EP300 gene single nucleotide polymorphism molecular marker related to chicken carcass traits and application thereof

Abstract

The invention discloses an EP300 gene single nucleotide polymorphism molecular marker related to chicken carcass traits and application of the molecular marker, and belongs to the technical field of breeding of improved varieties of animal husbandry. The invention provides three SNP molecular markers obviously related to chicken carcass traits in an EP300 gene, the nucleotide sequences of the three SNP molecular markers are shown as SEQ ID NO.1, and the SNP sites and polymorphism of the three SNP molecular markers are Cgt existing at the 697th site on the sequence shown as SEQ ID NO.1; t mutation exists, and Tgt exists at the 707th site; c mutation and Ggt existing at the 732 site; a mutation. Experimental results show that the three molecular markers are all significantly related to the full eviscerating weight and the wing weight of the chicken (Plt; 0.05) of the method. The molecular marker provided by the invention can accurately identify the carcass traits of the chickens, provides a scientific basis for breeding of chickens with high-quality carcass traits, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of livestock improved breed reproduction, and particularly to single nucleotide polymorphism molecular markers of the EP300 gene related to chicken carcass traits and their applications. Background Art

[0002] In modern poultry farming, as an important economic animal, the carcass traits of chickens are one of the core factors determining their market value. Single nucleotide polymorphism (SNP) is the most widespread form of genetic variation in the genome, accounting for more than 90% of all known genetic variations. SNP refers to the variation of a single nucleotide in the genome, including base transitions, transversions, insertions or deletions. Recent studies have shown that SNPs in the genome have a significant impact on the production performance of animals, especially in aspects such as growth rate, meat quality, feed conversion efficiency, and disease resistance. In addition, SNPs can also be used as important tools for molecular marker-assisted selection (MAS). By early screening and precise breeding, the breeding efficiency and selection effect can be significantly improved, providing strong support for the sustainable development of the poultry industry.

[0003] The E1A binding protein p300 (EP300) gene encodes a transcriptional co-activator protein and belongs to the histone acetyltransferase (HAT) family. This gene regulates gene transcription through chromatin remodeling and plays an important role in biological processes such as cell proliferation, differentiation, and cell cycle regulation. However, SNP sites or molecular markers designed based on the EP300 gene have not been reported yet. Summary of the Invention

[0004] The object of the present invention is to provide single nucleotide polymorphism molecular markers of the EP300 gene related to chicken carcass traits and their applications to solve the problems existing in the above-mentioned prior art. The present invention discovers that multiple SNP sites of the chicken EP300 gene are significantly correlated with chicken carcass traits, and provides a new SNP molecular marker in combination with chicken carcass trait indicators, which can be used to efficiently screen chicken breeds with outstanding carcass traits.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a molecular marker related to chicken carcass traits. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, and there is a C>T mutation at the 697th position of the sequence shown in SEQ ID NO.1; the genotypes at the 697th position of the sequence shown in SEQ ID NO.1 include CC, CT, and TT.

[0007] Preferably, the chicken carcass traits are the dressed weight and the wing weight, and the dressed weight and wing weight of the TT genotype are significantly greater than those of the CC genotype.

[0008] The present invention provides a molecular marker related to chicken carcass traits. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a T>C mutation at position 707 of the sequence shown in SEQ ID NO.1; the genotypes at position 707 of the sequence shown in SEQ ID NO.1 include TT, CT, and CC.

[0009] Preferably, the chicken carcass traits are the dressed weight and the wing weight, and the dressed weight and wing weight of the CC genotype are significantly greater than those of the TT genotype.

[0010] The present invention provides a molecular marker related to chicken carcass traits. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a G>A mutation at position 732 of the sequence shown in SEQ ID NO.1; the genotypes at position 732 of the sequence shown in SEQ ID NO.1 include GG, GA, and AA.

[0011] Preferably, the chicken carcass traits are the dressed weight and the wing weight, and the dressed weight and wing weight of the AA genotype are significantly greater than those of the GG genotype.

[0012] The present invention also provides a combination of molecular markers related to chicken carcass traits, and the combination of molecular markers includes at least two of the above three molecular markers.

[0013] The present invention also provides a primer pair for amplifying the above molecular marker or the above combination of molecular markers. The primer pair includes an upstream primer with a nucleotide sequence shown in SEQ ID NO.2 and a downstream primer with a nucleotide sequence shown in SEQ ID NO.3.

[0014] The present invention also provides an application of the above molecular marker or the above combination of molecular markers or the above primer pair in the preparation of a product for identifying chicken carcass traits.

[0015] Preferably, the product is a kit.

[0016] The present invention also provides a kit for identifying chicken carcass traits, which includes the above primer pair.

[0017] The present invention also provides a method for identifying chicken carcass traits, which includes the following steps:

[0018] Extract the DNA of the chicken to be tested, and use the above primer pair or the above kit for amplification to obtain an amplification product;

[0019] Sequence the amplified product to detect the genotype of the above-mentioned molecular marker;

[0020] Based on the genotyping results, judge the carcass traits of the chicken to be tested.

[0021] Preferably, the chicken carcass traits are the eviscerated weight and the wing weight. When the genotype at position 697 of the sequence shown in SEQ ID NO.1 is TT, and / or

[0022] When the genotype at position 707 of the sequence shown in SEQ ID NO.1 is CC, and / or

[0023] When the genotype at position 732 of the sequence shown in SEQ ID NO.1 is AA, judge that the eviscerated weight and the wing weight of the chicken to be tested are large.

[0024] The present invention also provides an application of the above-mentioned molecular marker, the above-mentioned molecular marker combination, the above-mentioned primer pair or the above-mentioned kit in identifying chicken carcass traits.

[0025] The present invention also provides an application of the above-mentioned molecular marker, the above-mentioned molecular marker combination, the above-mentioned primer pair or the above-mentioned kit in chicken carcass trait breeding.

[0026] The present invention discloses the following technical effects:

[0027] By analyzing the EP300 gene, the present invention finds that there are multiple SNP sites in this gene that are significantly related to chicken carcass performance, providing new SNP molecular markers for marker-assisted selection. And through experimental verification, the molecular marker NC_052532.1:g.49850393 is significantly related to both the eviscerated weight and the wing weight (P<0.05), and the difference in the eviscerated weight and the wing weight between the CC genotype and the TT genotype is significant (P<0.05); NC_052532.1:g.49850383 is significantly related to both the eviscerated weight and the wing weight (P<0.05), and the difference in the eviscerated weight and the wing weight between the TT genotype and the CC genotype is significant (P<0.05); NC_052532.1:g.49850358 is significantly related to the eviscerated weight and the wing weight (P<0.05), and the difference in the eviscerated weight and the wing weight between the GG genotype and the AA genotype is significant (P<0.05). It can be seen that the molecular markers provided by the present invention can accurately identify the carcass traits of chickens, providing a scientific basis for the breeding of chickens with high-quality carcass traits and having broad application prospects. Description of the Drawings

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can be obtained based on these drawings.

[0029] Figure 1 It is a schematic diagram of the position of the EP300 gene on the chromosome and primer design;

[0030] Figure 2 It is a schematic diagram of the SNP sites and nucleotide polymorphisms of the EP300 gene. Detailed implementation manners

[0031] Now, the various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be regarded as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0032] It should be understood that the terms used in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0033] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0034] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are also obvious to those skilled in the art. The present invention specification and embodiments are only exemplary.

[0035] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0036] Example 1

[0037] 1. Materials and Methods

[0038] 1.1 Animal Samples

[0039] A total of 282 small white - feather broilers, slow - growing yellow - feather broilers, and fast - growing white - feather broilers at 45 days of age were selected. 2 mL of subcutaneous venous blood was collected and stored at - 80 °C for use as DNA extraction samples. Record the carcass traits of the selected population, such as chest angle, chest depth, chest width, live weight, shank length, shank circumference, body diagonal length, keel length, comb height, dressed weight, subcutaneous fat thickness, intramuscular fat width, semi - eviscerated weight, eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, chicken claw weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, semi - eviscerated rate, eviscerated rate, abdominal fat rate, breast muscle rate, leg muscle rate, etc.

[0040] 1.2 Main Reagents

[0041] Blood DNA Extraction Kit (Brand: OMEGA; Catalog Number: D3392; Guangzhou Feiyang Biotechnology Co., Ltd.), 2×ES Taq Master Mix (Dye) (Brand: Novoprotein; Catalog Number: P222 - 01; Nanjing Novoprotein Biotechnology Co., Ltd.), DNAmarker (Brand: TransGen Biotech; Catalog Number: BM101 - 01; Beijing TransGen Biotech Co., Ltd.), high - purity low - electroendosmosis agarose (Brand: Tsingke; Catalog Number: TSJ001; Beijing Tsingke Biotechnology Co., Ltd.).

[0042] 1.3 Experimental Methods

[0043] 1.3.1 Primer Design

[0044] According to the sequence of the EP300 gene of Gallus gallus domesticus (NC_052532.1) published by NCBI, primers were designed using the Primer - BLAST tool of NCBI, and primer synthesis services were provided by Guangzhou Tsingke Biotechnology Co., Ltd. The relevant information of the primer sequences is shown in Table 1, and the schematic diagram of the primer sequences and the EP300 gene sequence is as Figure 1 shown.

[0045] Table 1 PCR Amplification Primer Sequences

[0046]

[0047] 1.3.2 Blood Sample DNA Extraction

[0048] Extract blood sample DNA with reference to the operation manual of the blood sample DNA extraction kit.

[0049] 1.3.3 PCR Amplification of EP300 Gene Sequence

[0050] Using the genomic DNA of the blood samples of the above 282 chickens as a template, the following reaction system was followed: 2 μL of template DNA, 15 μL of 2×ES Taq Master Mix (Dye), 1.2 μL of upstream primer, 1.2 μL of downstream primer, and 10.6 μL of ddH2O.

[0051] Reaction program: Pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 52°C for 15 s, extension at 72°C for 15 s, 34 cycles; final extension at 72°C for 5 min; storage at 4°C.

[0052] The PCR products were sent to Guangzhou Qingke Biotechnology Co., Ltd. for Sanger sequencing.

[0053] 1.3.4 SNPs Determination and Genotyping

[0054] The SnapGene software was used to analyze the sequence peak maps of the Sanger sequencing results of the PCR products to determine potential SNP sites.

[0055] By comparing the sequencing data of each sample using the SnapGene software, genotyping was performed.

[0056] 1.3.5 Association Analysis between Genotype and Carcass Traits

[0057] The carcass trait data of the individuals corresponding to the SNPs sites and genotypes were subjected to association analysis using SPSS 26.0.

[0058] 2. Results

[0059] 2.1 PCR Amplification of EP300 Gene Sequence and SNP Screening

[0060] Selecting the above 282 chicken individuals, PCR amplification was performed using the blood sample DNA of each individual as a template. The obtained PCR products (nucleotide sequence as shown in SEQ ID NO.1) were subjected to Sanger sequencing. The sequenced peak maps were compared and analyzed, and a total of 3 SNP sites were detected, namely: NC_052532.1:g.49850393, NC_052532.1:g.49850383, NC_052532.1:g.49850358 sites, as Figure 2 shown.

[0061] The NC_052532.1:g.49850393 site is located at the 697th nucleotide of the sequence shown in SEQ ID NO.1, with a C>T mutation; the genotypes include CC, CT, and TT.

[0062] The position of NC_052532.1:g.49850383 is at the 707th nucleotide of the sequence shown in SEQ ID NO.1, with a T>C mutation; the genotypes include TT, CT, and CC.

[0063] The position of NC_052532.1:g.49850383 is at the 732nd nucleotide of the sequence shown in SEQ ID NO.1, with a G>A mutation; the genotypes include GG, GA, and AA.

[0064] SEQ ID NO.1:

[0065] GTTGGGAGTTGCTTGTACCCTGGTGATGATCCTCTTTGACCTGGGAATACACAATGTAATTGTCATCTTGCTTTGAAGTGGCAGAATATTCTGCTGCTGCTGATAGCTAGTTTTTGTGGAAGCTTTCTAACTTTTCTAGCAGGAGAGTGGTAAGGGTGAACAAGAACTGTAGTGTTCTTAACCAGTTGATGTGCTTTTCTCTACCACCTGTTGGAGCTGATGATCTCCTGCAGATAAGCATGCGCATAGAGAGGGTTGTGCCATTTCAGCTTTGTTCTGTCTTCCTCTGTTTTCCTTTTCCCTCTTCCCCTTTCTGACTCCTTGGTCTTCCTGCCAAAATTTGCAAGATATCTTGTATCCTGTATCCTCATGGTTCTTAATGTTATTTTGGGCTCTTTGCATGACATGAACTGGGATATTTCTTGTTCTAAGAAAATAACAAAGTATGGCTGTTGAAGAGCTGAACCCTTCTGCCTTTAAACTCTGTGACGTGTGCTTCTGTTCTCAATTTTGAGCAAACAATCTCCTAAATACTTAAGGATTTCTTCTCAGCAGCTCAGAAGGAAAACAATGTTACTGAAATGACTGCTTGGGTCAAAATCTATTCTCCCTTTTCACAGTGGCTTTTCCAGACCTGGCATCTTACTTGCGTAGTCCTAGATGGGGACGTTTTGGTTCTGAACAACCAGCAGTCTCCTCCCTCTTTTTGTAGACCTCTTTGACTACCTCCC GCTGTCCTTACTAACTTTGGTGCATCTCTTCTAGCGCTACTGGGTGGAG CTGCAGTAGGACTTGCAAACACCGGCTCCGTGGGTGTGGGGCAGCAGACTACGCCCAGCATAAGCACTACCAGCCAGATA. Among them, the SNP sites are marked by underlines.

[0066] 2.2 Association analysis of SNP sites in the EP300 gene sequence and carcass traits

[0067] Association analysis was performed on the above 3 SNP sites and carcass traits (chest angle, chest depth, chest width, live weight, shank length, shank circumference, body slant length, keel length, comb height, carcass weight, subcutaneous fat thickness, intramuscular fat width, half-eviscerated weight, eviscerated weight, abdominal fat weight, wing weight, breast muscle weight, leg muscle weight, chicken claw weight, breast muscle shear force, leg muscle shear force, drip loss rate, cooking loss rate, breast muscle pH value, leg muscle pH value, breast muscle L value, breast muscle a value, breast muscle b value, leg muscle L value, leg muscle a value, leg muscle b value, dressing percentage, half-eviscerated percentage, eviscerated percentage, abdominal fat percentage, breast muscle percentage, leg muscle percentage, etc.).

[0068] As shown in Table 2, the results showed that the site NC_052532.1:g.49850393 was significantly correlated with both eviscerated weight and wing weight (P<0.05). Among them, the eviscerated weight and wing weight of the TT genotype were significantly greater than those of the CC genotype (P<0.05).

[0069] Table 2 Association of SNP sites and carcass traits

[0070]

[0071] Note: Different lowercase letters in the superscript indicate significant differences (P<0.05).

[0072] As shown in Table 3, the results showed that the site NC_052532.1:g.49850383 was significantly correlated with both eviscerated weight and wing weight (P<0.05). Among them, the eviscerated weight and wing weight of the CC genotype were significantly greater than those of the TT genotype (P<0.05).

[0073] Table 3 Association of SNP sites and carcass traits

[0074]

[0075] Note: Different lowercase letters in the superscript indicate significant differences (P<0.05).

[0076] As shown in Table 4, the results showed that the locus NC_052532.1:g.49850358 was significantly correlated with the dressed weight and wing weight (P<0.05). Among them, the dressed weight and wing weight of the AA genotype were significantly greater than those of the GG genotype (P<0.05).

[0077] Table 4 Association between SNP Loci and Carcass Traits

[0078]

[0079] Note: Different lowercase letters in superscript indicate significant differences (P<0.05).

[0080] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker associated with chicken carcass traits, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a C>T mutation at position 697 of the sequence shown in SEQ ID NO.1; the genotype at position 697 of the sequence shown in SEQ ID NO.1 includes CC, CT and TT.

2. A molecular marker associated with chicken carcass traits, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a T>C mutation at position 707 of the sequence shown in SEQ ID NO.1; the genotype at position 707 of the sequence shown in SEQ ID NO.1 includes TT, CT and CC.

3. A molecular marker associated with chicken carcass traits, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and there is a G>A mutation at position 732 of the sequence shown in SEQ ID NO.1; the genotype at position 732 of the sequence shown in SEQ ID NO.1 includes GG, GA and AA.

4. A molecular marker combination associated with chicken carcass traits, characterized in that: The method comprises at least two of the molecular marker according to claim 1, the molecular marker according to claim 2, and the molecular marker according to claim 3.

5. A primer pair for amplifying the molecular marker according to any one of claims 1 to 3 or the molecular marker combination according to claim 4, characterized in that: The primer pair includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.

3.

6. Use of the molecular marker according to any one of claims 1 to 3, the molecular marker combination according to claim 4, or the primer pair according to claim 5 in the preparation of a product for identifying chicken carcass traits.

7. A kit for identifying the characteristics of chicken carcasses, characterized in that: Comprising the primer pair described in claim 5.

8. A method for identifying the characteristics of chicken carcasses, characterized in that: The following steps are involved: Extracting DNA from the chicken to be tested, and amplifying it using the primer pair described in claim 5 or the kit described in claim 7 to obtain an amplified product; Sequencing the amplified product to detect the genotype of the molecular marker according to any one of claims 1 to 3; According to the genotyping results, the carcass traits of the chicken to be tested are determined.

9. Use of the molecular marker according to any one of claims 1 to 3, the molecular marker combination according to claim 4, the primer pair according to claim 5 or the kit according to claim 7 in identifying chicken carcass traits.

10. Use of the molecular marker according to any one of claims 1 to 3, the molecular marker combination according to claim 4, the primer pair according to claim 5 or the kit according to claim 7 in chicken carcass trait breeding.

Images