A SLC26A11 gene SNP primer related to androstenediol content in musk deer musk and its application

Abstract

The present invention relates to an SLC26A11 gene SNP primer and application related to the androstenediol content in musk deer, belonging to the field of biotechnology. The present invention provides an SLC26A11 gene SNP primer related to the androstenediol content in musk deer, the molecular marker corresponding to the SNP primer is located at base 55966787 of chromosome 21 of the musk deer reference genome, the base mutation is A or G, the genotype is AG, GG, and the deoxyribonucleotide sequence of the SNP primer is shown in SEQ ID NO: 1 and SEQ ID NO: 2. The detection method disclosed in the present invention is simple and easy to operate, can be carried out in the laboratory, and can also be applied to genomic breeding technology. Its beneficial effect is that it can efficiently and quickly identify the relative content of androstenediol in musk deer, providing a scientific basis for the early selection of high-quality musk deer.

Description

Technical Field

[0001] The invention relates to an SLC26A11 gene SNP primer related to the androstenediol content in musk deer antler and an application thereof, belonging to the field of biotechnology. Background Art

[0002] Musk is a natural fragrance and a raw material for traditional Chinese medicine derived from members of the family Musk Deer. Musk is a dried secretion from the glands of male forest musk deer, matured over a long period of time. Its unique aroma and valuable medicinal properties have made it highly sought after, though this has indirectly contributed to the endangered status of wild musk deer. To preserve biodiversity, preserve the culture of Traditional Chinese Medicine, and promote the sustainable development of related industries, my country has developed musk deer farming to obtain natural musk. Decades of research have gradually revealed the composition of musk, primarily macrocyclic ketones, steroids, fatty acids, amino acids, and inorganic salts. It is widely used in various fields. In medicine, it has therapeutic effects against a variety of conditions, including tumors, cardiovascular and cerebrovascular diseases, and neurological disorders. From a fragrance perspective, musk has a unique and captivating fragrance that is soft and long-lasting. It enhances the unique allure and quality of various high-end perfumes and aromatherapy products, making it highly sought after and highly valued in the international fragrance market. Among them, the analyzed androstenediol, as part of the musk component, has a certain contribution to the formation of musk fragrance. It can work together with other components to produce a unique fragrance. Secondly, as a steroid compound, androstenediol is used as a model compound for steroid metabolism, endocrine system function, and related diseases. It has certain activity and can participate in some physiological processes such as endocrine regulation of musk deer. It acts as a pheromone for male musk deer to find mates during the breeding season. Therefore, conducting research on improving musk deer has become an urgent need for the development of the traditional Chinese medicine industry. It is urgent to find suitable molecular markers to quickly and accurately identify musk deer individuals with high androstenediol production. This can achieve early breeding, achieve the goal of improving the quality of natural musk, and establish evaluation standards for natural musk. Summary of the Invention

[0003] The purpose of the present invention is to address the defects of the existing technology, propose a SLC26A11 gene SNP primer related to the androstenediol content in musk deer and its application, and quickly and accurately identify traits related to the androstenediol content in musk deer.

[0004] The SLC26A11 gene encodes a transmembrane protein belonging to the SLC26 (Solute Carrier Family 26) family. Members of this family are typically involved in ion transport, regulating intracellular and extracellular ion homeostasis and pH. The protein encoded by the SLC26A11 gene, also known as pendrin, is primarily expressed in the kidney, thyroid, and ear. The SLC26A11 gene may indirectly participate in musk synthesis by regulating sulfate metabolism or the cellular ionic environment, affecting the modification, transport, or excretion of androgens. Research has shown that hormones play a significant role in musk maturation, promoting its maturation and ultimately achieving high-quality musk. Studies on the composition and characteristics of natural musk from forest musk deer have shown a significant correlation between the SLC26A11 gene and the relative content of androstenediol.

[0005] The present invention measured the content of androstenediol in musk components using liquid chromatography-mass spectrometry (LC / MS), performed SNP genotyping using whole-genome resequencing technology, and screened the SLC26A11 gene molecular marker significantly correlated with the relative content of androstenediol through whole-genome association analysis, providing new gene and molecular marker resources for the breeding of high-yield androstenediol traits in musk deer.

[0006] The present invention solves the technical problem through the following technical solution: a SLC26A11 gene SNP primer related to the androstenediol content in musk deer, the deoxyribonucleotide sequences of the SNP primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2, the SNP is located at base 55966787 of chromosome 21 of the musk deer reference genome, the base mutation is A or G, and the genotype is GG or AG. The musk deer reference genome is the only high-quality musk deer reference genome successfully assembled at the chromosome level in 2022 and published on the website http: / / muskdb.cn / .

[0007] The present invention further provides the use of SLC26A11 gene SNP primers related to the androstenediol content in musk deer, for detecting the SNP molecular marker genotype of androstenediol content in musk deer. The detection method comprises the following steps:

[0008] The first step is to detect the musk deer DNA sample and perform PCR amplification using the SNP primers to obtain an amplified product;

[0009] The second step is to perform Sanger sequencing on the amplified product;

[0010] The third step is to determine the molecular marker genotype of the target site based on the sequencing results obtained in the second step.

[0011] The deoxyribonucleotide sequence of the musk deer-specific primer pair in the first step of the above method consists of AGAAGCAGAGCAGGAACGTC upstream and CAGTGCGCCAGTGTCTAAGT downstream, and the amplified product is 955 bp long and contains the 55966787th base on chromosome 21 of the musk deer reference genome.

[0012] The final volume of the PCR reaction system is 50 μl.

[0013] 50 ng of musk deer DNA to be tested,

[0014] 2 x Accurate Taq Master Mix 25μl,

[0015] Upstream primer 2 μl,

[0016] 2 μl of downstream primer,

[0017] Sterile water is added to make up to 50 μl.

[0018] The reaction conditions of the PCR amplification are: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 58°C for 15 seconds, extension at 72°C for 15 seconds, for a total of 35 cycles, extension at 72°C for 5 minutes; and storage at 4°C.

[0019] The nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0020] In the third step, the judgment criterion is that the relative content of androstenediol in individuals with a genotype of the SNP site of G / G is higher than that in individuals with a genotype of G / A.

[0021] The present invention detects the genotype of the relevant traits of androstenediol content in musk deer by SLC26A11 gene molecular marker, and finds that the relative content of androstenediol in individuals with G / G genotype is higher than that of G / A genotype. By using the genomic DNA of the musk deer to be tested as a template, using a specific primer pair for PCR amplification, and then performing Sanger sequencing and SNP molecular marker genotyping on the PCR amplification product, the genotype based on the SNP molecular marker can be used to select the relative content trait of androstenediol in musk deer. In breeding, according to the breeding goals, by eliminating individuals with G / A genotype and retaining individuals with G / G genotype, the beneficial effect is that the relative content trait of androstenediol in musk deer can be identified efficiently and quickly, providing a scientific basis for the early selection of high-quality musk deer. In addition, the detection method disclosed in the present invention is simple and easy to operate, can be carried out in the laboratory, and can also be applied to genomic breeding technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is the Manhattan plot of the GWAS analysis of the relative content of androstenediol in musk deer.

[0023] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the two genotypes.

[0024] Figure 3 This is a violin plot of the phenotypic distribution of individuals with three genotypes of the chr21:55966787 molecular marker. DETAILED DESCRIPTION

[0025] The following examples are used for breeding of forest musk deer.

[0026] Example

[0027] In this example, the relative content of androstenediol in musk deer was measured, SNP genotyping was performed using whole genome resequencing technology, and the SLC26A11 gene molecular marker significantly correlated with the relative content of androstenediol was screened through whole genome association analysis. The results are as follows: Figure 1 shown.

[0028] This example uses the following experiments to identify and apply the SLC26A11 gene molecular marker related to the relative content of androstenediol in musk deer musk.

[0029] 1. Phenotypic and genotypic testing

[0030] (1) Experimental materials and determination of relative content of androstenediol in musk deer

[0031] 132 adult male forest musk deer were selected as experimental animals and housed under identical conditions with free access to food and water. Musk was collected from the musk deer during the musk season (October each year). LC / MS was then used to quantify androstenediol in the musk, providing phenotypic data.

[0032] 2) Extraction of genomic DNA

[0033] 1. According to the instructions of the TianGen DP602 kit, select 20 hairs with relatively rounded follicles. Aseptically collect the follicles (1 cm in length) and place them in an EP tube. Add 400 μl of Buffer GHA and 20 μl of Proteinase K reagent, mix thoroughly, centrifuge, and digest in a 65°C water bath overnight.

[0034] 2. Transfer the digested sample to a TGuide 96-deep-well plate after instant centrifugation. Place the 96-deep-well plate on the 96-deep-well plate base of the TGuide S16 fully automated nucleic acid extraction and purification instrument.

[0035] 3. Run the automatic extraction program of the TGuide S16 fully automatic nucleic acid extraction and purification instrument. The program is shown in Table 1:

[0036] slot name Mixing time (min) Magnetic segments Each magnetic attraction time (sec) Magnetic attraction speed (mm / s) 1 Cracking 2 1 0 6 Transfer magnetic beads 0.5 5 3 2.5 1 Combine 10 5 4 2.5 2 Rinse 1 5 5 3 2.5 3 Rinse 2 5 5 3 2.5 4 Rinse 3 5 5 3 2.5 5 Elution 10 5 5 2.5 6 Place magnetic beads 0.5 1 0

[0037] 4. After the program is completed, collect the DNA extract aseptically and store it at 4°C for later use.

[0038] (3) PCR amplification

[0039] Using the genomic DNA extracted above as a template, a fragment containing the SNP molecular marker at base position 55966787 on chromosome 21 of the forest musk deer was amplified.

[0040] Upstream primer: 5'- AGAAGCAGAGCAGGAACGTC-3' (SEQ ID NO: 1)

[0041] Downstream primer: 5'-CAGTGCGCCAGTGTCTAAGT-3' (SEQ ID NO: 2)

[0042] The amplified product is 955 bp in length.

[0043] The final volume of the reaction system is 50 μl:

[0044] 50 ng of musk deer DNA to be tested,

[0045] 2 x Accurate Taq Master Mix 25μl,

[0046] Upstream primer 2 μl,

[0047] Downstream primer 2 μl,

[0048] Sterile water is added to make up to 50 μl.

[0049] The reaction conditions for PCR amplification were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 15 sec, for a total of 35 cycles, and extension at 72°C for 5 min; storage at 4°C; 10 μl was taken for agarose detection, and a single target band with a length of 955 bp was amplified to obtain a product containing base 55,966,787 of chromosome 21 of musk deer.

[0050] The nucleotide sequences of the amplified products are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0051] (4) Sequencing verification and genotyping

[0052] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak diagram was as follows: Figure 2 shown.

[0053] 2. Results Analysis

[0054] 132 musk deer were selected and the relative content of androstenediol in their mature musk was measured by GC / MS for correlation analysis. The t.test function of R4.0 software was used for statistical testing, and the pairwise mean comparison mode was selected to perform statistical testing on the genotypes of the experimental musk deer and the relative content of androstenediol. P <0.001 indicates that the difference is extremely significant. The results are shown in Table 2 and Figure 3 As shown in the table, among the individuals tested, there were 16 individuals with AG genotype and 112 individuals with GG genotype. The relative content of androstenediol in musk deer of the two genotypes was significantly different ( P <0.01). The average relative androstenediol content of the GG genotype was 0.00189, significantly higher than the average relative androstenediol content of the AG genotype (0.00162). These results indicate that the SLC26A11 gene marker is significantly associated with the relative androstenediol content in musk deer. Based on actual breeding goals, individuals with the G / G genotype can be selected to increase androstenediol content and improve overall musk quality.

[0055] genotype Number / head Relative content of androstenediol / g Standard deviation CV G / G 112 <![CDATA[0.00189 a ]]> 7.91385E-06 4.19% G / A 16 <![CDATA[0.00162 b ]]> 1.47549E-05 9.10%

[0056] Note: The same letters in the same column indicate no significant difference, while different letters in the same column indicate significant difference. P <0.001).

[0057] In addition to the above embodiments, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the scope of protection required by the present invention.

Claims

1. A SLC26A11 gene SNP primer related to the androstenediol content in musk deer musk, characterized by: The deoxyribonucleotide sequences of the SNP primers are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The SNP is located at base 55966787 on chromosome 21 of the musk deer reference genome. The base mutation is A or G, and the genotype is GG or AG. The musk deer reference genome is published on http: / / muskdb.cn / .

2. The use of the SLC26A11 gene SNP primers related to the androstenediol content in musk deer according to claim 1, characterized in that: The method is used to detect the genotype of a SNP site related to androstenediol content in musk deer, wherein the SNP is located at base 55966787 of chromosome 21 of the musk deer reference genome, the base mutation is A or G, and the genotype is GG or AG. The musk deer reference genome is published on http: / / muskdb.cn / . The detection method comprises the following steps: The first step is to detect the musk deer DNA sample and perform PCR amplification using the SNP primers to obtain an amplified product; The second step is to perform Sanger sequencing on the amplified product; The third step is to determine the genotype of the target SNP site based on the sequencing results obtained in the second step. The relative content of androstenediol in individuals with a genotype of G / G at the SNP site is higher than that in individuals with a genotype of G / A.

3. The use of the SLC26A11 gene SNP primers related to the androstenediol content in musk deer musk as claimed in claim 2, characterized in that: In the first step, the final volume of the reaction system is 50 μl. 50 ng of musk deer DNA to be tested, 2 x Accurate Taq Master Mix 25μl, Upstream primer 2 μl, Downstream primer 2 μl, Sterile water is added to make up to 50 μl. The reaction conditions of the PCR amplification were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 15 sec, for a total of 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

Images