and neutrophils at the inflammatory site and inhibit the proliferation of macrophages.

[0026] In a seventh aspect, the present invention provides the use of the polypeptide pka15, nucleic acid molecule, recombinant vector, host cell, and fusion protein in the preparation of a drug for relieving and / or treating inflammatory bowel disease and a drug for protecting the digestive tract mucosa and / or repairing damage, which increases the number of goblet cells in the mucosal damage area, reduces the intestinal lumen area, and improves the intestinal tissue pathological characteristics.

[0027] In an eighth aspect, the present invention provides a pharmaceutical composition comprising the polypeptide pka15, nucleic acid molecule, recombinant vector, or host cell as described above, and a pharmaceutically acceptable carrier and / or excipient.

[0028] In a ninth aspect, the present invention provides a medical device comprising the polypeptide pka15 and an acceptable carrier.

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention conducts in-depth exploration and screens to obtain the novel polypeptide pka15. Through experiments, it is found that it can significantly reduce the number of macrophages and neutrophils at the inflammatory site and inhibit the proliferation of macrophages; at the same time, it can also significantly improve the symptoms of IBD, has the effect of protecting the digestive tract mucosa or improving digestive tract mucosal damage, and can be used in the preparation of drugs for relieving and / or treating autoimmune diseases and / or allergic diseases caused by inflammation, such as drugs for relieving and / or treating inflammatory bowel disease and drugs for protecting the digestive tract mucosa and / or repairing damage.

[0031] The polypeptide pka15 of the present invention can be synthesized by genetic engineering techniques or by chemical methods such as solid-phase synthesis. It is easy to prepare in large quantities, its synthesis is simple and can be prepared into polypeptide preparations, which is convenient for subsequent clinical application and promotion, has no toxic side effects, has significant effects, and good stability; as a polypeptide preparation, it has better safety compared with glucocorticoid and non-steroidal immunomodulatory drugs, and has lower drug costs and better efficacy.

[0032] In addition, the polypeptide pka15 provided by the present invention can also be used as a reagent for immunological research, providing a model for better understanding the mechanism of immune regulation and a new idea for exploring immunomodulatory drugs with high specificity and low side effect risk for the treatment and / or diagnosis of immune diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The drawings described herein are used to provide a further understanding of the present application, form a part of the present application, and the illustrative embodiments and descriptions thereof of the present application are used to explain the present application, and do not constitute a limitation to the present application.

[0034] In the drawings:

[0035] Figure 1 Mass spectrometry analysis charts of polypeptide pka15 (15aa polypeptide) and amidated polypeptide pka15 (15aa polypeptide - amidated).

[0036] Figure 2 HPLC purity analysis charts of polypeptide pka15 (15aa polypeptide) and amidated polypeptide pka15 (15aa polypeptide - amidated).

[0037] Figure 3 Fluorescence microscopy images of neutrophils in zebrafish yolk sac after treatment with samples of polypeptide pka15 (15aa polypeptide) and amidated polypeptide pka15 (15aa polypeptide - amidated).

[0038] Figure 4 Column analysis chart of the effect of samples of polypeptide pka15 (15aa polypeptide) and amidated polypeptide pka15 (15aa polypeptide - amidated) on the number of neutrophils in zebrafish yolk sac.

[0039] Figure 5 Fluorescence microscopy images of macrophages in zebrafish yolk sac after treatment with samples of polypeptide pka15 (15aa polypeptide) and amidated polypeptide pka15 (15aa polypeptide - amidated).

[0040] Figure 6 Column analysis chart of the effect of samples of polypeptide pka15 (15aa polypeptide) and amidated polypeptide pka15 (15aa polypeptide - amidated) on the number of macrophages in zebrafish yolk sac.

[0041] Figure 7 Evaluation chart of the effect of samples of polypeptide pka15 (15aa polypeptide) and amidated polypeptide pka15 (15aa polypeptide - amidated) on inhibiting the proliferation of RAW264.7 cells.

[0042] Figure 8 Column analysis chart of the intestinal lumen area of zebrafish after sample treatment;

[0043] Figure 9 Column analysis chart of the number of goblet cells in the zebrafish intestine after sample treatment;

[0044] Figure 10 Column analysis chart of the number of neutrophils in the zebrafish intestine after sample treatment;

[0045] Figure 11 Typical chart of zebrafish intestinal tissue pathological sections after sample treatment.

[0046] It should be noted that these drawings and textual descriptions are not intended to limit the scope of the concept of the present invention in any way, but to illustrate the concept of the present invention to those skilled in the art through specific embodiments. Detailed Embodiments

[0047] In order to more clearly illustrate the overall concept of the present application, the following provides a detailed description by way of examples in conjunction with the drawings of the specification. In the following description, numerous specific details are given to provide a more thorough understanding of the present invention. However, it will be apparent to those skilled in the art that the present invention may be practiced without one or more of these details. In other instances, some well-known technical features are not described to avoid obscuring the present invention.

[0048] In the present invention, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art.

[0049] Unless otherwise indicated, the practice of the present invention will employ conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the capabilities of those skilled in the art. Such techniques are well explained in the literature, such as "Molecular Cloning: A Laboratory Manual", 2nd Edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (ed. M.J. Gait, 1984); "Animal Cell Culture" (ed. R.I. Freshney, 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology" (ed. D.M. Weir and C.C. Blackwell); "Gene Transfer Vectors for Mammalian Cells" (ed. J.M. Miller and M.P. Calos, 1987); "Current Protocols in Molecular Biology" (ed. F.M. Ausubel et al., 1987); "PCR: The Polymerase Chain Reaction" (ed. Mullis et al., 1994); and "Current Protocols in Immunology" (ed. J.E. Coligan et al., 1991), each of which is hereby expressly incorporated by reference.

[0050] Where specific techniques or conditions are not indicated in the examples, the conventional techniques or conditions described in the literature within the art or according to the product specifications are followed.

[0051] Unless otherwise specified, in the following embodiments, reagents or instruments for which the manufacturer is not indicated are all conventional products that can be obtained commercially through regular channels.

[0052] In the first aspect of the present invention, a novel polypeptide pka15 with immunomodulatory efficacy is provided. The polypeptide is composed of 15 amino acids, so it is named pka15, and its amino acid sequence is shown in SEQ ID NO: 1, which is: N-terminal-LYILEEEEENTKRKD-C-terminal. In the present invention, the C-terminal and / or N-terminal of the polypeptide pka15 preferably also has an amide modification, specifically: LYILEEEEENTKRKD-NH2; the amide modification is used to ensure the stability of the polypeptide and does not affect the activity of the polypeptide.

[0053] The present invention also includes fragments, derivatives and analogs of polypeptide pka15. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to polypeptides that substantially retain the same biological function or activity as polypeptide pka15 of the present invention. A fragment, derivative or analog of polypeptide pka15 may be:

[0054] (1) a polypeptide having 1 or 2 conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, wherein the substituted amino acid residues may or may not be encoded by the genetic code, or

[0055] (2) a polypeptide having a substitution group in one or more amino acid residues, or

[0056] (3) a polypeptide formed by fusion of a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or

[0057] (4) A polypeptide formed by fusion of an additional amino acid sequence to the polypeptide sequence (such as a leader sequence or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein). According to the definition of the present invention, these fragments, derivatives and analogs fall within the scope known to those skilled in the art.

[0058] In the present invention, polypeptide pka15 may refer to a polypeptide having a sequence as shown in SEQ ID NO: 1. The term also includes polypeptides having the same function as polypeptide pka15 with one or more amino acids added to the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids having similar or similar properties generally does not change the function of the protein. For another example, adding one or more amino acids to the C-terminus and / or N-terminus generally does not change the function of the protein. The term also includes active fragments and active derivatives of polypeptide pka15.

[0059] In the present invention, it also includes a modified form of polypeptide formed by modifying one or several amino acids to increase the stability, half-life, and promote the efficacy of the polypeptide (usually without changing the primary structure), including: chemical derivative forms of the polypeptide in vivo or in vitro, such as amidation or carboxylation. The modification also includes glycosylation. The modified form also includes a sequence having phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, phosphothreonine). It also includes polypeptides that are modified to improve the anti-hydrolysis performance or optimize the solubility performance.

[0060] The polypeptide of the present invention can also form a complex with other functional molecules, and the complex includes: the polypeptide described in the present invention, and a functional molecule connected to the polypeptide.

[0061] In some embodiments, the functional molecule is a marker with a tracing function, including but not limited to fluorescent dyes, MRI contrast agents, radioactive imaging agents, magnetic particles, or chemical reagents with a coloring function. For example, the marker or functional small molecule with a tracing function can be fluorescein isothiocyanate (FITC).

[0062] In some embodiments, the functional molecule is a functional small molecule, including inorganic small molecules and organic small molecules, with a molecular weight less than 1000 daltons.

[0063] In some embodiments, the functional molecule is a functional macromolecule, such as a functional polypeptide (such as an antibody), a functional nucleic acid; preferably, the functional nucleic acid includes but not limited to: plasmid, siRNA, DNA, oligonucleotide, miRNA, antisense nucleic acid, etc.

[0064] In the second aspect of the present invention, there is provided a nucleic acid molecule encoding the polypeptide pka15, and its nucleotide sequence is as shown in SEQ ID NO: 2, which is:

[0065] CTGTACATCCTGGAAGAAGAAGAAGAAAACACCAAACGTAAAGAC.

[0066] In the third aspect of the present invention, there is provided a recombinant vector, which contains the above nucleic acid molecule. The vector of the present invention can be a cloning vector or an expression vector. In certain embodiments, the vector of the present invention is, for example, a plasmid, a cosmid, a phage, a cosmid, etc.

[0067] In the fourth aspect of the present invention, there is provided a host cell, which contains the above nucleic acid molecule or recombinant vector. Such host cells include but not limited to prokaryotic cells such as Escherichia coli cells, and eukaryotic cells such as yeast cells, insect cells (such as Sf9 cells), plant cells, and animal cells (such as mammalian cells, such as mouse cells, human cells, etc.).

[0068] In the fifth aspect of the present invention, a method for preparing the polypeptide pka15 is provided, including chemical synthesis and synthesis by genetic engineering methods. Under conditions allowing the expression of the polypeptide pka15, the host cells of the present invention are cultured, and the polypeptide or its variant is recovered from the cultured host cell culture.

[0069] In the sixth aspect of the present invention, the application of the polypeptide pka15, nucleic acid molecule, recombinant vector or host cell in the preparation of immunomodulatory drugs is provided, and the immunomodulatory drugs are used to relieve and / or treat autoimmune diseases and allergic diseases caused by inflammation.

[0070] The main contribution of the present invention lies not only in obtaining the polypeptide pka15, but also in verifying the function of this polypeptide.

[0071] In some specific embodiments of the present invention, it is determined that the polypeptide pka15 can significantly reduce the number of macrophages and neutrophils at the inflammatory site, and can significantly inhibit the proliferation of macrophages, having an anti-inflammatory effect.

[0072] In some other specific embodiments of the present invention, the exogenously synthesized polypeptide pka15 can reduce the intestinal lumen area, reduce the number of intestinal neutrophils, and increase the number of intestinal goblet cells. In addition, the intestinal tissue pathological sections of the zebrafish gastrointestinal mucosal injury model show that the treatment with the polypeptide pka15 can improve intestinal dilation and increase the number of intestinal folds and the number of long villi. In summary, the polypeptide pka15 of the present invention can significantly improve the intestinal tissue pathological characteristics of the IBD model, effectively relieve and / or treat IBD, and has the effect of protecting or repairing the digestive tract mucosa.

[0073] The above research results show that the polypeptide pka15 can be used to prepare drugs for autoimmune diseases and / or allergic diseases, or to prepare drugs for reducing the number of macrophages and neutrophils at the inflammatory site and inhibiting the proliferation of macrophages. In some specific embodiments, the autoimmune disease is inflammatory bowel disease.

[0074] In the seventh aspect of the present invention, a pharmaceutical composition for immunomodulation is provided, which comprises the polypeptide pka15 (or its variant), nucleic acid molecule, recombinant vector or host cell of the present invention, and a pharmaceutically acceptable carrier and / or excipient.

[0075] In addition, the present invention also provides a medical device comprising the polypeptide pka15 and an acceptable carrier.

[0076] The polypeptide (or its variant) or pharmaceutical composition of the present invention can be formulated into any dosage form known in the medical field, for example, in the form of tablets, pills, suspensions, emulsions, solutions, gels, capsules, powders, granules, elixirs, lozenges, suppositories, injections (including injection solutions, lyophilized powders), etc. In some embodiments, the polypeptide (or its variant) or pharmaceutical composition of the present invention can be formulated into an injection solution or a lyophilized powder.

[0077] In addition, the polypeptide or its variant of the present invention can be present in the pharmaceutical composition in unit dosage form for ease of administration.

[0078] The polypeptide or its variant or pharmaceutical composition of the present invention can be administered by any suitable method known in the art, including but not limited to oral, buccal, sublingual, ocular, topical, parenteral, rectal, intrathecal, intracisternal, inguinal, intravesical, local (such as powders, ointments or drops), or nasal routes. However, for many therapeutic uses, the preferred route / way of administration is parenteral administration (such as intravenous injection, subcutaneous injection, intraperitoneal injection, intramuscular injection). Those skilled in the art should understand that the route and / or way of administration will vary according to the intended purpose. In a preferred embodiment, the polypeptide (or its variant) or pharmaceutical composition of the present invention is administered by intravenous infusion or injection.

[0079] The polypeptide (or its variant) or pharmaceutical composition provided by the present invention can be used alone or in combination, and can also be used in combination with another pharmaceutically active agent (such as an immunomodulator). Such another pharmaceutically active agent can be administered before, simultaneously or after the administration of the polypeptide (or its variant) or pharmaceutical composition of the present invention.

[0080] As used herein, "pharmaceutically acceptable carrier and / or excipient" refers to a carrier and / or excipient that is pharmacologically and / or physiologically compatible with the subject and the active ingredient, which is well known in the art (see, e.g., Remington's Pharmaceutical Sciences. Edited by Gennaro AR, 19th ed. Pennsylvania: Mack Publishing Company, 1995), and includes but is not limited to: pH regulators, surfactants, ionic strength enhancers, osmotic pressure maintaining reagents, absorption delaying reagents, diluents, adjuvants, preservatives, stabilizers, etc. For example, pH regulators include but are not limited to phosphate buffer. Surfactants include but are not limited to cationic, anionic or non-ionic surfactants, such as Tween-80. Ionic strength enhancers include but are not limited to sodium chloride. Osmotic pressure maintaining reagents include but are not limited to sugars, NaCl and its analogs. Absorption delaying reagents include but are not limited to monostearate and gelatin. Diluents include but are not limited to water, aqueous buffer (such as buffered saline), alcohols and polyols (such as glycerol), etc. Adjuvants include but are not limited to aluminum adjuvants (such as aluminum hydroxide), Freund's adjuvants (such as complete Freund's adjuvant), etc. Preservatives include but are not limited to various antibacterial and antifungal reagents, such as thimerosal, 2-phenoxyethanol, parabens, chlorobutanol, phenol, sorbic acid, etc. Stabilizers have the meaning commonly understood by those skilled in the art, and can stabilize the desired activity of the active ingredient in the drug (such as the inhibitory activity against PSD-95 ubiquitination), including but not limited to sodium glutamate, gelatin, SPGA, saccharides (such as sorbitol, mannitol, starch, sucrose, lactose, dextran, or glucose), amino acids (such as glutamic acid, glycine), proteins (such as dried whey, albumin or casein) or their degradation products (such as lactalbumin hydrolysate), etc.

[0081] In use, a safe and effective amount of the polypeptide or polynucleotide encoding the same, or an expression vector containing the polynucleotide or a recombinant cell expressing the polypeptide of the present invention is administered to an animal body (such as a human, a mouse, a zebrafish, etc.), wherein the safe and effective amount is usually at least about 1 gram per kilogram body weight. Of course, the specific dose should also consider factors such as the administration route and the health condition of the patient, which are within the scope of the skills of a skilled physician.

[0082] The precise effective amount for a particular subject depends on the size and health of the subject, the nature and degree of the disorder, and the therapeutic agent and / or combination of therapeutic agents selected for administration. For a given condition, the effective amount can be determined by routine experimentation and can be judged by a clinician.

[0083] The inventor of the present invention has first discovered polypeptide pka15, and its preparation can be carried out according to any relevant techniques well-known in the art, such as synthesizing by solid / liquid phase synthesis method or expressing and then purifying the protein by genetic recombination using genetic engineering techniques.

[0084] The following further elaborates the present invention in combination with specific embodiments, but the embodiments do not limit the present invention in any form.

[0085] Example 1 Biosynthesis of polypeptide pka15

[0086] Construction of recombinant vector

[0087] Synthesize the DNA sequence shown in SEQ ID NO: 2, introduce the NcoI restriction enzyme cleavage site sequence CCATGG and enterokinase cleavage site sequence DDDDK at the 5' end of the synthesized sequence, and introduce the stop codon TAA and BamHI restriction enzyme cleavage site sequence GGATCC at the 3' end of the sequence.

[0088] Use two restriction endonucleases, BamHI and NcoI, to digest the synthesized DNA sequence, and the digestion method is carried out according to the instruction manual of the restriction endonuclease. After digestion, perform agarose gel electrophoresis and cut and recover the band of the target size.

[0089] Use two restriction endonucleases, BamHI and NcoI, to digest the pET-28a(+) vector, and the digestion method is carried out according to the instruction manual of the restriction endonuclease. After digestion, perform agarose gel electrophoresis and cut and recover the band of the target size.

[0090] Use T4 DNA ligase to ligate the vector recovered after digestion with the DNA fragment. The ligation method is carried out with reference to the instruction manual of T4 DNA ligase.

[0091] Transform the ligated product into Escherichia coli competent cell DH5α to obtain monoclonal strains. Use primers pka15F: GTAGAGGATCGAGATCTCGAT and pka15R: AAGGGT TATGCTAGTTATTGC to perform colony PCR verification on the monoclonal strains.

[0092] Cultivate the strains with positive colony PCR verification in LB liquid medium containing kanamycin, and then extract the plasmid. The plasmid extraction method is carried out with reference to the instruction manual of the plasmid extraction kit.

[0093] Sequentially verify the extracted plasmid using primer pka15F. If the verification is correct, the pET-28a-pka15 recombinant plasmid is obtained. After measuring the concentration of the plasmid using an ultra-micro ultraviolet spectrophotometer, store it in a -80°C refrigerator.

[0094] Construction of Host Cells

[0095] The recombinant plasmid pET-28a-pka15 was transformed into the host cell Escherichia coli Rosetta(DE3) strain by the CaCl2 chemical transformation method. The transformation method was carried out with reference to "Molecular Cloning: A Laboratory Manual" to obtain monoclonal strains.

[0096] The monoclonal strains were verified by colony PCR using the primers pka15F: GTAGAGGATCGAGATCTCGAT and pka15R: AAGGGGTTATGCTAGTTATTGC. If the verification was correct, the host strain containing the pET-28a-pka15 recombinant plasmid was obtained.

[0097] The host strain containing the pET-28a-pka15 recombinant plasmid was cultured in LB liquid medium containing kanamycin, then sterile glycerol (final concentration 15%) was added. After mixing, it was aliquoted into cryotubes, labeled, and stored in a -80°C refrigerator.

[0098] The pka15 gene fragment with restriction enzyme site sequences at both ends was amplified by PCR using upstream and downstream primers containing restriction enzyme site sequences. The pka15 gene fragment and the pET-28a vector were respectively digested with restriction enzymes, and then the digested fragments were recovered. The vector and the gene fragment were ligated using T4 DNA ligase and transformed into Escherichia coli for positive clone screening. After verifying the plasmid sequencing of the positive clone single colonies, the pka15 gene was constructed into the pET-28a plasmid to obtain the first recombinant vector. The first recombinant vector was the pET-28a plasmid containing the pka15 gene, hereinafter referred to as pET-28a-pka15; the host cells used in each example and comparative example of this application were Escherichia coli.

[0099] a. Transform pET-28a-pka15 into Escherichia coli (such as competent cell E.coli DH5α); pick monoclonal colonies of pET-28a-pka15 or strains stored at -80°C and inoculate them into a small test tube containing 5 mL of LB liquid medium (Kan+, 100 μg / mL), and culture overnight at 37°C and 220 rpm as the seed solution.

[0100] b. Transfer the seed solution into 50 mL of LB liquid medium (Kan+, 100 μg / mL), and culture it again at 37°C and 220 rpm on a shaker for activation.

[0101] c. Transfer the re-activated bacterial liquid into 800 mL of 2YT liquid medium (Kan+, 100 μg / mL) at an inoculation amount of 1%, and culture it in a shaker at 37 °C and 220 rpm until the OD600 is about 0.6 - 0.8.

[0102] d. Lower the shaker temperature to 16 °C - 18 °C. After the temperature of the cultured bacterial liquid decreases, add Isopropylthio-β-D-galactoside (IPTG) to a final concentration of 0.5 mM and induce expression for 14 - 16 h.

[0103] e. After the expression is completed, collect the above cultured bacterial liquid into a bottle, pre-cool the centrifuge to 4 °C, centrifuge at 5500 rpm for 10 min.

[0104] f. Remove the supernatant, add 30 mL of protein purification buffer, and resuspend the bacterial cells with a vortex oscillator.

[0105] g. Centrifuge the resuspended bacterial cells again at 5500 rpm for 10 min. Pour out the supernatant, add 30 mL of protein purification buffer, resuspend the bacterial cells with a vortex oscillator (no solid particles), pour them into a 50 mL centrifuge tube, and store them in a -80 °C refrigerator.

[0106] Purification of polypeptide pka15

[0107] a. Preparation of crude enzyme solution: Add 1.0 g of wet bacterial cells collected to 20 mL of equilibration buffer for resuspension, and use a cell disruptor to disrupt the resuspended cells. The parameters of the cell disruptor are set to 300 W to prevent the influence of excessive temperature on enzyme activity. The disruption program is set to work for 1 s and pause for 3 s. At the same time, the disruption solution needs to be cooled with an ice-water mixture all the time. Stop the disruption when the suspension becomes clear and transparent. Centrifuge the disruption solution at 4 °C and 12,000 rpm for 10 min, collect the supernatant, and filter it through a 0.22 μm filter membrane to obtain the crude enzyme solution. All proteins used in this study have no tags, and the predicted isoelectric point of the protein is PI = 6.35. Therefore, a weakly basic anion group is selected for purification.

[0108] b. Regeneration and equilibration of ion exchange chromatography column: Use a DEAE Sepharose Fast Flow anion exchange column for protein purification. Rinse it with a buffer solution with a high salt concentration (containing 1 - 2 M NaCl) at a flow rate of 1 mL / min for 3 - 5 column volumes, then rinse it with 0.1 M NaOH for 3 - 5 column volumes, then rinse it with the elution buffer for 3 - 5 column volumes, and then rinse it with the equilibration solution until the parameters such as OD280, conductivity, and pH value of the detector are stable.

[0109] c. Loading and elution of crude enzyme solution: Load the prepared crude enzyme solution at a loading rate of 0.5 mL / min, with a loading volume of 20 mL. After loading, rinse with the equilibration buffer for 3 - 5 column volumes, then elute using an increasing salt concentration gradient with the elution buffer, collect each fraction, and confirm with protein electrophoresis. If the purification effect is not good, this step can be repeated, or use Sephadex G75 FF for further purification.

[0110] d. Protein concentration: Concentrate the target protein collected by ultrafiltration membrane concentration method, use a 1 kDa protein concentration tube for concentration, centrifuge at 4°C and 5000 rpm for 30 min.

[0111] e. Protein desalting: Add an appropriate amount of PBS buffer (20 mM, pH 7.0) to dilute the concentrated protein, and place it in a dialysis bag (molecular weight cut-off 8 - 14 kDa), use 20 mM, pH 7.0 PBS dialysis solution, and let it stand overnight in a 4°C refrigerator, and change the dialysis solution once in the middle.

[0112] f. Storage of ion exchange chromatography column: After use, rinse the ion exchange chromatography column with 1 M NaOH for 3 - 5 column volumes, and then rinse with 20% ethanol, and store it in a 4°C refrigerator.

[0113] Electrophoresis analysis of polypeptide pka15

[0114] a. Treatment of protein sample: Add the purified protein solution and 5× loading buffer in a ratio of 1:4 (v / v), heat in boiling water for 10 min, and set aside after completion.

[0115] b. Loading and electrophoresis: Place the precast protein gel (Genscript, SurePAGE, 4% - 20%) in the electrophoresis tank, and add the protein sample and Marker to the protein gel loading wells using a pipette.

[0116] c. Staining and decolorization: Remove the outer shell of the precast gel after electrophoresis, and automatically decolorize and stain it using a protein staining and decolorization instrument, with the staining time set to 15 min.

[0117] d. Analysis of protein gel image: Take a photo and save the stained and decolorized protein gel using a gel imager.

[0118] Example 2 Chemical synthesis of polypeptide pka15

[0119] This example uses the solid-phase peptide synthesis (SPPS) method to produce polypeptide pka15. SPPS couples amino acids to a resin in sequence to form a peptide chain. After the sequence synthesis is completed, the N-terminal Fmoc protecting group is first deprotected (or after the N-terminal modification is completed), and then the side-chain protecting groups are deprotected, and the peptide segment is cleaved from the resin:

[0120] 1) Coupling the first amino acid: Take an appropriate amount of modified resin, add the previously prepared amino acid solution and coupling reagent to the resin, and react for a period of time;

[0121] 2) Removal of Fmoc: After adding the Pip / DMF solution for a period of time, vacuum filter to remove the solvent;

[0122] 3) Washing: Add DMF (washing step) to the resin, and vacuum filter to remove the solvent;

[0123] 4) Resin detection: Put the detection reagents A and B and a little resin into a test tube. Then put the test tube into a metal bath for a few seconds, and check whether the color of the resin has changed. If the color of the resin changes, the Fmoc group has been successfully deprotected;

[0124] 5) Amino acid condensation: Add the previously prepared amino acid solution to the resin. Then add the coupling reagent, shake well for a period of time, and vacuum filter to remove the solvent;

[0125] 6) Repeat steps 2-5 until the synthesis of the last amino acid is completed.

[0126] This example uses a conventional solid-phase peptide synthesis method to synthesize a polypeptide according to the amino acid sequence of SEQ ID NO:2, and analyzes the correctness and purity of the obtained polypeptide by mass spectrometry detection and HPLC detection. The results are as follows Figure 1 and 2 shown. Mass spectrometry analysis confirmed the correct amino acids, and the molecular weight of the obtained polypeptide pka15 was 1909.0( Figure 1 a), and the molecular weight of the obtained amidated polypeptide pka15 was 1907.8( Figure 1 b); the purity of the obtained polypeptide pka15 detected by HPLC was 95.04%( Figure 2 a), and the purity of the obtained amidated polypeptide pka15 was 98.05%.

[0127] Effect of polypeptide pka15 and amidated polypeptide pka15 on bacterial inflammation in Example 3

[0128] 1. Detection materials

[0129] 1.1. Sample preparation information

[0130] Polypeptide pka15 was prepared into a stock solution of 2.00 mg / mL with PBS buffer and stored at 4°C.

[0131] The amidated modified polypeptide pka15 was prepared into a stock solution of 2.00 mg / mL with PBS buffer and stored at 4°C.

[0132] Positive control: Dexamethasone acetate, batch number B1828095, Shanghai Aladdin Biochemical Technology Co., Ltd., stored in a cool and dry place. It was prepared into a stock solution of 20.0 mg / mL with DMSO and stored at -20°C.

[0133] 1.2. Experimental animals

[0134] Zebra fish species (Water quality: 200 mg of instant sea salt was added to every 1 L of reverse osmosis water, with a conductivity of 450 - 550 μS / cm; pH of 6.5 - 8.5; hardness of 50 - 100 mg / L CaCO3), provided by the breeding center of Huante Biotechnology. The experimental animal use license number is: SYXK(Zhe)2022 - 0004. The feeding management complies with the requirements of international AAALAC certification (certification number: 001458), and the IACUC ethical review number is: IACUC - 2024 - 7634 - 01.

[0135] Transgenic neutrophil green fluorescent zebra fish (MPX), purchased from the breeding center of Huante Biotechnology. The neutrophils of this strain show green fluorescence under a fluorescence microscope and are used for the observation and quantification of cell behavior. They are bred by natural pair mating. Zebra fish at 3 days post-fertilization (3dpf) are used for the evaluation of the anti-bacterial inflammation (neutrophil) efficacy of the samples.

[0136] Transgenic macrophage green fluorescent zebra fish, purchased from the breeding center of Huante Biotechnology. The macrophages of this strain show green fluorescence under a fluorescence microscope and are used for the observation and quantification of cell behavior. They are bred by natural pair mating. Zebra fish at 3dpf are used for the evaluation of the anti-bacterial inflammation (macrophage) efficacy of the samples.

[0137] 1.3. Instruments, consumables and reagents

[0138] Dissecting microscope (SZX7, OLYMPUS, Japan); Microinjector (IM300, Narishige, Japan); Needle puller (PC - 10, Narishige, Japan); Precision electronic balance (CP214, OHAUS, USA); CCD camera (VertA1, Shanghai Tusen Vision Technology Co., Ltd., China); Motorized focusing continuous zoom fluorescence microscope (AZ100, Nikon, Japan); 6-well plate (Zhejiang Beilanbo Biotechnology Co., Ltd., China).

[0139] Dimethyl sulfoxide (DMSO, batch number BCCD8942, Sigma, Switzerland); LPS (batch number 127M4030V, Sigma, Israel); PBS phosphate buffer (product number BL601A, biosharp, China); methyl cellulose (batch number C2004046, Shanghai Aladdin Biochemical Technology Co., Ltd., China).

[0140] 2. Detection methods

[0141] 2.1. Evaluation of the efficacy against bacterial inflammation (neutrophils)

[0142] Randomly select 3 dpf transgenic neutrophil green fluorescent zebrafish (MPX) into 6-well plates, with 30 tails in each well (experimental group). Intravenous injection of the sample (dose shown in Table 1), positive control dexamethasone acetate at doses of 10.0, 20.0, and 40.0 ng / tail. At the same time, set up a normal control group and a model control group, with a volume of 3 mL per well. After 1 h of sample pretreatment, except for the normal control group, LPS was injected into the yolk sac of the remaining experimental groups to establish a zebrafish bacterial inflammation model. After treatment at 28 °C for 2 h, randomly select 10 zebrafish from each experimental group and place them under a fluorescence microscope for photographing. Use NIS-Elements D 3.20 advanced image processing software to analyze and collect data, and analyze the number of neutrophils in the zebrafish yolk sac. Evaluate the efficacy of the sample against bacterial inflammation based on the statistical analysis results of this index. The statistical processing results are expressed as mean ± SE. Use SPSS 26.0 software for statistical analysis, and p < 0.05 indicates that the difference is statistically significant.

[0143] 2.2. Evaluation of the efficacy against bacterial inflammation (macrophages)

[0144] Randomly select 3 dpf transgenic macrophage green fluorescent zebrafish into 6-well plates, with 30 tails in each well (experimental group). Intravenous injection of the sample (dose shown in Table 2), positive control dexamethasone acetate at doses of 10.0, 20.0, and 40.0 ng / tail. At the same time, set up a normal control group and a model control group, with a volume of 3 mL per well. After 1 h of sample pretreatment, except for the normal control group, LPS was injected into the yolk sac of the remaining experimental groups to establish a zebrafish bacterial inflammation model. After treatment at 28 °C for 2 h, randomly select 10 zebrafish from each experimental group and place them under a fluorescence microscope for photographing. Use NIS-Elements D 3.20 advanced image processing software to analyze and collect data, and analyze the fluorescence intensity of macrophages in the zebrafish yolk sac. Evaluate the efficacy of the sample against bacterial inflammation based on the statistical analysis results of this index. The statistical processing results are expressed as mean ± SE. Use SPSS 26.0 software for statistical analysis, and p < 0.05 indicates that the difference is statistically significant.

[0145] 3. Detection Results

[0146] 3.1. Evaluation of the Efficacy against Bacterial Inflammation (Neutrophils)

[0147] Figure 3 and 4 respectively show the fluorescence microscopic images of neutrophils in the yolk sac of zebrafish eggs after treatment with polypeptide pka15 (polypeptide 15aa) and amidated polypeptide pka15 (polypeptide 15aa-amidated), and the column analysis chart of the effect of this treatment on the number of neutrophils in the yolk sac of zebrafish eggs. In Figure 3 the yellow dotted box is the analysis site, and the green fluorescent dots are neutrophils. Under the experimental conditions, the number of neutrophils in the yolk sac decreased significantly, specifically manifested as a significant decrease in the fluorescence intensity of macrophages in the yolk sac. Thus, both polypeptide pka15 and amidated polypeptide pka15 reduced the number of neutrophils at the inflammatory site and had the efficacy against bacterial inflammation. There was no statistical difference in the efficacy against bacterial inflammation between amidated polypeptide pka15 and polypeptide pka15 at the doses of 10.0, 20.0, and 40.0 ng / fish. See Table 1 and Figure 4 .

[0148] Table 1. Experimental Results of the Evaluation of the Efficacy of Samples against Bacterial Inflammation (Neutrophils) (n = 10)

[0149]

[0150]

[0151] Compared with the model control group, *p < 0.05, **p < 0.01, ***p < 0.001

[0152] Figure 4 shows the number of neutrophils in the yolk sac of zebrafish eggs after treatment with the samples, where polypeptide 15aa represents pka15; compared with the model control group, *p < 0.05, **p < 0.01, ***p < 0.001.

[0153] 3.2. Evaluation of the Efficacy against Bacterial Inflammation (Macrophages)

[0154] Figure 5 and 6 respectively show the fluorescence microscopic images of macrophages in the yolk sac of zebrafish eggs after treatment with polypeptide pka15 (polypeptide 15aa) and amidated polypeptide pka15 (polypeptide 15aa-amidated), and the column analysis chart of the effect of this treatment on the number of macrophages in the yolk sac of zebrafish eggs. In Figure 5Among them, the yellow dotted line box is the analysis part, and the green fluorescent dots are neutrophils. Under the experimental conditions, the number of yolk sac macrophages was significantly reduced, specifically manifested as a significant decrease in the fluorescence intensity of yolk sac macrophages. Thus, both polypeptide pka15 and amidated polypeptide pka15 reduced the number of macrophages at the inflammatory site and had antibacterial inflammatory effects. There was no significant statistical difference in the antibacterial inflammatory effects between amidated polypeptide pka15 and polypeptide pka15 at doses of 10.0 and 20.0 ng / tail, and the antibacterial inflammatory effect of amidated polypeptide pka15 was superior to that of polypeptide pka15 at a dose of 40.0 ng / tail. See Table 2 and Figure 6 。

[0155] Table 2. Experimental results of the antibacterial inflammatory (macrophage) efficacy evaluation of samples (n = 10)

[0156]

[0157]

[0158] Compared with the model control group, **p < 0.01, ***p < 0.001

[0159] Compared with polypeptide pka15 at 40.0 ng / tail, # p < 0.05

[0160] Figure 6 The number of zebrafish yolk sac macrophages after sample treatment is shown, where polypeptide 15aa represents pka15; compared with the model control group, **p < 0.01, ***p < 0.001; compared with polypeptide pka15 at 40.0 ng / tail, #p < 0.05.

[0161] Example 4 Effects of polypeptide pka15 and amidated polypeptide pka15 on macrophage proliferation

[0162] 1.1 Materials: Raw264.7 mouse macrophages, 1640 medium, high-glucose DMEM, FBS, penicillin-streptomycin, PBS, two polypeptides (polypeptide 15aa and polypeptide 15aa-amidated).

[0163] 1.2 Methods: Polypeptide solutions at 4 concentrations (0.125 mg / ml, 0.25 mg / ml, 0.5 mg / ml, 1 mg / ml) and a control without polypeptide were taken and added to a 96-well plate, and Raw264.7 cells were observed for cell proliferation status.

[0164] 1.3 Steps:

[0165] a: Preparation of polypeptide samples and stock solutions of each concentration

[0166] The original polypeptide is bottled at 5 mg / vial. Directly pipette 1 ml of PBS into the polypeptide vial, then vortex to dissolve and mix evenly. Label it as A, and the stock solution concentration is 5 mg / ml.

[0167] Take 150 μl of stock solution A and add it to 150 μl of PBS in a new EP tube and mix well. The solution concentration is 2.5 mg / ml, and label it as stock solution B;

[0168] Take 150 μl of stock solution B and add it to 150 μl of PBS in a new EP tube and mix well. The solution concentration is 1.25 mg / ml, and label it as stock solution C;

[0169] Take 150 μl of stock solution C and add it to 150 μl of PBS in a new EP tube and mix well. The solution concentration is 0.625 mg / ml, and label it as stock solution D;

[0170] b: Seed cells in 96-well plates

[0171] Take Raw264.7 cells and seed them into 96-well plates, 2 x 10 3 cells per well. 100 μl / well. Each cell group has 5 replicates, and a total of 25 wells are seeded. Place them in a CO2 incubator for culture, and add two kinds of polypeptide reagents respectively the next morning.

[0172] c: Before adding polypeptides to the 96-well plates, replace the fresh cell culture medium in advance, 80 μl / well.

[0173] The experiment sets up a control group (20 μl of PBS + 80 μl of culture medium), experimental groups (polypeptide concentration 0.125 mg / ml: polypeptide concentration), experimental groups (polypeptide concentration 0.25 mg / ml: 20 μl of stock solution C + 80 μl of culture medium), experimental groups (polypeptide concentration 0.5 mg / ml: 20 μl of stock solution B + 80 μl of culture medium), experimental groups (polypeptide concentration 1 mg / ml: 20 μl of stock solution A + 80 μl of culture medium).

[0174] d: MTT proliferation assay

[0175] After adding polypeptides for 48 h, add 10 μl of MTT reagent solution to each well of the 96-well plate, incubate in a 37-degree incubator for 3 h, then discard the supernatant, and then add 150 μl of formazan solubilization solution to each well and place it on a shaker at room temperature to dissolve for 10 min, and then measure the OD = 570 nm value with an enzyme-linked immunosorbent assay (ELISA) reader.

[0176] e: Calculation of proliferation rate

[0177] Proliferation rate = (OD of measurement wells - OD of zero adjustment wells) / OD of control wells * 100%

[0178] f: Statistical difference analysis

[0179] The results of 5 concentrations were analyzed by one-way ANOVA with 5 replicates, and the significant differences were analyzed using the Student-Newman-Keμls test. Different letters were used to represent the significant differences in cell proliferation caused by different concentrations.

[0180] 1.4 Results:

[0181] Figure 7 The evaluation of the inhibitory effect of polypeptide pka15 and amidated polypeptide pka15 on the proliferation of RAW264.7 cells is shown. The evaluation results show that both polypeptides have a significant inhibitory effect on the proliferation of mouse macrophages RAW264.7 ( Figure 7 ).

[0182] Example 5 Role of polypeptide pka15 and amidated polypeptide pka15 in assisting IBD treatment and relieving gastrointestinal mucosal injury

[0183] 1. Detection materials

[0184] 1.1. Sample preparation information

[0185] For polypeptide pka15, the solvent is standard dilution water.

[0186] Positive control: Prednisolone, white powder, batch number A2411035, Shanghai Aladdin Biochemical Technology Co., Ltd., and the solvent is DMSO.

[0187] 1.2. Experimental animals

[0188] Zebrafish were all raised in fish culture water at 28°C (water quality: 200 mg of instant sea salt was added to every 1 L of reverse osmosis water, the conductivity was 450 - 550 μS / cm; pH was 6.5 - 8.5; hardness was 50 - 100 mg / L CaCO3). They were provided by the breeding center of Huante Biotechnology. The license number for the use of experimental animals is: SYXK(Zhe)2022 - 0004. The feeding management meets the requirements of international AAALAC certification (certification number: 001458), and the IACUC ethical review number is: IACUC - 2024 - 7587 - 01.

[0189] 1.3. Instruments, consumables and reagents

[0190] Dissecting microscope (SZX7, OLYMPUS, Japan); CCD camera (VertA1, Shanghai Tusen Vision Technology Co., Ltd., China); Electrically focused continuously variable fluorescence microscope (AZ100, Nikon, Japan); Precision electronic balance (CP214, OHAUS, America); 6-well plate (Zhejiang Beilanbo Biotechnology Co., Ltd., China); Digital display horizontal decolorizing shaker (ZD-9556A, Taicang Hualida Experimental Equipment Co., Ltd., China); Electronic constant temperature water bath (HHS-2S, Shanghai Kanglu Instrument Equipment Co., Ltd., China); Microtome (KD2258, Jinhua Cody Medical Instrument Co., Ltd., China); Intelligent electric hot plate (400X280, Tianjin Laiyuenage Laboratory Instrument Sales Co., Ltd., China); Biological microscope (CX31, OLYMPUS, Japan).

[0191] Methyl cellulose (batch number C2004046, Shanghai Aladdin Biochemical Technology Co., Ltd., China); Dimethyl sulfoxide (DMSO, batch number I2229063, Shanghai Aladdin Biochemical Technology Co., Ltd., China); TNBS (batch number 0000296416, Sigma, USA); Alcian blue (batch number BCBV8028, Sigma, Switzerland); 4% tissue cell fixative (batch number 240005013, Beijing Solarbio Science & Technology Co., Ltd., China); Glacial acetic acid (batch number A2425033, Shanghai Aladdin Biochemical Technology Co., Ltd., China); Absolute ethanol (batch number 20240312, Sinopharm Chemical Reagent Co., Ltd., China); Xylene (batch number 20220105, Sinopharm Chemical Reagent Co., Ltd., China); Hematoxylin staining solution (batch number 20220120, Shanghai Yihe Biotechnology Co., Ltd., China); Eosin staining solution (batch number 20220120, Shanghai Yihe Biotechnology Co., Ltd., China); Dilute hydrochloric acid (batch number 20210104, Shenzhen Bolinda Technology Co., Ltd., China); Neutral balsam (batch number 330A021, Beijing Solarbio Science & Technology Co., Ltd., China); High-performance sectioning paraffin wax (melting point 54 - 56 °C, batch number 20201020, Shanghai Huayong Paraffin Co., Ltd., China); High-performance sectioning paraffin wax (melting point 62 - 64 °C, batch number 20210828, Shanghai Huayong Paraffin Co., Ltd., China).

[0192] 2. Detection method

[0193] 2.1. Effect on intestinal lumen area

[0194] Wild-type AB strain zebrafish at 3 days post-fertilization (3 dpf) were randomly selected and placed in 6-well plates, with 30 zebrafish in each well (experimental group). Except for the normal control group, the remaining experimental groups were given TNBS dissolved in water to establish a zebrafish gastrointestinal mucosal injury model. After treatment at 28 °C for 2 days, TNBS was removed, and samples (3 polypeptide concentration gradients: 6 μg / mL, 30 μg / mL, and 150 μg / mL) were respectively given dissolved in water. The concentration of the positive control prednisolone was 25.0 μg / mL. At the same time, a normal control group and a model control group were set up, and the volume of each well was 3 mL. After continuing treatment at 28 °C for 2 days, 10 zebrafish were randomly selected from each experimental group and placed under a dissection microscope to take pictures and save the images. The NIS-Elements D 3.20 advanced image processing software was used to collect data and analyze the intestinal lumen area of zebrafish. The statistical analysis results of this index were used to evaluate the efficacy of the sample in relieving and / or treating gastrointestinal mucosal injury. The statistical treatment results were expressed as mean ± SE. SPSS 26.0 software was used for statistical analysis, and p < 0.05 indicated that the difference was statistically significant.

[0195] 2.2. Effect on the number of intestinal neutrophils

[0196] Transgenic neutrophil green fluorescent zebrafish (MPX strain) at 3 dpf were randomly selected and placed in 6-well plates, with 30 zebrafish in each well (experimental group). Except for the normal control group, the remaining experimental groups were given TNBS dissolved in water to establish a zebrafish gastrointestinal mucosal injury model. After treatment at 28 °C for 2 days, TNBS was removed, and samples (3 polypeptide concentration gradients: 6 μg / mL, 30 μg / mL, and 150 μg / mL) were respectively given dissolved in water. The concentration of the positive control prednisolone was 25.0 μg / mL. At the same time, a normal control group and a model control group were set up, and the volume of each well was 3 mL. After continuing treatment at 28 °C for 2 days, 10 zebrafish were randomly selected from each experimental group and placed under a fluorescence microscope to take pictures and save the images. The NIS-Elements D 3.20 advanced image processing software was used to collect data and analyze the number of intestinal neutrophils in zebrafish. The statistical analysis results of this index were used to evaluate the efficacy of the sample in relieving and / or treating gastrointestinal mucosal injury. The statistical treatment results were expressed as mean ± SE. SPSS 26.0 software was used for statistical analysis, and p < 0.05 indicated that the difference was statistically significant.

[0197] 2.3. Effect on the number of intestinal goblet cells

[0198] Randomly select 3-dpf wild-type AB strain zebrafish into 6-well plates, with 30 zebrafish treated in each well (experimental group). Except for the normal control group, the rest of the experimental groups were given TNBS dissolved in water to establish a zebrafish gastrointestinal mucosal injury model. After treatment at 28 °C for 2 days, TNBS was removed, and samples (3 polypeptide concentration gradients: 6 μg / mL, 30 μg / mL, and 150 μg / mL) were respectively given dissolved in water. The concentration of the positive control prednisolone was 25.0 μg / mL. At the same time, a normal control group and a model control group were set up, and the volume of each well was 3 mL. After continuing to treat at 28 °C for 2 days, the zebrafish in each group were fixed with 4% tissue cell fixative, and then Alcian blue staining was performed. After the staining was completed, 10 zebrafish were randomly selected from each experimental group and photographed under a dissecting microscope to save the pictures. The NIS-Elements D 3.20 advanced image processing software was used to collect data and analyze the number of goblet cells in the zebrafish intestine. The statistical analysis results of this index were used to evaluate the efficacy of the sample in relieving and / or treating gastrointestinal mucosal injury. The statistical processing results were expressed as mean ± SE. SPSS 26.0 software was used for statistical analysis, and p < 0.05 indicated that the difference was statistically significant.

[0199] 2.4. Effect on intestinal histopathology

[0200] Randomly select 3-dpf wild-type AB strain zebrafish into 6-well plates, with 30 zebrafish treated in each well (experimental group). Except for the normal control group, the rest of the experimental groups were given TNBS dissolved in water to establish a zebrafish gastrointestinal mucosal injury model. After treatment at 28 °C for 2 days, TNBS was removed, and samples (concentrations are shown in Figure 8 ) were respectively given dissolved in water, and the positive control prednisolone was at a concentration of 25.0 μg / mL. At the same time, a normal control group and a model control group were set up, and the volume of each well was 3 mL. After continuing to treat at 28 °C for 2 days, the zebrafish in each group were subjected to intestinal histopathological examination through steps such as fixation, dehydration, embedding, sectioning, and H&E staining to evaluate the efficacy of the sample in relieving and / or treating gastrointestinal mucosal injury.

[0201] 3. Test results

[0202] 3.1. Effect on intestinal lumen area

[0203] Under the conditions of this experiment, the polypeptide pka15 can significantly reduce gastrointestinal mucosal injury, specifically manifested as a decrease in the intestinal lumen area. See Figure 8 .

[0204] 3.2. Effect on the number of intestinal neutrophils

[0205] Under the conditions of this experiment, the polypeptide pka15 can significantly reduce gastrointestinal mucosal injury, specifically manifested as a decrease in the number of intestinal neutrophils. See Figure 9 .

[0206] 3.3. Effect on the number of intestinal goblet cells

[0207] Under the conditions of this experiment, polypeptide pka15 can significantly reduce gastrointestinal mucosal injury, specifically manifested as an increase in the number of intestinal goblet cells. See details in Figure 10 .

[0208] 3.4. Effect on intestinal histopathology

[0209] Under the conditions of this experiment, there were no obvious abnormalities in the intestines of the normal control group. The intestinal folds were obvious, the number of intestinal villi was large and the height was normal, and the intestinal epithelial cells were tightly connected to the cilia and mucosa. In the model control group, the intestinal folds were significantly reduced, the number of intestinal villi was reduced and the height decreased significantly, and the intestinal lumen was significantly dilated, indicating that the model was successfully established.

[0210] In the positive control prednisolone 25.0 μg / mL concentration group, the intestinal lumen dilation and intestinal mucosa tissue were significantly improved, and the number of intestinal folds and intestinal mucosa increased significantly, indicating that prednisolone has the effect of reducing gastrointestinal mucosal injury.

[0211] In the polypeptide pka15 6.00 μg / mL concentration group, the intestinal lumen was significantly dilated, the number of intestinal folds was small, the number of intestinal villi was small and the height decreased, similar to the model control group; in the polypeptide pka15 30.0 μg / mL concentration group, the intestinal lumen dilation was slightly improved, and the number of intestinal folds and intestinal villi increased; in the polypeptide pka15 150 μg / mL concentration group, the intestinal lumen shrank, the number of intestinal folds increased significantly, the number and height of intestinal villi were significantly improved, and there were no obvious abnormalities in the intestinal mucosa tissue. Thus, it can be seen that polypeptide pka15 can significantly reduce gastrointestinal mucosal injury. See details in Figure 11 .

[0212] The present invention first performs yolk sac injection on zebrafish embryos after fluorescence labeling modification, and observes the response effects of macrophages and neutrophils in different groups under PBS induction to evaluate the immunomodulatory efficacy of polypeptide pka15. The results show that the novel polypeptide pka15 can significantly reduce the number of macrophages and neutrophils at the inflammatory site. At the same time, polypeptide pka15 is added to murine macrophages to evaluate its effect on mammalian immune cells. The results show that polypeptide pka15 can also significantly inhibit the proliferation of murine macrophages. Thus, it can be seen that polypeptide pka15 has immunomodulatory effects on the immune cells of zebrafish and mice and can be applied to the preparation of immunomodulatory drugs.

[0213] Secondly, the present invention orally administers to a TNBS-induced zebrafish IBD model to observe the recovery effect of the polypeptide pka15-amidation on the digestive tract at different administration doses. The results show that the polypeptide pka15 can significantly reduce gastrointestinal mucosal damage, improve the gastrointestinal mucosa of zebrafish, and reduce inflammatory cell infiltration. Specifically, it is manifested as reducing the intestinal lumen area, decreasing the number of intestinal neutrophils, increasing the number of intestinal goblet cells, and improving the intestinal histopathological characteristics, etc. These results indicate that the polypeptide pka15 can significantly improve IBD symptoms, has the efficacy of protecting the digestive tract mucosa or improving digestive tract mucosal damage, can be applied to the preparation of drugs for relieving and / or treating IBD, and is easy to prepare in large quantities. Compared with existing drugs, the present invention has lower costs, higher safety, and better curative effects.

[0214] Meanwhile, the polypeptide pka15 of the present invention can also be used as a reagent for immunological research, providing a model for better understanding the mechanism of immune regulation. The polypeptide pka15 shows a clear regulatory effect on immune cells. Based on this, it can be used to prepare drugs and / or kits for immunotherapy and / or diagnosis, and has broad application prospects and potential value in the biomedical field.

[0215] It should be noted that the above-described embodiments are only the preferred embodiments of the present invention. For those of ordinary skill in the art, without departing from the principle of the present invention, several modifications, improvements, and equivalent substitutions can be made to the present invention, and these modifications, improvements, and equivalent substitutions are also considered to fall within the protection scope of the claims of the present invention.

Claims

1. A polypeptide pka15, characterized in that have: (I) the amino acid sequence shown in SEQ ID NO: 1; or (II) An amino acid sequence having at least 90% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 obtained by substituting, deleting, adding and / or replacing 1 or 2 amino acids based on the amino acid sequence shown in (I).

2. A nucleic acid molecule encoding the polypeptide pka15 according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that have: (I) the nucleotide sequence shown in SEQ ID NO: 2; or (II) a complementary nucleotide sequence to the nucleotide sequence shown in SEQ ID NO: 2; or (III) a nucleotide sequence that encodes the same protein as the nucleotide sequence described in (I) or (II), but is different from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or (IV) A nucleotide sequence having at least 90% sequence identity with the nucleotide sequence described in (I), (II) or (III).

4. A recombinant vector, characterized in that: Comprising the nucleic acid molecule according to claim 2.

5. A host cell, characterized in that Comprising the nucleic acid molecule according to claim 2 or the recombinant vector according to claim 4.

6. A fusion protein, which has a protein tag connected to the N-terminus and / or C-terminus of the polypeptide pka15 according to claim 1, and has the same biological function as the polypeptide pka15 according to claim 1.

7. Use of the polypeptide pka15 according to claim 1, the nucleic acid molecule according to claim 2, the recombinant vector according to claim 4, the host cell according to claim 5, and the fusion protein according to claim 6 in the preparation of an immunomodulatory preparation, wherein the immunomodulatory preparation is used to alleviate and / or treat autoimmune diseases and / or allergic diseases caused by inflammation.

8. The use according to claim 7, characterized in that: The preparation for alleviating and / or treating autoimmune diseases and / or allergic diseases caused by inflammation includes drugs that reduce the number of macrophages and neutrophils at the inflammation site and inhibit the proliferation of macrophages.

9. Use of the polypeptide pka15 according to claim 1, the nucleic acid molecule according to claim 2, the recombinant vector according to claim 4, the host cell according to claim 5, and the fusion protein according to claim 6 in the preparation of drugs for alleviating and / or treating inflammatory bowel disease and drugs for protecting and / or repairing gastrointestinal mucosa.

10. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the polypeptide pka15 according to claim 1, the nucleic acid molecule according to claim 2, the recombinant vector according to claim 4 or the host cell according to claim 5, and a pharmaceutically acceptable carrier and / or excipient.

11. A medical device, characterized in that: It comprises the polypeptide pka15 according to claim 1 and an acceptable carrier.

Images