Primer probe combination, detection method and kit for identifying A, B and K subgroups of avian leukosis virus

Abstract

The invention relates to the field of virus detection, in particular to a primer probe combination, a detection method and a kit for identifying and detecting avian leukosis virus A, B and K subgroups. The invention provides a primer combination for identifying and detecting avian leukosis virus A, B and K subgroups, wherein the nucleotide sequences of the primer combination are as shown in SEQ ID NO: 1-SEQ ID NO: 9. The fluorescent quantitative RT-PCR detection method has the advantages of strong specificity, high sensitivity, good repeatability and the like, can accurately identify whether a sample contains the avian leukosis virus A subgroup, the avian leukosis virus B subgroup and the avian leukosis virus K subgroup or not, and can effectively solve the problem that infection of different strains is difficult to distinguish in the process of identifying, preventing and controlling the avian leukosis virus A / B / K subgroups.

Description

Technical Field

[0001] The invention relates to the field of virus detection, and specifically to a primer-probe combination, a detection method and a kit for differentially detecting subgroups A, B and K of avian leukosis virus. Background Art

[0002] Avian leukosis is a leukemia and neoplastic disease of poultry caused by avian leukosis virus. ALV is the main pathogen of chicken neoplastic diseases. The virus belongs to the Retroviridae family and is a member of the avian C-type retrovirus group. It is a single-stranded RNA virus with a full length of 7.2 - 7.8 kb and usually exists in the form of a dimer. According to the antigenicity difference of the viral envelope protein, virus interference experiments and host range, ALV can be divided into 11 subgroups (ALV-A - K) in total, and it is also the only known retrovirus with exogenous and endogenous repetitive activities at present. Subgroups A and B are common exogenous viruses, mainly infecting light commercial laying hens and causing lymphoid leukemia in chickens. Subgroups C and D are rarely reported exogenous viruses. ALV-E is an endogenous virus, which is not pathogenic or weakly pathogenic to chickens. In recent years, subgroup K of avian leukosis virus (ALV-K) has been isolated and identified from local breed chickens, and ALV-K has a relatively high isolation rate in yellow-feathered broilers and local breed chickens. The ALV coding region mainly encodes Gag, Pol and Env proteins, which are the virus group-specific protease, reverse transcriptase and envelope glycoprotein respectively. Among them, the Env gene is mainly closely related to the antigenicity, tumorigenic type and host range of the virus, and is the key gene for tumorigenesis. The nucleotide sequences of the Env gene vary greatly among different subgroups. This gene mainly encodes two envelope gene glycoproteins, namely envelope glycoprotein gp85 and transmembrane glycoprotein gp37.

[0003] The occurrence of ALV disease usually has a relatively long incubation period, and chronic tumors will gradually form during the disease development process. There are mainly two transmission routes for exogenous ALV, namely vertical transmission from parents to offspring through eggs and horizontal transmission among poultry through direct or indirect contact. Among them, vertical transmission is the main transmission method, which is sufficient to spread and prevail the virus from generation to generation, and horizontal transmission ensures the maintenance of vertical transmission. Especially, dying poultry maintains the prevalence and infection of the vertically transmitted virus through horizontal transmission, which has caused a great obstacle to the development of the breeding industry. The main detection and identification methods for ALV include virus isolation and identification, enzyme-linked immunosorbent assay, indirect immunofluorescence assay, rapid detection test strip, PCR technology, nucleic acid dot blot hybridization test, etc. The PCR method mainly focuses on subgroup ALV-J, and there are fewer rapid identification methods for other subgroups. Summary of the Invention

[0004] The object of the present invention is to provide a set of primer-probe combinations for rapidly differentiating subgroups A, B, and K of avian leukosis virus in view of the deficiencies of existing detection techniques for differentiating different subgroups of avian leukosis virus.

[0005] Another object of the present application is to provide a method for rapidly differentiating subgroups A, B, and K of avian leukosis virus, so as to solve the technical problems of low sensitivity, cumbersome operation, poor specificity, and easy generation of false positives existing in the existing detection techniques for subgroups A / B / K of avian leukosis virus.

[0006] Another object of the present invention is to provide a kit for differentiating and detecting subgroups A, B, and K of avian leukosis virus.

[0007] The present invention has designed three groups of RT-PCR primer sets for detecting subgroups A, B, and K of avian leukosis virus, including specific primers for ALV-A, the nucleotide sequences of which are shown in SEQ ID NO: 1-3; specific primers for ALV-B, the nucleotide sequences of which are shown in SEQ ID NO: 4-6; and specific primers for ALV-K, the nucleotide sequences of which are shown in SEQ ID NO: 7-9.

[0008] Among them, for the specific primer pair for detecting ALV-A, the primer pair includes the following primers:

[0009] SEQ ID NO: 1: 5'-CTCACAAGAACAGGGTCA-3',

[0010] SEQ ID NO: 2: 5'-CACTGGGTTTCAGGAGAA-3',

[0011] SEQ ID NO: 3: 5'-CAATACCGCTGTGGCAAGGC-3';

[0012] For the specific primer pair for detecting ALV-B, the primer pair includes the following primers:

[0013] SEQ ID NO: 4: 5'-GACCGGAGACAAGTTACA-3',

[0014] SEQ ID NO: 5: 5'-TACGGGCCTTATTAAAGAAAG-3',

[0015] SEQ ID NO: 6: 5'-CTTGACTGACCCAGGGAGCA-3';

[0016] For the specific primer pair for detecting ALV-K, the primer pair includes the following primers:

[0017] SEQ ID NO:7: 5’-GACAGGCTTTCAGATTGG-3’

[0018] SEQ ID NO:8: 5’-GTACCGCAGTACTCATTC-3’

[0019] SEQ ID NO:9: 5’-TCTATCCGCCGTTACCACCG-3’

[0020] Among them, the 5’ ends of SEQ ID NO:3, SEQ ID NO:6 and SEQ ID NO:9 are linked with fluorescent groups of different colors.

[0021] The present invention constructs standard plasmids of ALV-A, ALV-B and ALV-K as RT-PCR positive control DNA templates. Using the primer sets designed by the present invention, the optimal template concentration and the optimal primer concentration are determined by RT-PCR.

[0022] The present invention provides an RT-PCR detection method for rapidly differentiating and detecting subgroups A, B and K of avian leukosis virus. The detection method includes the step of performing PCR detection on a sample to be detected using the following primer pairs and probe pairs.

[0023] Among them, the specific primer pair for detecting ALV-A: SEQ ID NO:1, SEQ ID NO:2 and probe SEQ ID NO:3; the specific primer pair for detecting ALV-B: SEQ ID NO:4 and SEQ ID NO:5 and probe pair SEQ ID NO:6, and the specific primer pair for detecting ALV-K: SEQ ID NO:7 and SEQ ID NO:8 and probe pair SEQ ID NO:9.

[0024] Combining the results of collecting probe fluorescence signals, the infections of subgroups A, B and K of avian leukosis virus can be differentiated.

[0025] The RT-PCR detection method for rapidly differentiating and detecting subgroups A, B and K of avian leukosis virus according to the specific embodiments of the present invention includes the following steps:

[0026] Extract the genomic RNA of the sample to be detected;

[0027] Using the extracted RNA as a template, amplify using the primer-probe combination of the present application and collect specific probe signals.

[0028] Result determination: There are amplification curves for the fluorescent groups linked to the 5' ends of the positive control SEQ ID NO:3, SEQ ID NO:6, and SEQ ID NO:9, with Ct values less than 36. There is no amplification curve for the negative control standard. Otherwise, the test fails and needs to be redone.

[0029] For the sample to be tested, if there is an amplification curve for the fluorescent group signal linked to the 5' end of SEQ ID NO:3 and the Ct value < 36, then the sample to be tested is subgroup A of avian leukosis virus.

[0030] For the sample to be tested, if there is an amplification curve for the fluorescent group signal linked to the 5' end of SEQ ID NO:6 and the Ct value < 36, then the sample to be tested is subgroup B of avian leukosis virus.

[0031] For the sample to be tested, if there is an amplification curve for the fluorescent group signal linked to the 5' end of SEQ ID NO:9 and the Ct value < 36, then the sample to be tested is subgroup K of avian leukosis virus.

[0032] For the sample to be tested, if there is no amplification curve for the fluorescent group signals linked to the 5' ends of SEQ ID NO:3, SEQ ID NO:6, and SEQ ID NO:9, or the Ct value > 36, then the sample to be tested is not a strain of subgroup A / B / K of avian leukosis virus.

[0033] Preferably, the amplification conditions are: reverse transcription at 50°C for 10 min; pre-denaturation at 95°C for 1 min, denaturation at 95°C for 15 s, annealing and extension at 55°C for 30 s, 45 cycles, and fluorescence signals are collected at the end of each cycle.

[0034] The sample to be tested includes but is not limited to the environment, serum, tissue, excrement, and aerosol.

[0035] The present invention has the following advantages and beneficial effects:

[0036] The present invention provides a specific primer set for identifying subgroup A of avian leukosis virus, subgroup B of avian leukosis virus, and subgroup K of avian leukosis virus. Combining with the RT-PCR method to construct a fluorescence probe detection method, it is possible to determine whether it is ALV-A, ALV-B, and ALV-K without sequencing through the amplification curve and Ct value of the probe. This method can be applied to the infection identification of subgroup A / B / K of avian leukosis virus.

[0037] The fluorescence quantitative RT-PCR detection method provided by the present invention has the advantages of strong specificity, high sensitivity, and good repeatability. It can accurately identify whether the sample contains subgroup A of avian leukosis virus, subgroup B of avian leukosis virus, and subgroup K of avian leukosis virus, and can effectively solve the problem of difficult differentiation of different strain infections in the identification and prevention and control of subgroup A / B / K of avian leukosis virus. Brief Description of the Drawings

[0038] Figures 1 to 3 Show the detection results of the feasibility and specificity of ALV-A / B / K respectively;

[0039] Figures 4 to 5 Show the detection results of the sensitivity of ALV-A;

[0040] Figures 6 to 7 Show the detection results of the sensitivity of ALV-B;

[0041] Figures 8 to 9 Show the detection results of the sensitivity of ALV-K. Detailed Description of the Invention

[0042] The present invention will be further described below in conjunction with specific embodiments. Many specific details are set forth in the description to facilitate a full understanding of the present invention. However, these embodiments are only used to explain the present invention and not to limit the scope of the present invention. Without departing from the spirit and essence of the present invention, any modification or replacement of the methods, steps or conditions of the present invention shall fall within the scope of the present invention. Unless otherwise specified, the test methods used in the following embodiments are all conventional methods; the reagents and consumables used, unless otherwise specified, can all be obtained from commercial sources.

[0043] The present invention aims to provide a set of specific primer-probe combinations and detection methods for identifying infections of subgroup A, subgroup B, and subgroup K of avian leukosis virus, so as to solve the problem of identifying infections of subgroup A, subgroup B, and subgroup K of avian leukosis virus. The primer-probe combinations and detection methods can effectively identify subgroup A / B / K strains of avian leukosis virus.

[0044] The present invention adopts the following technical solutions:

[0045] The present invention provides a set of specific primer-probe combinations and detection methods for identifying subgroup A / B / K strains of avian leukosis virus. The detection reagents required for this detection method are composed of RT-PCR reaction reagents, three pairs of typing primers and probes, positive control and negative control samples.

[0046] (1) PCR reaction reagents: 5×FastAmpli RT Buffer (DG), 12.5×FastAmpli Part Taq / UNG Mix (with dNTPs) (DG), 50×FastAmpli Part RTase (DG).

[0047] (2) Three pairs of typing primers: The primer pair SEQ ID NO:1, SEQ ID NO:2 and probe SEQ ID NO:3 for subgroup A of avian leukosis virus, the primer pair SEQ ID NO:4, SEQ ID NO:5 and probe SEQ ID NO:6 for subgroup B of avian leukosis virus, the primer pair SEQ ID NO:7, SEQ ID NO:8 and probe SEQ ID NO:9 for subgroup K of avian leukosis virus. The primer concentration is 10 mM for each, and the sequences are as follows:

[0048] SEQ ID NO:1: 5’-CTCACAAGAACAGGGTCA-3’,

[0049] SEQ ID NO:2: 5’-CACTGGGTTTCAGGAGAA-3’,

[0050] SEQ ID NO:3: 5’-CAATACCGCTGTGGCAAGGC-3’;

[0051] SEQ ID NO:4: 5’-GACCGGAGACAAGTTACA-3’,

[0052] SEQ ID NO:5: 5’-TACGGGCCTTATTAAAGAAAG-3’,

[0053] SEQ ID NO:6: 5’-CTTGACTGACCCAGGGAGCA-3’;

[0054] SEQ ID NO:7: 5’-GACAGGCTTTCAGATTGG-3’,

[0055] SEQ ID NO:8: 5’-GTACCGCAGTACTCATTC-3’,

[0056] SEQ ID NO:9: 5’-TCTATCCGCCGTTACCACCG-3’.

[0057] (3) Positive controls: Respectively include the ALV-A positive control plasmid with the gene sequence SEQ ID NO:10, the ALV-B positive control plasmid with the gene sequence SEQ ID NO:11, and the ALV-K positive control plasmid with the gene sequence SEQ ID NO:12.

[0058] SEQ ID NO:10:

[0059] 5’ATCCTCCTTTTCTAATTCCACGGAACCATTTACGGTGGTGACAGCGGATAGA CACAATCTGTTTATGGGGAGTGAGTACTGTGGTGCATATGGCTACAGATTTTGGGAAGTATATAACTGCTCACAAGAACAGGGTCAGGGCCAACAGCAATACCGCTGTGGCAAGGCACGCAGCCCCCGCTCGGGTTCTCCTGAAACCCAGTGCATAAGGAGAGGAGGTAAATGGGTTAATCAATCACGGGAGATTAATGAAACAGAGCCGTTCAGCTTTACGGTGAACTGTACAGCTAGCAATTTGCG 3’

[0060] SEQ ID NO:11:

[0061] 5’ACTGTTAGGTTCCCAGTCTCTCCCTAATATAACTAATATTACTCAGATCCCTA GTGTGGCTGGGGGATGCATCGGTTTCACCCCGTACGGCAGTCCGGCGGGCGTTTACGGATGGGACCGGAGACAAGTTACACACATTCTCTTGACTGACCCAGGGAGCAATCCTTTCTTTAATAAGGCCCGTAACTCCTCGAAACCGTTTACAGTAGTGACAGCAGATAGGCACAATCTTTTTATGGGGAGTGAATATTGCGGTGCATATGGCTACAGATTTTGGGAGATGTACAATTGCTCACAAATGAGACAG 3’

[0062] SEQ ID NO:12:

[0063] 5’TACTAACATTACTCAGATCCCTGGCGTAGCAGGGGGATGCGTAGCTTTCGGCC CCCGGAGCATTGACAGGCTTTCAGATTGGTCCAGGCCGCAACTCACGAGGGAGCTCCTCGTCCGCCGCAATTATACAGAACCGTTTACGGTGGTAACGGCGGATAGACACAATCTTTTTAGGGGGAATGAGTACTGCGGTACATATGGTTACAGATTTTGGAAGCTATACAATTGTTCACAGAGAGGTCCTCGTTACTTCTGTGGACGTGTGCCCACAGGGGGCCTCCCTGAGACCGGGTGCACACGCACA 3’

[0064] (4) The negative control sample includes sterilized double-distilled water.

[0065] The amplification sequences of primers SEQ ID NO:1 to SEQ ID NO:3 are as follows (5′-3′):

[0066] SEQ ID NO:13:

[0067] CTCACAAGAACAGGGTCAGGGCCAACAGCAATACCGCTGTGGCAAGGCACGC AGCCCCCGCTCGGGTTCTCCTGAAACCCAGTG;

[0068] The amplification sequences of primers SEQ ID NO:4 to SEQ ID NO:6 are as follows (5′-3′):

[0069] SEQ ID NO:14:

[0070] GACCGGAGACAAGTTACACACATTCTCTTGACTGACCCAGGGAGCAATCCTTTCTTTAATAAGGCCCGTA;

[0071] The amplification sequences of primers SEQ ID NO:7 to SEQ ID NO:9 are as follows (5′-3′):

[0072] SEQ ID NO:15:

[0073] GACAGGCTTTCAGATTGGTCCAGGCCGCAACTCACGAGGGAGCTCCTCGT CCGCCGCAATTATACAGAACCGTTTACGGTGGTAACGGCGGATAGACACAATCT TTTTAGGGGGAATGAGTACTGCGGTAC。

[0074] In the present invention, the fluorescent groups used to label the probes include FAM, HEX, ROX, BHQ1, BHQ2, BHQ3, etc.

[0075] The usage method of the above detection reagent sequentially includes the following steps:

[0076] (1) RNA extraction: Extract the RNA of avian leukosis virus subgroup A / B / K strains using a magnetic bead method virus nucleic acid extraction kit. Using the extracted RNA as a template, mix the template, PCR reaction reagents, and primer pairs in proportion, perform amplification, and collect the corresponding fluorescence signals;

[0077] (2) RT-PCR amplification: The PCR amplification system is 25 μL, specifically including 5 μL of 5×FastAmpli RT Buffer (DG), 2 μL of 12.5×FastAmpli Part Taq / UNG Mix (with dNTPs) (DG), 0.5 μL of 50×FastAmpliPart RTase (DG), 5 μL of the extracted RNA template, 0.5 μL of primer pairs, 0.25 μL of probes, and 5 μL of ddH2O.

[0078] The amplification conditions are: reverse transcription at 50 °C for 10 min; pre-denaturation at 95 °C for 1 min, denaturation at 95 °C for 15 s, annealing and extension at 55 °C for 30 s, for 45 cycles, and collect the fluorescence signals at the end of each cycle.

[0079] (3) Result judgment: For the positive controls SEQ ID NO:3, SEQ ID NO:6, and SEQ ID NO:9, there are amplification curves for the fluorescent groups connected to the 5' ends, and the Ct values are less than 36. For the negative control standard product, there is no amplification curve. Otherwise, the test fails and needs to be redone;

[0080] For the test sample, if there is an amplification curve for the fluorescent group signal connected to the 5' end of SEQ ID NO:3 and the Ct value < 36, then the test sample is avian leukosis virus subgroup A;

[0081] For the test sample, if there is an amplification curve for the fluorescent group signal connected to the 5' end of SEQ ID NO:6 and the Ct value < 36, then the test sample is avian leukosis virus subgroup B;

[0082] For the sample to be tested, if there is an amplification curve for the fluorescence group signal linked to the 5'-end of SEQ ID NO:9 and the Ct value < 36, then the sample to be tested is subgroup K avian leukosis virus;

[0083] For the sample to be tested, if there is no amplification curve for the fluorescence group signals linked to the 5'-ends of SEQ ID NO:3, SEQ ID NO:6, and SEQ ID NO:9, or the Ct value > 36, then the sample to be tested is not a strain of subgroup A / B / K avian leukosis virus.

[0084] The following examples are used to illustrate the present invention, but are not used to limit the scope of the present invention. Unless otherwise specified, the examples are all carried out under conventional experimental conditions. For example, for the magnetic bead method virus nucleic acid extraction kit, nucleic acid extraction is carried out according to the conditions recommended in the manufacturer's instructions.

[0085] Nucleic acid samples of subgroup A avian leukosis virus, subgroup B avian leukosis virus, and subgroup K avian leukosis virus are all provided by Pudao (Beijing) Standard Technology Co., Ltd.

[0086] The following further explains in conjunction with examples and drawings. It should be understood that these examples are only for illustrative purposes and are not used to limit the scope of the present invention.

[0087] Example 1:

[0088] 1. Sources of disease materials and virus strains

[0089] Virus samples of ALV-A, B, and K subgroups are from Pudao (Beijing) Standard Technology Co., Ltd., virus samples of ALV-J subgroup are from Guangzhou Qianxun Biotechnology Co., Ltd., Marek's disease virus (MDV) is from the live chicken Marek's disease vaccine of Harbin Pharmaceutical Group, infectious laryngotracheitis virus of chicken (ILTV) is from the live infectious laryngotracheitis vaccine of Harbin Pharmaceutical Group, avian influenza virus (AIV) and Newcastle disease virus (NDV) are from the inactivated vaccines of Bomeilai Biotechnology Co., Ltd., and fowl adenovirus (FAdv) is from the virus nucleic acid extracted from the FAdV disease materials provided by Sunner Foods Co., Ltd.

[0090] 2. Design and screening of primers

[0091] Multiple sets of RT-PCR primer pairs were designed based on the gene sequences of the published ALV-A, ALV-B, and ALV-K reference strains in GenBank: For the env gene sequence that is relatively conserved among subgroups but varies greatly among subgroups, ALV-A primers and probes, ALV-B primers and probes, and ALV-K primers and probes were designed respectively. In addition, through multiple alignments of the genomic sequences of ALV-A, ALV-B, and ALV-K, the genomic sequences with relatively low homology among different strains in multiple pairs of env genes were determined as shown in Table 1. Specific primers and probes corresponding to each strain were designed from them. Using real strain samples, the specificities of the primers and probes for ALV-A, ALV-B, and ALV-K were screened and detected repeatedly, and the results are shown in Table 2. Finally, a primer-probe combination that can distinguish the three strains was screened out.

[0092] Table 1. Information on multiple sets of primers and probes screened for different ALV strains

[0093]

[0094] 。

[0096] Table 2. Screening and detection results of each primer combination

[0097]

[0098] 。

[0100] 3. Feasibility and specificity of primers and probes for differentiating and detecting subgroup A avian leukosis virus, subgroup B avian leukosis virus, and subgroup K avian leukosis virus

[0101] The designed and screened ALV-A, ALV-B, and ALV-K primers and probes were respectively used for the virus-positive samples of subgroup A avian leukosis virus, subgroup B avian leukosis virus, and subgroup K avian leukosis virus to verify the feasibility of each designed primer and probe. The detection results are shown in Table 3. At the same time, other positive samples of common chicken infectious diseases were selected, including nucleic acids of subgroup J avian leukosis virus ALV-J, Marek's disease virus MDV, infectious laryngotracheitis virus ILTV, fowl adenovirus type 4 FAdV-4, infectious bronchitis virus IBV, and Newcastle disease virus NDV to verify specificity. The fluorescence quantitative PCR method of Example 1 was used for detection with the primers and probes (SEQ ID NO: 1-9).

[0102] The detection results are as Figures 1 to 3 and shown in Table 3, among which the feasibility and specificity detection results of ALV-A are as Figure 1 shown, and the feasibility and specificity detection results of ALV-B are as Figure 2As shown, the feasibility and specificity detection results of ALV-K are as Figure 3 shown. The results show that the screened ALV-A primer-probe only recognizes subgroup A of avian leukosis virus, the ALV-B primer-probe only recognizes subgroup B of avian leukosis virus, and the ALV-K primer-probe only recognizes subgroup K of avian leukosis virus. There is no amplification curve for other viruses, indicating good feasibility and specificity of the primers.

[0103] Table 3. Feasibility and specificity detection results of ALV-A / B / K primer-probes

[0104] Nucleic acid sample ALV-A detection probe ALV-B detection probe ALV-K detection probe ALV-A viral nucleic acid Positive Negative Negative ALV-B viral nucleic acid Negative Positive Negative ALV-K viral nucleic acid Negative Negative Positive ALV-J viral nucleic acid Negative Negative Negative MDV viral nucleic acid Negative Negative Negative ILTV viral nucleic acid Negative Negative Negative FAdV-4 viral nucleic acid Negative Negative Negative IBV viral nucleic acid Negative Negative Negative NDV viral nucleic acid Negative Negative Negative .

[0105] 4. Detection of the sensitivity of primers and probes for subgroup A, subgroup B, and subgroup K of avian leukosis virus

[0106] Positive control plasmids for subgroup A of avian leukosis virus, with the gene sequence SEQ ID NO:10, subgroup B of avian leukosis virus, with the gene sequence SEQ ID NO:11, and subgroup K of avian leukosis virus, with the gene sequence SEQ ID NO:12, were constructed respectively. Positive control plasmids of ALV-A, ALV-B, and ALV-K with a concentration of 1.304×10 9 copies / μL were used, and sterile double-distilled water was used to prepare 10-fold serial dilutions as templates. 5 μL of each dilution was taken as a template, and the fluorescence quantitative PCR method described in Example 1 was used for detection. The sensitivity was calculated based on the highest dilution of the template amount at which a positive expected curve appeared, and a standard curve was plotted. The sensitivity detection results of ALV-A are as Figure 4 and Figure 5 shown, the sensitivity detection results of ALV-B are as Figure 6 and Figure 7 shown, and the sensitivity detection results of ALV-K are as Figure 8 and Figure 9 shown. The detection results show that the designed and screened primers and probes have high sensitivity, a good linear range, and the lowest detection limit can reach 13.4 copies. Thus, the RT-PCR primer set, kit, and method for detecting subgroup A, B, and K of avian leukosis virus of the present invention have good application effects and significant advantages in the detection and preliminary identification of exogenous ALV.

[0107] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made thereto based on the present invention, which will be obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

Claims

1. A primer combination for identifying and detecting avian leukosis virus A, B and K subgroups, characterized in that: The primer combination comprises: A primer pair for detecting ALV-A, comprising primers having nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 2, and a probe having a nucleotide sequence as shown in SEQ ID NO: 3: SEQ ID NO:1:5'-CTCACAAGAACAGGGTCA-3' SEQ ID NO:2:5'-CACTGGGTTTCAGGAGAA-3' SEQ ID NO:3':5'-CAATACCGCTGTGGCAAGGC-3'; A primer pair for detecting ALV-B, the primer pair comprising primers having nucleotide sequences as shown in SEQ ID NO:4 and SEQ ID NO:5, and a probe having a nucleotide sequence as shown in SEQ ID NO:6: SEQ ID NO:4:5'-GACCGGAGACAAGTTACA-3' SEQ ID NO:5:5'-TACGGGCCTTATTAAAGAAAG-3' SEQ ID NO:6:5'-CTTGACTGACCCAGGGAGCA-3'; A primer pair for detecting ALV-K, the primer pair comprising primers having nucleotide sequences as shown in SEQ ID NO:7 and SEQ ID NO:8, and a probe having a nucleotide sequence as shown in SEQ ID NO:9: SEQ ID NO:7:5'-GACAGGCTTCAGATTGG-3' SEQ ID NO:8:5'-GTACCGCAGTACTCATTC-3' SEQ ID NO:9:5'-TCTATCCCCCGTTACCACCG-3', The 5' end of the probes of the nucleotide sequences such as SEQ ID NO: 3, SEQ ID NO: 6 and SEQ ID NO: 9 is connected with fluorescent groups of different colors.

2. A method for identifying and detecting avian leukosis virus A, B and K subgroups, characterized in that: The method comprises the following steps: (1) extracting genomic RNA from the sample to be tested; (2) using the extracted genomic RNA of the sample to be tested as a template, amplifying using the primer combination for identifying and detecting the A, B and K subgroups of avian leukosis virus according to claim 1, and collecting the fluorescent signals amplified using each primer pair respectively; (3) Result determination: If for the sample to be tested, there is an amplification curve of the fluorescent group connected to the 5' end of SEQ ID NO:3 and the Ct value is <36, then the sample to be tested contains an avian leukosis virus subgroup A strain, If for the sample to be tested, there is an amplification curve of the fluorescent group connected to the 5' end of SEQ ID NO:6 and the Ct value is <36, then the sample to be tested contains an avian leukosis virus subgroup B strain; If for the sample to be tested, there is an amplification curve of the fluorescent group connected to the 5' end of SEQ ID NO:9 and the Ct value is <36, then the sample to be tested contains an avian leukosis virus subgroup K strain.

3. A kit for identifying and detecting avian leukosis virus A, B and K subgroups, characterized in that: The kit comprises: the primer-probe combination for detecting A, B and K subgroups of avian leukosis virus as described in claim 1.

4. The kit for avian leukosis virus A, B and K subgroups according to claim 3, characterized in that: The kit also includes negative control and positive control plasmid DNA templates.

Images