Application of substance for detecting OPA1 mutation site in preparation of product for diagnosing syndrome-type hereditary hearing loss

Abstract

The invention discloses application of a substance for detecting an OPA1 mutation site in preparation of a product for diagnosing syndrome-type hereditary hearing loss. The OPA1 mutation site is any one of the following nucleotides shown as the 1333rd site, the 1555th site, the 2635th site and the 2639th site of the OPA1 gene. According to the invention, three OPA1 gene pathogenic mutation sites related to syndrome-type hereditary hearing loss are found for the first time, and whether a to-be-detected person suffers from syndrome-type hereditary hearing loss or not can be effectively judged and an individual susceptible to syndrome-type hereditary hearing loss can be screened by detecting whether the three mutation sites in the to-be-detected person are mutated or not; meanwhile, an OPA1 gene mutant can be constructed on the basis of the three mutation sites so as to be used for screening drugs for treating syndrome-type hereditary hearing loss. Genetic basis is provided for developing molecular diagnosis of hereditary hearing loss, and a new detection site is provided for diagnosis or treatment of the hereditary hearing loss.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to the application of substances for detecting OPA1 mutation sites in the preparation of products for diagnosing syndromic hereditary deafness. Particularly, it relates to methods for diagnosing syndromic autosomal dominant hereditary deafness, screening individuals susceptible to syndromic autosomal dominant hereditary deafness, and constructing a drug screening model based on OPA1 mutation sites. Background Art

[0002] The OPA1 (Optic Atrophy 1) gene is located at 3q28-q29, consists of 31 exons, and contains a total of 8 transcripts, encoding 960 amino acids. OPA1 belongs to nuclear genes and encodes a GTPase-related dynamin protein that affects mitochondrial morphology and function. The OPA1 protein is a dynamin-related protein, located at the crista junctions of the inner mitochondrial membrane, and is related to the structural changes of the cristae. The OPA1 protein contains 5 domains: a mitochondrial leader sequence, a GTPase domain, a central dynamin domain, and 2 terminal coiled-coil domains. OPA1 is directly related to the respiratory complex. As part of the respiratory chain, it maintains the integrity of the respiratory chain, participates in respiration and energy metabolism, and plays an anti-apoptotic factor role in the form of the OPA1-PARL complex during apoptosis. Research shows that OPA1 also has an irreplaceable role in aspects such as steroid production.

[0003] Currently discovered OPA1 gene mutations mainly concentrate in the GTPase domain and the C-terminal coiled-coil domain. So far, more than 200 mutations have been identified, and most of them are predicted to produce protein truncation, which may lead to haploinsufficiency. These mutations cause typical "non-syndromic" optic neuropathy, characterized by varying degrees of central vision impairment. Some patients may present with an autosomal dominant optic atrophy (ADOA) syndrome form associated with sensorineural hearing loss, ataxia, sensorimotor neuropathy, progressive external ophthalmoplegia, and mitochondrial myopathy.

[0004] Sensorineural hearing loss is the most common extraocular manifestation of ADOA, present in 60% of ADOA patients, and the most common is the R445H mutation. Hearing loss begins in childhood or adolescence, usually occurring after visual symptoms appear. Although most studies widely classify hearing impairment as "sensorineural hearing loss", some scholars have proposed that ADOA hearing loss is a form of auditory neuropathy, namely syndromic autosomal dominant hereditary auditory neuropathy, because it can present normal distortion product otoacoustic emissions (DPOAE) and abnormal auditory brainstem responses (ABR). Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to diagnose syndromic hereditary deafness, and further screen individuals susceptible to syndromic hereditary deafness, and evaluate or assist in evaluating the risk of suffering from syndromic hereditary deafness in a subject to be tested.

[0006] To solve the above technical problem, the present invention first provides a new use of a substance for detecting the genotype of the OPA1 gene mutation site in the human genome.

[0007] The present invention provides the use of a substance for detecting the genotype of the OPA1 gene mutation site in the preparation of a product for diagnosing or assisting in diagnosing syndromic hereditary deafness.

[0008] The present invention also provides the use of a substance for detecting the genotype of the OPA1 gene mutation site in diagnosing or assisting in diagnosing syndromic hereditary deafness.

[0009] The present invention further provides the use of a substance for detecting the genotype of the OPA1 gene mutation site in the preparation of a product for screening or assisting in screening individuals susceptible to syndromic hereditary deafness.

[0010] The present invention also provides the use of a substance for detecting the genotype of the OPA1 gene mutation site in screening or assisting in screening individuals susceptible to syndromic hereditary deafness.

[0011] The present invention further provides the use of a substance for detecting the genotype of the OPA1 gene mutation site in the preparation of a product for evaluating or assisting in evaluating the risk of suffering from syndromic hereditary deafness in a subject to be tested.

[0012] The present invention provides the use of a substance for detecting the genotype of the OPA1 gene mutation site in evaluating or assisting in evaluating the risk of suffering from syndromic hereditary deafness in a subject to be tested.

[0013] To solve the above technical problem, the present invention also provides a product.

[0014] The product provided by the present invention comprises a substance for detecting the genotype of the OPA1 gene mutation site;

[0015] The function of the product is any one of the following A1)-A3):

[0016] A1) Diagnosing or assisting in diagnosing syndromic hereditary deafness;

[0017] A2) Screening or assisting in screening individuals susceptible to syndromic hereditary deafness;

[0018] A3) Evaluating or assisting in evaluating the risk of suffering from syndromic hereditary deafness in a subject to be tested.

[0019] In any of the above applications, the OPA1 gene mutation site (NM_015560.2) is any one of the following three sites: the 1333rd nucleotide of the OPA1 gene, the 1555th nucleotide of the OPA1 gene, and the 2635-2639th nucleotides of the OPA1 gene.

[0020] Furthermore, the substance for detecting the genotype of the OPA1 gene mutation site can be a substance for detecting whether a mutation occurs at the OPA1 gene mutation site.

[0021] Even further, the substance for detecting whether a mutation occurs at the 1333rd nucleotide of the OPA1 gene can be a substance for detecting whether the 1333rd nucleotide of the OPA1 gene mutates from base C to base G.

[0022] The substance for detecting whether a mutation occurs at the 1555th nucleotide of the OPA1 gene can be a substance for detecting whether the 1555th nucleotide of the OPA1 gene mutates from base G to base A.

[0023] The substance for detecting whether a mutation occurs at the 2635-2639th nucleotides of the OPA1 gene can be a substance for detecting whether a deletion mutation occurs at the 2635-2639th nucleotides of the OPA1 gene.

[0024] In any of the above applications, the substance for detecting the genotype of the OPA1 gene mutation site can be a reagent and / or instrument for detecting the genotype of the OPA1 gene mutation site in a biological sample.

[0025] The reagents include, but are not limited to, primers, probes, antibodies, and mass spectrometry detection reagents that specifically target the OPA1 gene mutation site or the OPA1 mutant gene containing the mutation site or the OPA1 mutant protein encoded by the OPA1 mutant gene. For example, the inventor can detect whether the above mutation exists in a sample to be tested by the specific binding of an antibody that specifically recognizes the OPA1 mutant protein to the OPA1 mutant protein, that is, detect the existence of the above OPA1 mutant protein through the interaction between the specific antibody and the antigen; the inventor can also pre-design a probe that specifically recognizes the OPA1 gene mutation site or the OPA1 mutant gene, and identify the existence of the OPA1 gene mutation site or the OPA1 mutant gene by the complementary pairing of the probe with the nucleic acid fragment where the OPA1 gene mutation site or the OPA1 mutant gene is located; the inventor can also design specific primers for amplifying the fragment containing the OPA1 gene mutation site, and then determine the existence of the OPA1 gene mutation site through gene amplification and sequencing; the inventor can also detect the m / z of the OPA1 mutant protein by mass spectrometry to judge the existence of the above OPA1 mutant protein.

[0026] In a specific embodiment of the present invention, the primers include a primer pair consisting of Primer-F1 and Primer-R1 for detecting the nucleotide mutation site at position 1333 of the OPA1 gene, a primer pair consisting of Primer-F2 and Primer-R2 for detecting the nucleotide mutation site at position 1555 of the OPA1 gene, and a primer pair consisting of Primer-F3 and Primer-R3 for detecting the nucleotide mutation site at positions 2635-2639 of the OPA1 gene. The primer sequences are specifically shown in Table 1.

[0027] The instrument includes, but is not limited to, a PCR instrument for PCR amplification or a sequencing instrument for sequencing (such as BGISEQ-500, BGISEQ-500RS, HISEQ2000, SOLiD, 454, and single-molecule sequencing devices, etc.).

[0028] The biological sample can be human blood, skin, or subcutaneous tissue, specifically human peripheral blood.

[0029] In practical applications, the following methods can be used to diagnose or assist in diagnosing syndromic hereditary deafness, screen or assist in screening individuals susceptible to syndromic hereditary deafness, and evaluate or assist in evaluating the risk of syndromic hereditary deafness in a subject to be tested: Extract the nucleic acid (genomic DNA) of the subject to be tested, and analyze the nucleic acid with the substances for detecting the genotypes of the OPA1 gene mutation sites described above to determine the specific mutation conditions of the OPA1 gene mutation sites in the subject to be tested, so as to determine whether the subject to be tested is a patient with syndromic hereditary deafness, an individual susceptible to syndromic hereditary deafness, and the risk of syndromic hereditary deafness.

[0030] To solve the above technical problems, the present invention also provides any one of the following biological materials B1)-B5):

[0031] B1) An OPA1 mutant gene, which is a gene obtained by mutating the nucleotide at position 1333 of the OPA1 wild-type gene from base C to base G, or a gene obtained by mutating the nucleotide at position 1555 of the OPA1 wild-type gene from base C to base G, or a gene obtained by deleting the nucleotides at positions 2635-2639 of the OPA1 wild-type gene;

[0032] B2) An OPA1 mutant protein, which is a protein obtained by mutating the 445th amino acid of the OPA1 wild-type protein from arginine (Arg) to glycine (Gly), or a protein obtained by mutating the 519th amino acid of the OPA1 wild-type protein from glutamic acid (Glu) to lysine (Lys), or a protein with an amino acid sequence as shown in Sequence 3;

[0033] B3) A recombinant vector, which contains the OPA1 mutant gene described in B1) or expresses the OPA1 mutant protein described in B2);

[0034] B4) A recombinant cell, which contains the OPA1 mutant gene described in B1) or expresses the OPA1 mutant protein described in B2) or contains the recombinant vector described in B3);

[0035] B5) An animal model, which contains the OPA1 mutant gene described in B1) or expresses the OPA1 mutant protein described in B2) or contains the recombinant vector described in B3) or contains the recombinant cell described in B4).

[0036] The use of the above biological materials in the development or screening of drugs for the treatment or adjuvant treatment of syndromic hereditary deafness also belongs to the protection scope of the present invention.

[0037] In any of the above-mentioned applications or products, the nucleotide sequence of the OPA1 wild-type gene is as shown in Sequence 1 in the sequence listing.

[0038] The amino acid sequence of the OPA1 wild-type protein is as shown in Sequence 2 in the sequence listing.

[0039] In any of the above-mentioned applications or products, the syndromic hereditary deafness is syndromic autosomal dominant hereditary auditory neuropathy.

[0040] The present invention has first discovered 3 pathogenic mutation sites of the OPA1 gene related to syndromic hereditary deafness. By detecting whether the above 3 mutation sites mutate in a subject to be tested, it is possible to effectively determine whether the subject to be tested has syndromic hereditary deafness, screen individuals prone to syndromic hereditary deafness, and evaluate the risk of suffering from syndromic hereditary deafness. At the same time, based on the above 3 mutation sites, OPA1 gene mutants can also be constructed and then used for the development or screening of drugs for the treatment of syndromic hereditary deafness. The discovery of the pathogenic mutation sites of the present invention enriches the gene mutation spectrum of deafness, provides a genetic basis for the molecular diagnosis of hereditary deafness, provides new detection sites, as well as new detection methods and approaches for the diagnosis or treatment of this disease, and further expands and improves the detection and research of hereditary hearing loss diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figures 1 to 3 Related drawings of the c.1333C>G(p.Arg445Gly) variation of the OPA1 gene obtained from the 1006835 family in Example 1 of the present invention. Figure 1 It is the pedigree of the 1006835 family. Figure 2Sequencing results of the OPA1 gene for family 1006835. Among them, the first line is the heterozygous mutant sequence (patient sequence), the second line is the wild-type sequence, and the arrow indicates the position of the mutation site. The mutation is a C→G mutation at the 1333rd base of the OPA1 gene. Figure 3 It is the position of the amino acid change c.1333C>G of the OPA1 gene in the protein structure.

[0042] Figures 4 to 6 It is the related drawing for obtaining the OPA1 gene c.1555G>A (p.Glu519Lys) variation based on family 1507337 in Example 2 of the present invention. Figure 4 It is the family tree of family 1507337. Figure 5 Sequencing results of the OPA1 gene for family 1507337. Among them, the first line is the heterozygous mutant sequence (patient sequence), the second line is the wild-type sequence, and the arrow indicates the position of the mutation site. The mutation is a G→A mutation at the 1555th base of the OPA1 gene. Figure 6 It is the position of the amino acid change c.1555G>A of the OPA1 gene in the protein structure.

[0043] Figures 7 to 9 It is the related drawing for obtaining the OPA1 gene c.2635_2639delTTGTT (p.Leu879LeufsX22) variation based on family 1707823 in Example 3 of the present invention. Figure 7 It is the family tree of family 1707823. Figure 8 Sequencing results of the OPA1 gene for the patient of family 1707823. Among them, the first line is the mutant sequence (patient sequence), the second line is the wild-type sequence, and the arrow indicates the position of the mutation site. The mutation is a deletion of TTGTT between the 2635th and 2639th bases of the OPA1 gene. Figure 9 It is the position of the amino acid change c.2635_2639delTTGTT of the OPA1 gene in the protein structure. Detailed implementation manners

[0044] The present invention will be further described in detail below in conjunction with the detailed implementation manners. The provided examples are only for clarifying the present invention and not for limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements and do not limit the present invention in any way.

[0045] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0046] The amplification primer sequences and related information of each variant site involved in the following examples are shown in Table 1.

[0047] Table 1

[0048]

[0049] Example 1. OPA1 gene c.1333C>G variant obtained based on pedigree 1006835

[0050] First, candidate variants of a syndromic autosomal dominant hereditary hearing neuropathy pedigree were screened by Sanger sequencing. Then, through sample collection, DNA extraction, PCR amplification and electrophoresis, PCR product purification, sequencing reaction, and detection of gene loci, variant detection was performed on family members and normal control populations to clarify the relationship between gene mutations and diseases. Finally, homologous genes in other organisms were compared, and biological software was used to predict the pathogenicity of mutations and analyze the polypeptide expression. The specific method steps are as follows:

[0051] 1. Sample collection

[0052] Taking a Chinese Han hereditary deafness pedigree as the research object, this pedigree consists of 5 members (see the pedigree diagram in Figure 1 ), among which there are 2 patients (II-2 and II-3) diagnosed with syndromic autosomal dominant hereditary hearing neuropathy, and the rest have normal phenotypes. Collect blood samples from patients (II-2, II-3) and normal people (I-1, I-2), collect 2 mL of peripheral blood samples for each sample, add EDTA for anticoagulation, and store at -80°C.

[0053] 2. DNA extraction

[0054] Extract DNA using a kit (refer to the protocol provided by the kit).

[0055] 3. PCR amplification and electrophoresis

[0056] ① Prepare the PCR reaction system (25 μL system): 15.2 μL of H2O, 2.5 μL of 10*PCR buffer, 3 μL of 2.5 mM dNTPs, 2 μL of primer (1 μL for each forward and reverse primer), 0.3 μL of LA Taq enzyme, and 2 μL of DNA template (DNA concentration greater than 30 ng / μL).

[0057] After adding samples to each 96-well plate each time, a sealing film must be pasted, and centrifuged (centrifuged at 2000g for 1 min) to mix evenly to prevent wall sticking. EP tubes and 96-well plates are all commercial disposable products. Pay attention to marking the plate number, sample number, and primer number.

[0058] ② Set up the PCR reaction program: Pre-denature at 96°C for 2 min, denature at 96°C for 30 s, anneal at 57°C for 30 s, extend at 72°C for 2 min, for 35 cycles; extend at 72°C for 5 min; 4°C / 15°C ∞.

[0059] ③ Agarose gel electrophoresis: Prepare a 1.5% agarose gel, and then mix 2 μL of loading buffer with 4 μL of the DNA amplification product and perform electrophoresis.

[0060] 4. Purification of PCR products

[0061] ① Prepare the digestion solution: 0.5 μL of TaKaRa Alkaline Phosphatase shrimp alkaline phosphatase and 0.5 μL of TaKaRa Exonuclease I exonuclease. After centrifuging the PCR product, add 1 μL of the digestion solution to the PCR reaction solution in each well.

[0062] ② Purification reaction: Perform the program reaction on a PCR instrument. The program is: 37°C for 60 min, 80°C for 15 min, 4°C / 15°C ∞.

[0063] 5. Sequencing reaction

[0064] ① Configure SEQMIX using the ABI PRISM@ BigDye@ Terminator v3.1 cycle Sequencing Kit. Prepare the MIX according to the following formula based on the number of PCR reactions: 0.4 μL of BigDye, 0.8 μL of Sequencing Buffer, 1.8 μL of H2O, 1 μL of Primer (3.2 pmol / μL) (the primer can be added separately), 1 μL of template (i.e., the product in 4-②).

[0065] Add 3 μL or more of the above MIX, 1 μL of the corresponding primer, and 1 μL of the corresponding PCR product (note that after sealing the film, it is required to press the film) into a 96-well plate and centrifuge.

[0066] ② SEQ program: Pre-denature at 96°C for 2 min, denature at 96°C for 10 s, anneal at 55°C for 5 s, extend at 60°C for 90 s, for 25 cycles; 4°C / 15°C ooo.

[0067] 5. Purification

[0068] ① Reagent preparation

[0069] 0.125 mol / L EDTA-Na2 solution: Weigh 2.325 g of EDTA-Na2·2H2O into a 50 mL centrifuge tube, add 40 mL of deionized water, heat in a 65°C water bath, intermittently shake several times until completely dissolved, make up to 50 mL with deionized water, and shake for 10 seconds to mix evenly.

[0070] Absolute ethanol (GR).

[0071] Deionized formamide HIDI.

[0072] ② Mix absolute ethanol with distilled water to prepare 85% ethanol and 70% ethanol for use on the same day.

[0073] ③ After centrifuging the sequencing reaction plate, add 2.5 μL of EDTA-Na2·2H2O solution and 40 μL of 85% ethanol to each reaction well, shake well for 3 min, and centrifuge at 3000 g and 4 °C for 30 min (EDTA, as a metal ion chelating agent, can bind to the ions in the sequencing PCR reaction system to remove the ions).

[0074] ④ After centrifugation, invert the sequencing reaction plate on absorbent paper and stop immediately when the centrifugal force reaches 185 g (or 900 rpm).

[0075] ⑤ Add 50 μL of 70% ethanol to each well, shake well for 1 min, and centrifuge at 3000 g and 4 °C for 15 min.

[0076] ⑥ Repeat step ④.

[0077] ⑦ Air dry in the dark for 15 - 30 min, add 10 μL of HIDI to each well, centrifuge, react in a PCR instrument at 96 °C for 2 min, and take out after cooling to 4 °C.

[0078] 6. Sequencing on the machine and result analysis

[0079] After denaturation, perform sequencing on a sequencer (ABI 3730). After obtaining the peak map, use the software VariantReport v1.1 to rename and analyze it to determine the presence and type of mutations.

[0080] 7. Mutation detection and screening

[0081] Perform preliminary statistical analysis on the above sequencing output data in sequence. The main steps are as follows: Use VariantEffect Predictor (VEP) to annotate the detected mutations, and at the same time add frequency databases such as 1KG / ESP / HapMap / ExAC / gnomAD and information such as OMIM, GO, KEGG, and harmfulness prediction.

[0082] 8. Analysis results

[0083] According to the patient phenotype and family inheritance pattern, that is, one of the father or mother carries a mutation, the child carries a mutation, or each parent has a mutation in the same gene and the child has two mutations at the same time (compound heterozygosity), or the parents are normal and the child carries a mutation. It is found that the mutation on the OPA1 gene meets the criteria. The c.1333C>G( Figure 2 ) variation of the OPA1 gene was detected in the probands II-1 and II-2. The c.1333C>G mutation causes the arginine at position 445 of the OPA1 protein amino acid sequence to mutate to glycine( Figure 3 ), and it can be judged as the pathogenic cause of syndromic autosomal dominant hereditary hearing neuropathy. Family members I-1 and I-2 are both normal. Through the analysis of the ACMG / AMP variant interpretation guidelines, this variant has the following evidence: PS2+PM1+PM2+PM5+PP1+PP3+PP4. Among them, PS2: The assumed mutation is de novo, including two known patients carrying this mutation, with a total of 2 points, reaching the PS2 level; PM1: This mutation is located in the GTPase domain of the OPA1 hot spot mutation; PM2: This variant was not found in the normal control populations of the ESP database, the 1000 Genomes database, and the EXAC database; PM5: A missense change occurs at the same codon as another pathogenic missense variant; PP1: The family shows dominant inheritance with 2 patients; PP3: Multiple software predicts pathogenicity; PP4: The phenotype highly conforms to this genetic disease. Therefore, it can be judged that this variant site is the pathogenic variant site of syndromic autosomal dominant hereditary hearing neuropathy.

[0084] Example 2. The c.1555G>A variation of the OPA1 gene obtained based on family 1507337

[0085] First, candidate variants of a syndromic autosomal dominant hereditary hearing neuropathy family were screened by whole exome sequencing. Then, through bioinformatics analysis, non-pathogenic nucleotide variants were screened out to narrow the number of candidate variants. Further, primers were designed for the candidate variants, and PCR amplification, product purification, and Sanger sequencing were performed. The candidate variants were detected in family members and normal control populations, and co-segregation analysis was carried out to clarify the relationship between gene mutations and diseases. Finally, homologous genes in other organisms were compared, and biological software was used to predict the pathogenicity of mutations and analyze the polypeptide expression. The specific method steps are as follows:

[0086] 1. Sample collection

[0087] Taking a Chinese Han hereditary deafness family as the research object, this family consists of 3 members (see the family tree in Figure 4) Among them, 1 patient (II-1) was diagnosed with syndromic autosomal dominant hereditary auditory neuropathy, and the rest had normal phenotypes. Blood samples of the patient (II-1) and normal individuals (I-1, I-2) were collected. 2 mL of peripheral blood samples were collected from each sample, anticoagulated with EDTA, and stored at -80°C.

[0088] 2. DNA Extraction

[0089] DNA was extracted from peripheral blood samples using the OMEGA Blood DNA Midi Kit whole blood DNA extraction kit. The extraction steps are as follows:

[0090] (1) Take 2 mL of whole blood sample, add 150 μL of OB Protease, 2.1 mL of Buffer BL, and 20 μL of RNase A, vortex at maximum speed for 1 minute to thoroughly mix;

[0091] (2) Incubate in a water bath at 65°C for 15 - 20 minutes, and vortex 5 times during the water bath;

[0092] (3) Add 2.2 mL of absolute ethanol, vortex at maximum speed for 30 seconds to thoroughly mix;

[0093] (4) Transfer 3.5 mL of the lysate to a 15 mL centrifuge tube with a filter column, centrifuge at 4000 rpm for 5 minutes, take out the filter column, pour out the filtered liquid, and put the filter column back;

[0094] (5) Add the remaining lysate from step 3 to a 15 mL centrifuge tube with a filter column, centrifuge at 4000 rpm for 5 minutes, take out the filter column, pour out the filtered liquid, and put the filter column back;

[0095] (6) Add 3 mL of HB Buffer to wash the filter column, centrifuge at 4000 rpm for 5 minutes, take out the filter column, pour out the filtered liquid, and put the filter column back;

[0096] (7) Add 3 mL of DNA Wash Buffer, centrifuge at 4000 rpm for 5 minutes, take out the filter column, pour out the filtered liquid, and put the filter column back;

[0097] (8) Add 3 mL of DNA Wash Buffer again, centrifuge at 4000 rpm for 5 minutes, take out the filter column, pour out the filtered liquid, and put the filter column back;

[0098] (9) Centrifuge at 4000 rpm for 15 minutes to spin dry the filter column;

[0099] (10) Transfer the filter column to a new 15 mL centrifuge tube, add 500 μL of 70°C Elution Buffer, let it stand at room temperature for 5 minutes, centrifuge at 4000 rpm for 5 minutes, and collect the filtered liquid containing DNA;

[0100] (11) Transfer the filtration column to a new 15 mL centrifuge tube again, add 500 μL of Elution Buffer at 70 °C, let it stand at room temperature for 5 minutes, centrifuge at 4000 rpm for 5 minutes, and collect the filtrate containing DNA.

[0101] 3. Exon capture sequencing and variant analysis

[0102] The inventors performed whole-exome sequencing and data analysis on 3 samples (I:1, I:2, II:1) in the family. Among them, based on the MGISEQ-2000 high-throughput sequencing platform, the above 3 samples were subjected to whole-exome capture sequencing using the BGI V4 chip, and the specific steps are as follows:

[0103] (1) Sample preparation

[0104] Respectively take the genomic DNA of the peripheral blood samples of the above 3 samples (I:1, I:2, II:1), measure the concentration and purity of DNA by spectrophotometer and gel electrophoresis. The OD260 / OD280 of the genomic DNA of each specimen is between 1.7 and 2.0, the concentration is not less than 200 ng / μL, and the total amount is not less than 30 μg, for standby.

[0105] (2) Library construction and sequencing

[0106] Use the adaptive high-focus ultrasound technology (Covaris) to randomly fragment each genomic DNA sample into fragments about 150 - 200 bp in length. Subsequently, according to the operation manual provided by the manufacturer, connect adapters to both ends of the fragments to prepare the library (see the Illumina / Solexa standard library construction manual provided by: http: / / www.illumina.com / ).

[0107] The library preparation process and sequencing process are as described below:

[0108] a) Primer design: The primers used for library construction were synthesized by Sangon Biotech Co., Ltd., and the primer specificity was verified using PrimerBLAST (http: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). The primer sequences are as follows:

[0109] Primer-F2 (5’→3’): CTGTGTTTCGGGAGGGAGAC;

[0110] Primer-R2 (5’→3’): AGTTCTGTATTTTGGACTCCAGTT.

[0111] b) Amplify the extracted DNA specimens using the designed primer pairs to obtain PCR products.

[0112] PCR reaction system (20 μL): 10 μL of Taq mix, 1 μL of upstream primer (10 μM), 1 μL of downstream primer (10 μM), 1 μL of template, 7 μL of double-distilled water; The PCR reaction conditions are shown in Table 2.

[0113] Table 2

[0114]

[0115] c) PCR product analysis: Prepare a 1.5% agarose gel, mix 2 μL of loading buffer with 4 μL of the DNA amplification product and perform electrophoresis, then analyze the electrophoresis pattern.

[0116] d) Select samples with a single band pattern and relatively high concentration. After purifying the PCR products, obtain a sequencing library. After the library is qualified for detection, it can be sequenced on the machine to obtain the original sequencing data. Among them, the sequencing is carried out with reference to the protocol of cluster generation and sequencing of Illumina standards. The sequencing platform is MGISEQ-2000, the read length is 418 bp, the average sequencing depth of the target region is ≥180X, and the proportion of sites with an average depth of the target region >20X is >95%.

[0117] (3) Mutation detection and screening

[0118] Perform preliminary statistical analysis, SNP detection and annotation, and prediction of amino acid substitutions on the above-mentioned sequencing output data in sequence. The main steps are as follows:

[0119] a) Conduct basic data analysis and statistics on the sequencing output data: analyze the length of the measured sequence reads, count the number of reads and the data output, align the reads sequences with the reference genome sequence, and count the coverage (Coverage) and sequencing depth (Depth) of the reads in the target region aligned to the reference genome to be referred to. According to the statistical results of the above basic data, obtain the basic information of the samples captured by exon and judge whether the data meets the requirements.

[0120] b) Align the high-quality original reads of each sample to the reference genome (hg19) using the Burrows-Wheeler Aligner (BWA, v0.7.10) alignment software. Then, use the Genome Analysis Toolkit (GATK, v3.3-0) software to detect SNPs and Indels, and use the Variant Effect Predictor (VEP) to annotate the detected variations. At the same time, add frequency databases such as 1KG / ESP / HapMap / ExAC / gnomAD and information such as OMIM, GO, KEGG, and pathogenicity prediction.

[0121] 4. Analysis Results

[0122] According to the patient phenotype and family inheritance pattern, that is, one of the father or mother carries a mutation, the child carries a mutation, or each parent has a mutation in the same gene and the child has two mutations at the same time (compound heterozygosity), or the parents are normal and the child carries a mutation. It was found that the mutations in the OPA1 gene met the conditions. In the proband II-1, a c.1555G>A ( Figure 5 ) variation was detected in the OPA1 gene. The c.1555G>A mutation caused the 519th amino acid in the amino acid sequence of the OPA1 protein to change from glutamic acid to lysine ( Figure 6 ), and it could be determined as the pathogenic cause of syndromic autosomal dominant hereditary hearing neuropathy. Family members I-1 and I-2 are both normal. Through the analysis of the ACMG / AMP variation interpretation guidelines, this variation has the following evidence: PS2+PM2+PP3+PP4. Among them, PS2: de novo verified by both parents, with highly heterogeneous phenotypes, scored 2; PM2: this variation was not found in the normal control populations of the ESP database, the 1000 Genomes database, and the EXAC database; PP3: predicted to be pathogenic by multiple software; PP4: the phenotype highly conforms to this hereditary disease. Therefore, it can be determined that this variant site is the pathogenic variant site of syndromic autosomal dominant hereditary hearing neuropathy.

[0123] Example 3. The c.2635_2639delTTGTT variation of the OPA1 gene obtained based on family 1707823

[0124] First, candidate variants of a syndromic autosomal dominant deafness family were screened by whole-exome sequencing. Then, through bioinformatics analysis, non-pathogenic nucleotide variants were screened to narrow down the number of candidate variants. Further, primers were designed for the candidate variants, followed by PCR amplification, product purification, Sanger sequencing, and detection of candidate variants in family members and normal control populations for co-segregation analysis to clarify the relationship between gene mutations and diseases. Finally, homologous genes in other organisms were compared, and biological software was used to predict the pathogenicity of mutations and analyze the polypeptide expression. The specific method steps are as follows:

[0125] 1. Sample collection

[0126] Taking a Chinese Han hereditary deafness family as the research object, this family consists of 3 members (see the family tree in Figure 7 ). Among them, there is 1 patient (II-1) diagnosed with syndromic autosomal dominant hereditary auditory neuropathy, and the rest have normal phenotypes. Blood samples of the patient (II-1) and normal individuals (I-1, I-2) were collected. 2 mL of peripheral blood samples were collected for each sample, anticoagulated with EDTA, and stored at -80 °C.

[0127] 2. DNA extraction

[0128] DNA was extracted from peripheral blood samples using the OMEGA Blood DNA Midi Kit whole blood DNA extraction kit. The extraction steps are as follows:

[0129] (1) Take 2 mL of whole blood sample, add 150 μL of OB Protease, 2.1 mL of Buffer BL, and 20 μL of RNase A, vortex at maximum speed for 1 minute to thoroughly mix;

[0130] (2) Incubate in a water bath at 65 °C for 15 - 20 minutes, and vortex 5 times during the water bath;

[0131] (3) Add 2.2 mL of absolute ethanol, vortex at maximum speed for 30 seconds to thoroughly mix;

[0132] (4) Transfer 3.5 mL of lysate into a 15 mL centrifuge tube with a filter column, centrifuge at 4000 rpm for 5 minutes, take out the filter column, pour out the filtered liquid, and put the filter column back;

[0133] (5) Add the remaining lysate from step 3 into a 15 mL centrifuge tube with a filter column, centrifuge at 4000 rpm for 5 minutes, take out the filter column, pour out the filtered liquid, and put the filter column back;

[0134] (6) Add 3 mL of HB Buffer to wash the filter column, centrifuge at 4000 rpm for 5 minutes, take out the filter column, pour out the filtered liquid, and put the filter column back;

[0135] (7) Add 3 mL of DNA Wash Buffer, centrifuge at 4000 rpm for 5 minutes, take out the filter column, pour out the filtered liquid, and put the filter column back;

[0136] (8) Add another 3 mL of DNA Wash Buffer, centrifuge at 4000 rpm for 5 minutes, take out the filter column, pour out the filtered liquid, and put the filter column back;

[0137] (9) Centrifuge at 4000 rpm for 15 minutes to spin-dry the filter column;

[0138] (10) Transfer the filter column to a new 15 mL centrifuge tube, add 500 μL of 70 °C Elution Buffer, let it stand at room temperature for 5 minutes, centrifuge at 4000 rpm for 5 minutes, and collect the filtered liquid containing DNA;

[0139] (11) Transfer the filter column to a new 15 mL centrifuge tube again, add 500 μL of 70 °C Elution Buffer, let it stand at room temperature for 5 minutes, centrifuge at 4000 rpm for 5 minutes, and collect the filtered liquid containing DNA.

[0140] 3. Exon Capture Sequencing and Variant Analysis

[0141] Perform whole-exome sequencing and data analysis on 3 samples (I:1, I:2, II:1) in the pedigree. Among them, based on the MGISEQ-2000 high-throughput sequencing platform, use the BGI V4 chip to perform whole-exome capture sequencing on the above 3 samples. The specific steps are as follows:

[0142] (1) Sample Preparation

[0143] Respectively take the genomic DNA of the peripheral blood samples of the above 3 samples (I:1, I:2, II:1), use a spectrophotometer and gel electrophoresis to measure the concentration and purity of the DNA. The OD260 / OD280 of the genomic DNA of each specimen is between 1.7 and 2.0, the concentration is not less than 200 ng / μL, and the total amount is not less than 30 μg, for standby.

[0144] (2) Library Construction and Sequencing

[0145] Use adaptive high-focus ultrasound technology (Covaris) to randomly fragment each genomic DNA sample into fragments about 150 - 200 bp in length. Subsequently, according to the operation manual provided by the manufacturer, ligate adapters to both ends of the fragments to prepare the library (for reference, see the Illumina / Solexa standard library construction manual provided by http: / / www.illumina.com / ).

[0146] The library preparation process and sequencing process are as described below:

[0147] a) Primer design: The primers used for library construction were synthesized by Sangon Biotech Co., Ltd., and the primer specificity was verified using PrimerBLAST (http: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). The primer sequences are as follows:

[0148] Primer-F3 (5’→3’): CTGTGTTTCGGGAGGGAGAC;

[0149] Primer-R3 (5’→3’): AGTTCTGTATTTTGGACTCCAGTT.

[0150] b) The extracted DNA specimens were amplified using the designed primers to obtain PCR products.

[0151] PCR reaction system (20 μL): 10 μL Taq mix, 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 1 μL template, 7 μL double-distilled water; The PCR reaction conditions are shown in Table 3.

[0152]

[0153] c) PCR product analysis: A 1.5% agarose gel was prepared, and 2 μL loading buffer was mixed with 4 μL DNA amplification product and then electrophoresed to analyze the electrophoresis pattern.

[0154] d) Samples with a single band pattern and relatively high concentration were selected. After PCR product purification, a sequencing library was obtained. After the library passed the inspection, it could be sequenced on the machine to obtain the original sequencing data. Among them, sequencing was carried out according to the protocol of Illumina standard clustering and sequencing. The sequencing platform was MGISEQ-2000, the read length was 90 bp, the average sequencing depth of the target region was ≥180X, and the proportion of sites with an average depth >20X in the target region was >95%.

[0155] (3) Mutation detection and screening

[0156] The above-mentioned sequencing output data were successively subjected to preliminary statistical analysis, SNP detection and annotation, and prediction of amino acid substitutions. The main steps are as follows:

[0157] a) Perform basic data analysis and statistics on the sequencing output data: analyze the length of the measured sequence reads, count the number of reads and the data output, align the read sequences with the reference genome sequence, and count the coverage (Coverage) and sequencing depth (Depth) of the reads in the target region aligned to the reference genome. Based on the statistical results of the above basic data, obtain the basic information of the samples captured by exon capture and determine whether the data meets the requirements.

[0158] b) Align the high-quality original reads of each sample to the reference genome (hg19) using the Burrows-Wheeler Aligner (BWA, v0.7.10) alignment software. Then, use the Genome Analysis Toolkit (GATK, v3.3-0) software to detect SNPs and Indels, and use the Variant Effect Predictor (VEP) to annotate the detected variations. At the same time, add frequency databases such as 1KG / ESP / HapMap / ExAC / gnomAD and information such as OMIM, GO, KEGG, and pathogenicity prediction.

[0159] 4. Analysis Results

[0160] According to the patient phenotype and family inheritance pattern, that is, one of the father or mother carries a mutation, the child carries a mutation, or each of the parents has a mutation in the same gene and the child has two mutations at the same time (compound heterozygosity), or the parents are normal and the child carries a mutation. It is found that the mutation on the OPA1 gene meets the conditions. In the proband II-1, a c.2635_2639delTTGTT ( Figure 8 ) variation was detected in the OPA1 gene. The deletion of the base TTGTT at c.2635_2639 results in a heterozygous frameshift variation ( Figure 9 ), and it can be judged as the pathogenic cause of syndromic autosomal dominant hereditary hearing neuropathy. Family members I-1 and I-2 are both normal. Through the analysis of the ACMG / AMP variation interpretation guidelines, this variation has the following evidence: PVS1+PM2. Among them, PVS1: the disease pathogenic mechanism is loss of function, and the detected variation is a frameshift mutation of a non-functional variation; PM2: this variation was not found in the normal control populations of the ESP database, the 1000 Genomes database, and the EXAC database. Therefore, it can be judged that this variation site is a possible pathogenic variant site of syndromic autosomal dominant hereditary hearing neuropathy.

[0161] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, in accordance with the principle of the present invention, this application intends to cover any modifications, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application but are made using conventional techniques known in the art. Some basic features can be applied within the scope of the following appended claims.

Claims

1. Use of a substance for detecting the genotype of OPA1 gene mutation sites in the preparation of a product for diagnosing or assisting in the diagnosis of syndromic hereditary deafness; The OPA1 gene mutation sites are any one of the following three sites: the 1333rd nucleotide of the OPA1 gene, the 1555th nucleotide of the OPA1 gene, and the 2635 - 2639th nucleotides of the OPA1 gene.

2. Use of a substance for detecting the genotype of OPA1 gene mutation sites in the diagnosis or assistance in the diagnosis of syndromic hereditary deafness; The OPA1 gene mutation sites are any one of the following three sites: the 1333rd nucleotide of the OPA1 gene, the 1555th nucleotide of the OPA1 gene, and the 2635 - 2639th nucleotides of the OPA1 gene.

3. Use of a substance for detecting the genotype of OPA1 gene mutation sites in the preparation of a product for screening or assisting in the screening of individuals susceptible to syndromic hereditary deafness; The OPA1 gene mutation sites are any one of the following three sites: the 1333rd nucleotide of the OPA1 gene, the 1555th nucleotide of the OPA1 gene, and the 2635 - 2639th nucleotides of the OPA1 gene.

4. Use of a substance for detecting the genotype of OPA1 gene mutation sites in the screening or assistance in the screening of individuals susceptible to syndromic hereditary deafness; The OPA1 gene mutation sites are any one of the following three sites: the 1333rd nucleotide of the OPA1 gene, the 1555th nucleotide of the OPA1 gene, and the 2635 - 2639th nucleotides of the OPA1 gene.

5. Use of a substance for detecting the genotype of OPA1 gene mutation sites in the preparation of a product for evaluating or assisting in the evaluation of the risk of syndromic hereditary deafness in a subject to be tested; The OPA1 gene mutation sites are any one of the following three sites: the 1333rd nucleotide of the OPA1 gene, the 1555th nucleotide of the OPA1 gene, and the 2635 - 2639th nucleotides of the OPA1 gene.

6. Use of a substance for detecting the genotype of OPA1 gene mutation sites in the evaluation or assistance in the evaluation of the risk of syndromic hereditary deafness in a subject to be tested; The OPA1 gene mutation sites are any one of the following three sites: the 1333rd nucleotide of the OPA1 gene, the 1555th nucleotide of the OPA1 gene, and the 2635 - 2639th nucleotides of the OPA1 gene.

7. A product comprising a substance for detecting the genotype of OPA1 gene mutation sites; The function of the product is any one of the following A1) - A3): A1) Diagnosing or assisting in the diagnosis of syndromic hereditary deafness; A2) Screening or assisting in the screening of individuals prone to syndromic hereditary deafness; A3) Evaluating or assisting in the evaluation of the risk of syndromic hereditary deafness in a subject to be tested; The OPA1 gene mutation site is any one of the following three sites: the 1333rd nucleotide of the OPA1 gene, the 1555th nucleotide of the OPA1 gene, and the 2635 - 2639th nucleotides of the OPA1 gene.

8. Any one of the following biomaterials B1)-B5): B1) An OPA1 mutant gene, which is a gene obtained by mutating the base C at the 1333rd position in the OPA1 wild-type gene sequence to base G, or a gene obtained by mutating the base G at the 1555th position in the OPA1 wild-type gene sequence to base A, or a gene obtained by deleting the base TTGTT shown at the 2635 - 2639th positions in the OPA1 wild-type gene sequence; B2) An OPA1 mutant protein, which is a protein obtained by mutating the 445th amino acid of the OPA1 wild-type protein from arginine to glycine, or a protein obtained by mutating the 519th amino acid of the OPA1 wild-type protein from glutamate to lysine, or a protein with an amino acid sequence as shown in Sequence 3; B3) A recombinant vector, which contains the OPA1 mutant gene described in B1) or expresses the OPA1 mutant protein described in B2); B4) A recombinant cell, which contains the OPA1 mutant gene described in B1) or expresses the OPA1 mutant protein described in B2) or contains the recombinant vector described in B3); B5) An animal model, which contains the OPA1 mutant gene described in B1) or expresses the OPA1 mutant protein described in B2) or contains the recombinant vector described in B3) or contains the recombinant cell described in B4).

9. Use of the biomaterial according to claim 8 in the development or screening of drugs for the treatment or adjuvant treatment of syndromic hereditary deafness.

10. The use according to any one of claims 1 - 6, or the product according to claim 7, or the use according to claim 9, characterized in that: The syndromic hereditary deafness is syndromic autosomal dominant hereditary deafness.

Images