Method for generating spot type erythroid progenitor cells and erythrocytes with strong multiplication capacity by engineering means and application of spot type erythroid progenitor cells and erythrocytes

Abstract

The invention discloses a method for generating spot-type erythroid progenitor cells and erythrocytes with strong multiplication capacity by an engineering means and application of the spot-type erythroid progenitor cells and erythrocytes. Belongs to the technical field of gene synthesis and stem cell application. Specifically, the invention provides application of the D-CSF2R protein in promoting the differentiation of hiPSC into erythroid progenitor cells or erythrocytes. The amino acid sequence of the D-CSF2R protein is as shown in SEQ ID No. 1. The novel transmembrane protein has the beneficial effects that the novel transmembrane protein which is constructed based on synthetic biology and contains the CSF2RA intracellular key activation structural domain and the CSF2RA intracellular key activation structural domain can promote cell fate transformation of the iPSC in the process of differentiating the iPSC into macrophages, and then the iPSC is differentiated into the iPSC-derived erythroid progenitor cells (iErP) with the erythroid progenitor cell fate.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene synthesis and stem cell applications, and specifically relates to a gene encoding a novel transmembrane protein constructed based on the concept of synthetic biology. This gene can induce human induced pluripotent stem cells (hiPSC) to differentiate into erythroid progenitor cells (ErP) with clinical application value that can proliferate rapidly and be cryopreserved, thus changing the cell fate. Background Art

[0002] Human induced pluripotent stem cells (hiPSC) have the potential to differentiate into all types of cells in the human body. At present, research on the differentiation of hiPSC into red blood cells has made certain progress in recent years, showing great potential in the treatment of various blood diseases, such as anemia, thalassemia, sickle cell anemia, etc., the safety and efficacy testing of drugs for blood system diseases, as well as personalized treatment, solving the shortage of blood supply, avoiding immune rejection reactions, and reducing the risk of infectious diseases. The main strategy for differentiating hiPSC into red blood cells is first to differentiate hiPSC into hematopoietic stem cells (HSC), and then induce the generation of red blood cells through certain signaling pathways and growth factors (such as SCF, EPO, VEGF, IL-3, GM-CSF, etc.), and finally differentiate into mature red blood cells. However, although some exploration has been done on the technical platform for differentiating iPSC into red blood cells at home and abroad (for example, patent number: US20150123456A1), there are still many pain points hindering the clinical application and large-scale production of iPSC-derived red blood cells. For example, ① due to the limited ability to expand hematopoietic stem cells in vitro, complex culture conditions and a long time are often required during the culture process, so the current iPSC culture and differentiation technology is not sufficient to support industrial-scale red blood cell production; ② it is difficult to achieve efficient and consistent differentiation; ③ the existing technology has a long differentiation cycle and is difficult to meet the clinical needs of acute blood use; ④ the existing differentiated red blood cells are usually not fully mature and their functionality is inferior to that of naturally sourced red blood cells. Therefore, developing ready-to-use erythroid progenitor cells with high proliferative ability and still having high viability after resuscitation will be the key to promoting the clinical application of iPSC-derived red blood cells.

[0003] Research has found that CD117 and CD235a are marker proteins of erythroid progenitor cells (ErP) (Zhang H, Wan GZ, Wang YY, Chen W, Guan JZ. The role of erythrocytes and erythroid progenitor cells in tumors. Open Life Sci. 2022 Dec 15;17(1):1641-1656. doi: 10.1515 / biol-2022-0102.). These two proteins are also significantly expressed only in erythroid progenitor cells. Summary of the Invention

[0004] The technical problem to be solved by the present invention is how to solve the problems of complex operation and long cycle existing in the differentiation of existing hiPSCs into red blood cells.

[0005] The present invention realizes the solution of the above technical problems through the following technical means:

[0006] In the first aspect of the present invention, a D-CSF2R protein is proposed. The D-CSF2R protein includes D-CSF2R-1 protein and D-CSF2R-2 protein, and its amino acid sequences are as shown in SEQ ID No. 1-2.

[0007] In the second aspect of the present invention, a gene encoding the above D-CSF2R protein is proposed. The CDS nucleotide sequences of D-CSF2R-1 protein and D-CSF2R-2 protein are as shown in SEQ ID No. 3-4.

[0008] In the third aspect of the present invention, a recombinant expression vector containing the above D-CSF2R gene is proposed.

[0009] In the fourth aspect of the present invention, a recombinant expression cell line D-CSF2R-hiPSC is proposed, which is obtained by integrating the D-CSF2R expression gene into the genome of hiPSC.

[0010] Preferably, by simultaneously transfecting the constructed D-CSF2R lentiviral expression plasmid, the lentiviral packaging plasmids psPAX2 and pMD2.G into HEK293T cells, extracting the lentiviral particles containing the D-CSF2R expression gene, and infecting the wild-type hiPSC cell line, it can be obtained.

[0011] In the fifth aspect of the present invention, the application of the above D-CSF2R protein in promoting the differentiation of hiPSC into erythroid progenitor cells or red blood cells is proposed.

[0012] In the sixth aspect of the present invention, a cultivation method for promoting the differentiation of hiPSC into erythroid progenitor cells is proposed, including the following steps:

[0013] (1) Cultivate hiPSCs stably overexpressing D-CSF2R to obtain embryoid bodies (EBs).

[0014] (2) Cultivate the embryoid bodies successively in MI medium, HS medium, EPE-1 medium, and EPE-2 medium, and collect iPSC-derived erythroid progenitor cells (D-CSF2R-iErP) to obtain the product.

[0015] Preferably, the composition of the MI medium is: APEL II medium + 10 ng / mL BMP4 + 5 ng / mL bFGF + 50 ng / ml VEGF + 100 ng / mL SCF;

[0016] The composition of the HS medium is: APEL II medium + 10 ng / mL BMP4 + 5 ng / mL bFGF + 50 ng / ml VEGF + 100 ng / mL SCF.

[0017] Preferably, the composition of the EPE-1 medium is: APEL II medium + 10 ng / ml bFGF + 50 ng / ml VEGF + 50 ng / mL SCF + 10 ng / mL IGF1 + 25 ng / mL IL-3 + 20 ng / mL IL-6 + 20 ng / mL IL-11 + 20 ng / mL TPO + 20 ng / mL EPO + 20 ng / mL M-CSF + 20 ng / mL GM-CSF.

[0018] Preferably, the composition of the EPE-2 medium is: X-VIVO TM -15 medium / StemSpan TM H3000 medium + 10 ng / ml bFGF + 50 ng / ml VEGF + 50 ng / mL SCF + 10 ng / mL IGF1 + 25 ng / mL IL-3 + 25 ng / mL IL-6 + 25 ng / mL IL-11 + 25 ng / mL TPO + 25 ng / mL EPO + 25 ng / mL M-CSF + 25 ng / mL GM-CSF.

[0019] The seventh aspect of the present invention provides a cultivation method for promoting the differentiation of hiPSCs into red blood cells, comprising the following steps:

[0020] S1: Cultivate hiPSCs stably overexpressing D-CSF2R into iPSC-derived erythroid progenitor cells (D-CSF2R-iErP),

[0021] S2: Continuously culture the collected D-CSF2R-iErP in X-VIVO TM -15 medium containing 50 ng / mL SCF, 25 ng / mL GM-CSF, 50 ng / ml VEGF, 25 ng / mL IL-3, and 25 ng / mL EPO to obtain mature red blood cells (D-CSF2R-iErT).

[0022] The beneficial effects of the present invention are as follows:

[0023] 1. Based on the concept of synthetic biology, the present invention constructs two novel D-CSF2R transmembrane proteins (D-CSF2R-1, D-CSF2R-2) with the ability to change cell fate by concatenating the 347-400aa sequence in the intracellular region of CSF2RA with the Box1 domain and the 498-849aa sequence in the intracellular region of CSF2RB, as well as the 461-897aa sequence in the intracellular region of CSF2RB. These novel proteins can enable hiPSCs to rapidly and efficiently differentiate into erythroid progenitor cells (iErP) in the differentiation system provided by the present invention and can further differentiate into mature red blood cells.

[0024] 2. By stably overexpressing D-CSF2R in hiPSCs, hiPSCs stably overexpressing D-CSF2R can be induced to differentiate into erythroid progenitor cells (D-CSF2R-iErP) by combining the temporal and spatial combinations and concentration combinations of different cytokines in the differentiation protocol of the present invention. The D-CSF2R-iErP is characterized by high proliferative ability and high resuscitation activity after cryopreservation. The iPSC-derived erythroid progenitor cells (D-CSF2R-iErP) obtained in the present invention are characterized by high proliferative ability and high resuscitation activity after cryopreservation and can be further induced to differentiate into mature red blood cells and myeloid cells including macrophages and DC cells. This strategy can shorten the treatment cycle based on red blood cells and myeloid cells. Its high proliferative ability also provides a continuous and reliable guarantee of cell quantity for clinical treatment.

[0025] 3. By different concentration combinations of the four cytokines SCF, GM-CSF, IL-3, and EPO in the present invention, D-CSF2R-iErP is induced to mature into red blood cells.

[0026] 4. Based on the concept of synthetic biology, the present invention synthesizes a transmembrane protein (D-CSF2R protein) containing the key intracellular activation domains of CSF2RA and CSF2RB through genetic engineering means. This novel transmembrane protein can automatically fold and further activate in terms of spatial structure, and then realize the fate transformation of iPSC-derived terminal cells into erythroid progenitor cells through downstream signaling pathways. The iPSC-derived erythroid progenitor cells obtained in the present invention have the characteristics of high proliferation ability and high recovery activity after cryopreservation, and can be further induced to differentiate into mature red blood cells. Through this strategy, the cycle of red blood cell-based therapy can be shortened. Its high proliferation ability also provides a continuous and reliable guarantee of cell quantity for clinical treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is a schematic diagram of the gene expression sequence of the transmembrane protein (D-CSF2R protein) based on the key intracellular activation domains of the CSF2Rα subunit and the CSF2Rβ subunit in Example 1 of the present invention. Among them, A is a schematic diagram of the structure of transmembrane protein D-CSF2R-1; B is a schematic diagram of the structure of transmembrane protein D-CSF2R-2; C is a schematic diagram of the structure of transmembrane protein Truncated D-CSF2R without an intracellular domain;

[0028] Figure 2 It is a lineage analysis diagram of D-CSF2R-iErP cells derived from hiPSC in Example 1 of the present invention. Among them, A is a phenotypic control diagram of D-CSF2R-iErP differentiated from D-CSF2R-iPSC and Truncated-iMAC differentiated from Truncated D-CSF2R-iPSC; B is a comparison and statistical chart of the expression of erythroid progenitor cell marker genes in D-CSF2R-iErP and control cells Truncated-iMAC;

[0029] Figure 3 It is a detection diagram of the proliferation ability of D-CSF2R-iErP in Example 1 of the present invention. Among them, A is a detection statistics and comparison chart of the expression of proliferation-related genes in some D-CSF2R-iErP control cells Truncated-iMAC; B is a detection statistics and comparison chart of the expression of proliferation-related genes in some D-CSF2R-iErP control cells Truncated-iMAC; C is a detection diagram of the proliferation ability of D-CSF2R-iErP control cells Truncated-iMAC;

[0030] Figure 4 It is a detection diagram of the recovery activity of D-CSF2R-iErP after cryopreservation in Example 1 of the present invention;

[0031] Figure 5This is the detection diagram of the potential of D-CSF2R-iErP to differentiate into red blood cells in Example 1 of the present invention. Among them, A is the statistical chart of the expression detection of genes related to red blood cell development and maturation in D-CSF2R-iErP; B is the statistical chart of the expression detection of hemoglobin genes in D-CSF2R-iErT after D-CSF2R-iErP is stimulated to mature; C is the red phenotype diagram of D-CSF2R-iErT presenting red blood cells. Detailed implementation manners

[0032] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0033] The test materials and reagents used in the following embodiments can be obtained from commercial channels without special instructions.

[0034] For those not specifying specific techniques or conditions in the embodiments, they can all be carried out according to the techniques or conditions described in the literature in the art or according to the product specifications.

[0035] Example 1:

[0036] The main implementation plans include the following parts:

[0037] The first part: Design of the D-CSF2R expression sequence.

[0038] Based on synthetic biology, the applicant's team constructed two novel D-CSF2R transmembrane proteins (D-CSF2R-1 protein, D-CSF2R-2 protein) by combining the amino acid sequences at positions 347-400 with the Box1 domain of CSF2RB, the amino acid sequences at positions 498-849, the amino acid sequences at positions 461-897, etc. in different combinations.

[0039] 1. Amino acid sequence of D-CSF2R-1 protein: (SEQ ID No.1)

[0040] MALPVTALLLPLALLLHAARPDIQMTQSPSSLSASVGDRVTITCRASQGIRNNLAWYQQKPGKAPKRLIYAASNLQSGVPSRFTGSGSGTEFTLIVSSLQPEDFATYYCLQHHSYPLTSGGGTKVEIKRTGSTSGSGKPGSGEGSEVQVLESGGGLVQPGGSLRLSCAASGFTFSSYAMSWVRQAPGKGLEWVSAISGSGGSTNYADSVKGRFTISRDNSKNTLYLQMNSLRAEDTAVYYCAGSSGWSEYWGQGTLVTVSSNLGSVYIYVLLIVGTLVCGIVLGFLFKRFLRIQRLFPPVPQIKDKLNDNHEVEDEIIWEEFTPEEGKGYREEVLTVKEITGGGGSGGGGSGGGGSWEEKIPNPSGSMSAFTSGSPPHQGPWGSRFPELEGVFPVGFGDSEVSPLTIEDPKHVCDPPSGPDTTPAASDLPTEQPPSPQPGPPAASHTPEKQASSFDFNGPYLGPPHSRSLPDILGQPEPPQEGGSQKSPPPGSLEYLCLPAGGQVQLVPLAQAMGPGQAVEVERRPSQGAAGSPSLESGGGPAPPALGPRVGGQDQKDSPVAIPMSSGDTEDPGVASGYVSSADLVFTPNSGASSVSLVPSLGLPSDQTPSLCPGLASGPPGAPGPVKSGFEGYVELPPIEGRSPRSPRNNPVPPEAKSPVLNPGERPADVSPTSPQPEGLLVLQQVGDYCFLPGLGPGPLSLRSKPSSPGPGPEIK

[0041] 2. Amino acid sequence of D-CSF2R-2 protein: (SEQ ID No.2)

[0042] MALPVTALLLPLALLLHAARPDIQMTQSPSSLSASVGDRVTITCRASQGIRNNLAWYQQKPGKAPKRLIYAASNLQSGVPSRFTGSGSGTEFTLIVSSLQPEDFATYYCLQHHSYPLTSGGGTKVEIKRTGSTSGSGKPGSGEGSEVQVLESGGGLVQPGGSLRLSCAASGFTFSSYAMSWVRQAPGKGLEWVSAISGSGGSTNYADSVKGRFTISRDNSKNTLYLQMNSLRAEDTAVYYCAGSSGWSEYWGQGTLVTVSSNLGSVYIYVLLIVGTLVCGIVLGFLFKRFLRIQRLFPPVPQIKDKLNDNHEVEDEIIWEEFTPEEGKGYREEVLTVKEITGGGGSGGGGSGGGGSRFCGIYGYRLRRKWEEKIPNPSKSHLFQNGSAELWPPGSMSAFTSGSPPHQGPWGSRFPELEGVFPVGFGDSEVSPLTIEDPKHVCDPPSGPDTTPAASDLPTEQPPSPQPGPPAASHTPEKQASSFDFNGPYLGPPHSRSLPDILGQPEPPQEGGSQKSPPPGSLEYLCLPAGGQVQLVPLAQAMGPGQAVEVERRPSQGAAGSPSLESGGGPAPPALGPRVGGQDQKDSPVAIPMSSGDTEDPGVASGYVSSADLVFTPNSGASSVSLVPSLGLPSDQTPSLCPGLASGPPGAPGPVKSGFEGYVELPPIEGRSPRSPRNNPVPPEAKSPVLNPGERPADVSPTSPQPEGLLVLQQVGDYCFLPGLGPGPLSLRSKPSSPGPGPEIKNLDQAFQVKKPPGQAVPQVPVIQLFKALKQQDYLSLPPWEVNKPGEVC

[0043] 3. CDS nucleotide sequence encoding D-CSF2R-1 protein: (SEQ ID No.3)

[0044] 4. CDS nucleotide sequence encoding D-CSF2R-2 protein: (SEQ ID No.4)

[0045] The gene expression and amino acid sequences of each domain of D-CSF2R are as follows:

[0046] 1) Signal peptide gene coding sequence: (SEQ ID No.5)

[0047] 2) Signal peptide amino acid sequence: (SEQ ID No.6)

[0048] 3) scFv gene coding sequence targeting EGFRvIII: (SEQ ID No.7)

[0049] 4) scFv amino acid sequence targeting EGFRvIII: (SEQ ID No.8)

[0050] 5) Transmembrane gene coding sequence: (SEQ ID No.9)

[0051] 6) Transmembrane amino acid sequence: (SEQ ID No.10)

[0052] 7) CSF2RA 347 - 400aa gene coding sequence: (SEQ ID No.11)

[0053] 8) CSF2RA 347 - 400aa amino acid sequence: (SEQ ID No.12)

[0054] 9) Linker gene coding sequence: (SEQ ID No.13)

[0055] 10) Linker amino acid sequence: (SEQ ID No.14)

[0056] 11) CSF2RB Box1 gene coding sequence: (SEQ ID No.15)

[0057] 12) CSF2RB Box1 amino acid sequence: (SEQ ID No.16)

[0058] 13) CSF2RB 498 - 849aa gene coding sequence: (SEQ ID No.17)

[0059] 14) CSF2RB 498 - 849aa amino acid sequence: (SEQ ID No.18)

[0060] 13) CSF2RB 461 - 897aa gene coding sequence: (SEQ ID No.19)

[0061] 14) CSF2RB 461 - 897aa amino acid sequence: (SEQ ID No.20)

[0062] To visually characterize the expression of D-CSF2R-1 and D-CSF2R-2, the T2A amino acid sequence was used to link D-CSF2R-1 / D-CSF2R-2 and the green fluorescent protein EGFP:

[0063] 15) T2A gene coding sequence: (SEQ ID No. 21)

[0064] gagggcagaggcagcctgctgacatgtggcgacgtggaagagaaccctggcccc

[0065] 16) T2A amino acid sequence: (SEQ ID No. 22)

[0066] EGRGSLLTCGDVEENPGP

[0067] 17) EGFP gene coding sequence: (SEQ ID No. 23)

[0068] 18) EGFP amino acid sequence: (SEQ ID No. 24)

[0069] 19) The D-CSF2R-1-T2A-EGFP gene coding sequence is: SEQ ID No. 3, SEQ ID No. 21, and SEQ ID No. 23 linked in sequence.

[0070] 20) The D-CSF2R-1-T2A-EGFP amino acid sequence is: SEQ ID No. 1, SEQ ID No. 22, and SEQ ID No. 24 linked in sequence.

[0071] 21) The D-CSF2R-2-T2A-EGFP gene coding sequence is: SEQ ID No. 4, SEQ ID No. 21, and SEQ ID No. 23 linked in sequence.

[0072] 22) The D-CSF2R-2-T2A-EGFP amino acid sequence is: SEQ ID No. 2, SEQ ID No. 22, and SEQ ID No. 24 linked in sequence.

[0073] Second part: The hiPSCs expressing D-CSF2R were divided into D-CSF2R-iErP

[0074] (1) Construct a lentiviral overexpression system for D-CSF2R.

[0075] The D-CSF2R was cloned into the lentiviral expression plasmid Lenti-EF1a-PGK-Puromycin by molecular cloning techniques to construct lentiviral expression plasmids of D-CSF2R-1, D-CSF2R-2, and Truncated D-CSF2R, respectively. The plasmids were amplified in Escherichia coli.

[0076] (2) Construct a hiPSC cell line stably overexpressing D-CSF2R.

[0077] The constructed lentiviral expression plasmid of D-CSF2R, the lentiviral packaging plasmids psPAX2 and pMD2.G were co-transfected into HEK293T cells at a mass ratio of 4:3:1. The cell supernatants were collected at 48, 60, and 72 hours of culture, and concentrated to obtain lentiviral particles containing the D-CSF2R expression gene. Subsequently, the lentiviral particles containing the D-CSF2R expression gene were infected into wild-type hiPSC cell lines using the cationic compound polybrane to construct a D-CSF2R-hiPSC cell line stably overexpressing D-CSF2R. The lentiviral overexpression system can stably integrate the D-CSF2R expression gene into the genome of hiPSC. The expression ratio and fluorescence intensity of EGFP in hiPSC cells can characterize the expression efficiency of D-CSF2R in hiPSC.

[0078] (3) Based on the formation of embryoid bodies (EBs), differentiate hiPSC stably overexpressing D-CSF2R into D-CSF2R-iErP.

[0079] The present invention provides two sets of hiPSC differentiation protocols:

[0080] 1) hiPSC differentiation system based on a horizontal shaker

[0081] ① When hiPSC of D-CSF2R was cultured in a six-well plate coated with Matrigel (Corning, #354277) with serum-free medium (mTesR1, STEMCELL; or ncTarget Medium, ZhongSheng SuYuan) until the confluence reached 60% to 80%, it was digested into single cells with TrypLE digestive solution (STEMCELL).

[0082] ② Subsequently, the hiPSC digested into single-cell state was resuspended in mTesR1 medium containing ROCK inhibitor (Y27632) and transferred to a low-attachment six-well plate, and cultured in suspension in a 37°C, 5% CO2 cell culture incubator for 24 hours. This was Day 0. After 24 hours of suspension culture, EBs could be formed.

[0083] ③On Day 1, change the EB in suspension culture to MI medium (APEL II medium + 10 ng / mL BMP4 + 5 ng / mL bFGF).

[0084] ④From Day 2 to Day 7, change to HS medium (HS medium: APEL II medium + 10 ng / mL BMP4 + 5 ng / mL bFGF + 50 ng / ml VEGF + 100 ng / mL SCF). Vesicle-like EBs will be produced at this stage. If no vesicle-like EBs are found or there are few vesicle-like EBs, the time for this step can be extended by 2 - 3 days. The subsequent steps will be postponed by 2 - 3 days.

[0085] ⑤From Day 8 to Day 10, change to EPE-1 medium (Erythroid progenitor expansion-1 medium: APEL II medium + 10 ng / ml bFGF + 50 ng / ml VEGF + 50 ng / mL SCF + 10 ng / mL IGF1 + 25 ng / mL IL-3 + 20 ng / mL IL-6 + 20 ng / mL IL-11 + 20 ng / mL TPO + 20 ng / mL EPO + 20 ng / mL M-CSF + 20 ng / mL GM-CSF).

[0086] ⑥On Day 11, transfer the EB in suspension culture to a six-well plate coated with Matrigel (Corning, #354277). At this time, change the culture medium to EPE-2 medium (Erythroid progenitor expansion-2 medium: X-VIVO TM -15 medium / StemSpan TM / H3000 medium + 10 ng / ml bFGF + 50 ng / ml VEGF + 50 ng / mL SCF + 10 ng / mL IGF1 + 25 ng / mL IL-3 + 25 ng / mL IL-6 + 25 ng / mL IL-11 + 25 ng / mL TPO + 25 ng / mL EPO + 25 ng / mL M-CSF + 25 ng / mL GM-CSF). Thereafter, the EBs were cultured in this medium continuously. During this period, a large number of D-CSF2R-iErP (derived from D-CSF2R-hiPSCs) and Truncated iMAC (Macrophage derived from Truncated D-CSF2R-hiPSCs) were generated. The supernatant was collected every two days, and CSF2R-iErP and Truncated iMAC were collected by horizontal rotor centrifugation (1000 rpm / 3 min). D-CSF2R-iErP and Truncated iMAC were resuspended with fresh EPE-2 medium and transferred to a new 6-well plate.

[0087] 2) Spin-EB-based hiPSC differentiation system

[0088] ① When D-CSF2R-hiPSCs were cultured in a 6-well plate coated with Matrigel (Corning, #354277) with serum-free medium (mTesR1, STEMCELL; or ncTarget Medium, ZhongSheng SuYuan) until the confluence reached 60% to 80%, they were digested into single cells with TrypLE Digest (STEMCELL).

[0089] ② Subsequently, the hiPSCs in single-cell state were resuspended with MI medium (APEL II medium + 20 ng / mL BMP4) containing ROCK inhibitor (Y27632) and transferred to a low-attachment round-bottom 96-well plate, and cultured in a 37°C, 5% CO2 cell culture incubator for 24 hours. This was Day 0. After 24 hours of suspension culture, EBs could be formed.

[0090] ③ On Day 1, the suspended EBs were continued to be cultured with MI medium (APEL II medium + 20 ng / mL BMP4) without ROCK inhibitor (Y27632) for 24 hours.

[0091] ④On Day 2 - 7, change to HS medium (HS medium: APEL II medium + 20 ng / mL BMP4 + 50 ng / ml VEGF + 100 ng / mL SCF). Vesicle-like EBs will be generated at this stage. If no vesicle-like EBs are found or there are only a few, the time for this step can be extended by 2 - 3 days. The subsequent steps will be postponed by 2 - 3 days.

[0092] ⑤On Day 8 - 10, change to EPE-1 medium (Erythroid progenitor expansion-1 medium: APEL II medium + 10 ng / ml bFGF + 50 ng / ml VEGF + 50 ng / mL SCF + 10 ng / mL IGF1 + 25 ng / mL IL-3 + 20 ng / mL IL-6 + 20 ng / mL IL-11 + 20 ng / mL TPO + 20 ng / mL EPO + 20 ng / mL M-CSF + 20 ng / mL GM-CSF).

[0093] ⑥On Day 11, transfer the EBs to a 6-well plate coated with Matrigel (Corning, #354277). At this time, change the culture medium to EPE-2 medium (Erythroid progenitor expansion-2 medium: X-VIVO TM -15 medium / StemSpan TM / H3000 medium + 10 ng / ml bFGF + 50 ng / ml VEGF + 50 ng / mL SCF + 10 ng / mL IGF1 + 25 ng / mL IL-3 + 25 ng / mL IL-6 + 25 ng / mL IL-11 + 25 ng / mL TPO + 25 ng / mL EPO + 25 ng / mL M-CSF + 25 ng / mL GM-CSF). Then culture the EBs with this medium continuously. A large number of D-CSF2R-iErP (derived from D-CSF2R-hiPSCs) and Truncated iMAC (Macrophage derived from Truncated D-CSF2R-hiPSCs) will be generated during this period. Aspirate the supernatant every two days and collect D-CSF2R-iErP and Truncated iMAC by centrifugation in a horizontal rotor (1000 rpm / 3 min). Resuspend D-CSF2R-iErP and Truncated iMAC with fresh EPE-2 medium and transfer them to a new 6-well plate.

[0094] ⑦ The collected D-CSF2R-iErP can be maintained in the erythroid progenitor cell state for a long time in the EPE-2 medium configured with X-VIVO TM -15 medium.

[0095] Part III: Further differentiate D-CSF2R-iErP into red blood cells

[0096] The collected D-CSF2R-iErP is cultured continuously in X-VIVO TM -15 medium containing 50 ng / mL SCF, 25 ng / mL GM-CSF, 50 ng / ml VEGF, 25 ng / mL IL-3, and 25 ng / mL EPO to obtain mature red blood cells (D-CSF2R-iErT, D-CSF2R-iPSC-derived erythrocyte). The cytokine concentrations in this step can be appropriately increased or decreased.

[0097] From Figure 1It can be seen that for A and B, the D-CSF2R protein gene expression sequence in the present invention consists of an extracellular domain, a transmembrane domain, and an intracellular signaling domain. The intracellular domain consists of a signal peptide and a single-chain variable region (scFv) that can target and recognize any antigen. The transmembrane domain is the transmembrane domain protein sequence from the CSF2RA protein. The intracellular part is formed by tandemly connecting the key activation domain in the intracellular part of CSF2RA and the key activation domain in the intracellular part of CSF2Rβ through a Linker sequence. According to different combinations of the intracellular signal activation domains, it can be divided into four combination types. Among them, the intracellular part of D-CSF2R-1 tandemly connects the amino acid sequence at positions 347-400 (347-400aa) in the intracellular domain (Cytoplasmic domain) of the CSF2RA protein, and the Box1 domain (amino acid sequence at positions 474-482) and the amino acid sequence at positions 498-849 (498-849aa) of the CSF2RB protein (A). The intracellular part of D-CSF2R-2 tandemly connects the amino acid sequence at positions 347-400 in the intracellular domain (Cytoplasmic domain) of the CSF2RA protein and the amino acid sequence at positions 461-897 (461-897aa) of the CSF2Rβ protein (B). C, The Truncated D-CSF2R protein that only contains the extracellular domain, transmembrane domain, and does not contain the intracellular signaling domain is used as a research control. The iPSC expressing the Truncated protein will be subsequently differentiated into macrophages (Truncated iMAC). At the same time, the 4 D-CSF2R proteins are respectively linked to the EGFP green fluorescent protein through the T2A element to form a fusion expression sequence. The expression of D-CSF2R protein can be indicated by the expression of EGFP.

[0098] As can be seen from Figure 2 it, for A, through microscopic observation, it was found that D-CSF2R-iErP on the first day and the 20th day after differentiation showed a naive cell-like state compared to the control group cells (Truncated iMAC). As the culture time progresses, Truncated iMAC will further mature into macrophages, while D-CSF2R-iErP still shows a naive cell phenotype. The EGFP green fluorescence confirms the successful expression of D-CSF2R in iErP. For B, transcriptome sequencing analysis shows that D-CSF2R-iErP highly expresses genes specific to erythroid progenitors (ErP) and key genes for erythrocyte development. Among them, the simultaneous high expression of CD117 and CD235a is considered a typical feature of human erythroid progenitors.

[0099] As can be seen from Figure 3As can be seen in A and B, transcriptome sequencing analysis showed that D-CSF2R-iErP expressed higher levels of cell proliferation-related genes than control cells (Truncated iMAC), indicating that D-CSF2R-iErP has a stronger proliferation ability. C, CCK8 proliferation assay detected cell activity 0-60 hours after hiPSC differentiated into D-CSF2R-iErP. The results showed that D-CSF2R-iErP has a stronger proliferation ability than control cells (Truncated iMAC).

[0100] from Figure 4 As can be seen in the figure, the D-CSF2R-iErP cryopreserved and control group cells (Truncated iMAC) were revived after cryopreservation, and the cell activity was detected by CCK8 proliferation assay at 0 hours, 12 hours, 36 hours and 60 hours of resuscitation. The results showed that D-CSF2R-iErP still had high cell activity after cryopreservation and resuscitation, and could continue to increase steadily.

[0101] from Figure 5 As can be seen in the figure, A, transcriptome sequencing shows that genes related to erythrocyte development and maturation are significantly overexpressed in D-CSF2R-iErP. B, transcriptome sequencing shows that hemoglobin genes are significantly overexpressed in D-CSF2R-iErT, the mature erythrocytes stimulated by D-CSF2R-iErP. C, D-CSF2R-iErT phenotypically exhibits a red phenotype of erythrocytes relative to the control group cells (Truncated iMAC).

[0102] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A D-CSF2R protein, characterized in that The D-CSF2R protein includes D-CSF2R-1 protein and D-CSF2R-2 protein, and the amino acid sequences thereof are shown in SEQ ID No. 1-2.

2. A gene encoding the D-CSF2R protein according to claim 1, characterized in that: The CDS nucleotide sequences of D-CSF2R-1 protein and D-CSF2R-2 protein are shown in SEQ ID No. 3-4.

3. A recombinant expression vector containing the gene encoding the D-CSF2R protein according to claim 2.

4. A recombinant expression cell line D-CSF2R-hiPSC, characterized in that: This was achieved by integrating the D-CSF2R expression gene into the genome of hiPSCs.

5. The recombinant expression cell line D-CSF2R-hiPSC according to claim 4, characterized in that: The constructed D-CSF2R lentiviral expression plasmid and lentiviral packaging plasmids psPAX2 and pMD2.G were simultaneously transfected into HEK293T cells, lentiviral particles containing the D-CSF2R expression gene were extracted, and the lentiviral particles were infected into wild-type hiPSC cell lines to obtain the obtained product.

6. Use of the D-CSF2R protein according to claim 1 in promoting the differentiation of hiPSCs into erythroid progenitor cells or red blood cells.

7. A method for promoting hiPSC differentiation into erythroid progenitor cells, characterized in that: The following steps are involved: (1) hiPSCs stably overexpressing D-CSF2R were cultured to obtain embryoid bodies (EBs); (2) The embryoid bodies were cultured in MI medium, HS medium, EPE-1 medium, and EPE-2 medium in sequence, and iPSC-derived erythroid progenitor cells (D-CSF2R-iErP) were collected.

8. The cultivation method according to claim 7, characterized in that: The components of the EPE-1 culture medium are: APEL II medium + 10 ng / ml bFGF + 50 ng / ml VEGF + 50 ng / mL SCF + 10 ng / mL IGF1 + 25 ng / mL IL-3 + 20 ng / mL IL-6 + 20 ng / mL IL-11 + 20 ng / mL TPO + 20 ng / mL EPO + 20 ng / mL M-CSF + 20 ng / mL GM-CSF.

9. The cultivation method according to claim 7, characterized in that: The components of the EPE-2 culture medium are: X-VIVO TM -15 medium / StemSpan TM / H3000 medium+10ng / ml bFGF+50ng / ml VEGF+50ng / mL SCF+10ng / mLIGF1+25ng / mL IL-3+25ng / mL IL-6+25ng / mL IL-11+25ng / mL TPO+25ng / mL EPO+25ng / mLM-CSF+25ng / mL GM-CSF.

10. A method for promoting hiPSC differentiation into red blood cells, characterized in that: The following steps are involved: S1: hiPSCs stably overexpressing D-CSF2R were cultured into iPSC-derived erythroid progenitors (D-CSF2R-iErP). S2: The collected D-CSF2R-iErP was incubated in X-VIVO containing 50 ng / mL SCF, 25 ng / mL GM-CSF, 50 ng / ml VEGF, 25 ng / mL IL-3, and 25 ng / mL EPO. TM -15 medium to obtain mature red blood cells (D-CSF2R-iErT).

Images