Nucleic acid composition, kit and detection method for detecting methylation of liver cancer-related genes

By designing methylation-specific primers and probes for EMX1, OTX2, DAB2IP, Septin9, CDKL2, and GSTP1 genes, and combining the ACTB internal reference gene, a fast and accurate liver cancer screening method was constructed, solving the problem of insufficient accuracy and sensitivity of liver cancer screening in the prior art, and achieving efficient early detection of liver cancer.

CN120174096BActive Publication Date: 2025-08-26HANGZHOU SHENGTING MEDICAL TECHNOLOGY LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510661468.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-22
Publication Date
2025-08-26
Estimated Expiration
2045-05-22

AI Technical Summary

Technical Problem

The existing liver cancer screening methods cannot provide nucleic acid compositions and kits with accurate results, fast timeliness, high detection throughput, good specificity and high sensitivity, and it is difficult to meet the efficient screening needs of early liver cancer.

Method used

A nucleic acid composition was designed, including methylation-specific primers and probes of EMX1, OTX2, DAB2IP, Septin9, CDKL2, and GSTP1 genes, combined with the ACTB internal reference gene, and formed a kit through PCR reaction solution and quality control products. Fluorescence quantitative PCR technology was used to detect the methylation status of cfDNA in plasma, and establish a fast and accurate liver cancer screening method.

Benefits of technology

It has achieved rapid, high-throughput, sensitive and specific detection of liver cancer-related gene methylation, with a positive detection rate of 85% and a negative detection rate of 90%, effectively supporting the diagnosis and treatment of early liver cancer, reducing medical costs, and improving quality of life.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120174096B_ABST
    Figure CN120174096B_ABST
Patent Text Reader

Abstract

The present invention discloses a nucleic acid composition, a kit and a detection method for detecting methylation of liver cancer-related genes. The nucleic acid composition is a first nucleic acid composition, a second nucleic acid composition or a combination of the first nucleic acid composition and the second nucleic acid composition. The first nucleic acid composition comprises: a methylation-specific primer and a probe for a target site of the EMX1 gene, a methylation-specific primer and a probe for a target site of the OTX2 gene, and a methylation-specific primer and probe for a target site of the DAB2IP gene. The second nucleic acid composition comprises: a methylation-specific primer and a probe for a target site of the Septin9 gene, a methylation-specific primer and a probe for a target site of the CDKL2 gene, and a methylation-specific primer and probe for a target site of the GSTP1 gene. The kit configured with the nucleic acid composition discovered in the present invention determines whether a test sample has become cancerous based on the degree of DNA methylation of the test sample, thereby providing a clinically simple and accurate liver cancer screening method, which has a very positive significance for the detection of liver cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, in particular to a nucleic acid composition, a kit and a detection method for detecting methylation of liver cancer-related genes. Background Art

[0002] On February 2, 2024, the World Health Organization's International Agency for Research on Cancer (IARC) reported that there were approximately 900,000 new cases of liver cancer and 830,000 deaths worldwide. The five-year survival rate for patients with early-stage liver cancer is 34.2%, and less than 1% for patients in the late stage. Normal liver tissue does not have pain nerves, which means that liver cancer usually has no typical symptoms in the early stages. Even if symptoms such as loss of appetite, nausea and vomiting occur, they can easily be confused with other digestive tract diseases. "Discovery at the late stage" makes primary liver cancer (PLC) the third most common malignant tumor in the world with the highest mortality rate. Compared with the general population, some high-risk groups (such as those with cirrhosis (LC) or chronic hepatitis virus infection (CHVI)) have a significantly increased incidence of liver cancer, and they have a higher demand for early screening for liver cancer.

[0003] Currently, liver cancer screening primarily involves hematologic AFP (alpha-fetoprotein) testing and imaging studies. Current diagnostic and treatment approaches typically combine AFP and liver ultrasound (US) testing for regular screening of high-risk individuals. Abnormalities are then followed by CT or MRI examinations. While AFP is currently the most commonly used serological marker for liver cancer diagnosis, nearly 40% of liver cancer patients still have normal or low AFP levels. Elevated serum AFP levels can also occur in individuals with pregnancy, active hepatitis, reproductive system tumors, or other digestive tract cancers, such as those associated with gastrointestinal and pancreatic cancers. Although ultrasound (US) equipment is simple, inexpensive, and readily available, making it widely used clinically, its sensitivity for early-stage liver cancer is only 47%, and it is often affected by cirrhotic nodules, requiring high operator experience. Even with combined AFP and US testing, sensitivity for early-stage liver cancer is only 63%, still insufficient for early-stage liver cancer screening. Plain CT scans have difficulty visualizing very early liver cancers (<1 cm) or those with a density similar to that of normal liver parenchyma, and they also carry a certain amount of radioactivity. Although MRI has greatly improved performance compared to ultrasound (US) and CT, its detection sensitivity and specificity also have a certain ceiling.

[0004] Cell-free DNA (cfDNA) refers to free-living, non-cellular DNA fragments in biological fluids. These fragments typically originate from apoptosis or necrosis (released after cell damage or death). Currently, multiple guidelines and consensus documents recommend gene methylation for early screening and diagnosis of liver cancer, specifically noting that epigenetic modification testing in cfDNA has promising application as a supplement to personalized diagnosis. Circulating cell-free DNA in plasma can not only quantify tumor burden and assess prognosis but also assess the nature of lesions by detecting gene mutations and epigenetic alterations, offering the advantages of simplicity and minimal invasiveness. Aberrant DNA methylation is a key factor in tumor development and progression. Unlike individual and diverse gene mutations, specific tumor cell types often exhibit similar DNA methylation changes, whereas cfDNA methylation patterns can reflect the characteristics of their cell of origin or tissue. Therefore, detecting these specific alterations closely associated with tumors can facilitate early detection. The study showed that the incidence of TGR5 promoter hypermethylation was significantly higher in HCC patients (48.13%) compared with chronic hepatitis B (13.64%) and healthy controls (4.44%).

[0005] Currently, there is still no nucleic acid composition and kit with accurate results, fast timeliness, high detection throughput, good specificity, and good sensitivity for early detection of liver cancer methylation. The present invention solves this problem and can indirectly provide effective information for the early diagnosis of human liver cancer, providing a simple and easy method for early detection and treatment of liver cancer and monitoring of treatment effects. Summary of the Invention

[0006] In view of the existing technology, the purpose of the present invention is to provide a liver cancer methylation detection kit and a method for detecting liver cancer that can quickly and accurately diagnose the degree of DNA methylation in the test sample. It can determine whether the test sample has become cancerous based on the degree of DNA methylation in the test sample, providing a simple and accurate liver cancer screening method for clinical use.

[0007] In a first aspect, the present invention provides a nucleic acid composition for detecting methylation of liver cancer-related genes, characterized in that the nucleic acid composition is a first nucleic acid composition, a second nucleic acid composition, or a combination of the first nucleic acid composition and the second nucleic acid composition; the first nucleic acid composition comprises: a methylation-specific primer and probe for a target site of the EMX1 gene, a methylation-specific primer and probe for a target site of the OTX2 gene, and a methylation-specific primer and probe for a target site of the DAB2IP gene; the second nucleic acid composition comprises: a methylation-specific primer and probe for a target site of the Septin9 gene, a methylation-specific primer and probe for a target site of the CDKL2 gene, and a methylation-specific primer and probe for a target site of the GSTP1 gene; wherein,

[0008] The methylation-specific primers and probes for the EMX1 gene target site include:

[0009] Forward primer: SEQ ID NO: 1,

[0010] Reverse primer: SEQ ID NO: 2,

[0011] Probe: SEQ ID NO: 3;

[0012] The methylation-specific primers and probes for the OTX2 gene target site include:

[0013] Forward primer: SEQ ID NO: 4,

[0014] Reverse primer: SEQ ID NO: 5,

[0015] Probe: SEQ ID NO: 6;

[0016] The methylation-specific primers and probes for the DAB2IP gene target site include:

[0017] Forward primer: SEQ ID NO: 7,

[0018] Reverse primer: SEQ ID NO: 8,

[0019] Probe: SEQ ID NO: 9;

[0020] The methylation-specific primers and probes for the target site of the Septin9 gene include:

[0021] Forward primer: SEQ ID NO: 10,

[0022] Reverse primer: SEQ ID NO: 11,

[0023] Probe: SEQ ID NO: 12;

[0024] The CDKL2 internal reference gene specific primers and probes include:

[0025] Forward primer: SEQ ID NO: 13,

[0026] Reverse primer: SEQ ID NO: 14,

[0027] Probe: SEQ ID NO: 15;

[0028] The GSTP1 gene-specific primers and probes include:

[0029] Forward primer: SEQ ID NO: 16,

[0030] Reverse primer: SEQ ID NO: 17,

[0031] Probe: SEQ ID NO:18.

[0032] Optionally, the 5' end of the probe comprises a fluorescent reporter group, and the fluorescent reporter group is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5.

[0033] Optionally, the 3' end of the probe comprises a fluorescence quenching group, and the fluorescence quenching group is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, and DABCYL.

[0034] Optionally, ACTB internal reference gene specific primers and probes are also included.

[0035] The ACTB internal reference gene specific primers and probes include:

[0036] Forward primer: SEQ ID NO: 19,

[0037] Reverse primer: SEQ ID NO: 20,

[0038] Probe: SEQ ID NO: 21.

[0039] In a second aspect, the present invention provides a kit for detecting methylation of liver cancer-related genes, the kit comprising the nucleic acid composition described in the first aspect, and also comprising a PCR reaction solution, a positive quality control product, and a negative quality control product.

[0040] Optionally, the positive quality control product is genomic DNA of the liver cancer HepG2 cell line.

[0041] Optionally, the negative control product is sterile water.

[0042] Optionally, the PCR reaction solution includes PCR buffer, dNTP, MgCl2, BSA and Taq enzyme.

[0043] Optionally, the kit for detecting methylation of liver cancer-related genes is characterized in that the final concentrations of the components of the PCR reaction solution are: 1X PCR buffer, 0.2-0.5mM dNTP nuclease-free water, and 2-2.5U / μL Taq enzyme.

[0044] Optionally, the nucleic acid composition includes 0.2 μM to 0.5 μM EMX1 forward primer, 0.2 μM to 0.5 μM EMX1 reverse primer, 0.15 μM to 0.4 μM EMX1 detection probe, 0.2 μM to 0.5 μM OTX2 forward primer, 0.2 μM to 0.5 μM OTX2 reverse primer, 0.15 μM to 0.4 μM OTX2 detection probe, 0.2 μM to 0.5 μM DAB2IP forward primer, 0.2 μM to 0.5 μM DAB2IP reverse primer, 0.15 μM to 0.4 μM DAB2IP detection probe, 0.2 μM to 0.5 μM Septin9 forward primer, 0.2 μM to 0.5 μM Septin9 reverse primer, 0.15 μM to 0.4 μM Septin9 detection probe, 0.2 μM to 0.5 μM CDKL2 forward primer, 0.2μM~0.5μM CDKL2 reverse primer, 0.15μM~0.4μM CDKL2 detection probe, 0.2μM~0.5μM GSTP1 forward primer, 0.2μM~0.5μM GSTP1 reverse primer, 0.15μM~0.4μM GSTP1 detection probe, 0.2μM~0.5μM ACTB forward primer, 0.2μM~0.5μM ACTB reverse primer, 0.15~0.4μM ACTB detection probe.

[0045] In a third aspect, the present invention provides a method for detecting methylation of liver cancer-related genes, comprising the following steps:

[0046] (1) Plasma cfDNA extraction;

[0047] (2) CfDNA is converted to obtain purified BisDNA;

[0048] (3) PCR detection: The methylation status of the Bis-DNA obtained in step 2) is detected using the nucleic acid composition described in the first aspect in combination with methylation fluorescence quantitative PCR amplification technology.

[0049] Optionally, the reaction procedure of the PCR amplification is: 95°C, 5 min, 45 cycles 95°C 15 sec, 60°C 30 sec (collecting fluorescence).

[0050] The beneficial effects of the present invention are as follows:

[0051] The present invention found that a nucleic acid composition of a forward primer specific for EMX1, OTX2, DAB2IP, Septin9, CDKL2, and GSTP1, a specific reverse primer, and a specific probe has a synergistic effect in the sensitivity and specificity of detecting methylation of liver cancer-related genes;

[0052] The present invention uses the gene ACTB as an internal reference gene to control the quality of the sample. Considering the possibility of methylation of the housekeeping gene, positions without CpG sites are selected when designing the internal reference primers and probes. The design is based on the sequence after bisulfite treatment to ensure the quality control of the sample by the housekeeping gene.

[0053] The present invention designs primers and probes with high specificity, configures them into a kit that is easy to use and has reliable detection results, and combines them with a scientific and reasonable PCR reaction system, making the present invention rapid, high-throughput, sensitive and specific.

[0054] When the kit of the present invention is used for liver cancer screening, the positive detection rate (sensitivity) is 85% and the negative detection rate (specificity) is 90%, which can quickly and accurately measure the methylation level of liver cancer-related genes, so as to indirectly carry out timely and effective diagnosis and treatment of liver cancer, reduce medical costs, save social resources, and improve the quality of life. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 : Positive results of hypomethylation of EMX1, OTX2 and DAB2IP genes;

[0056] Figure 2 : EMX1, OTX2, DAB2IP three genes hypermethylation positive results diagram;

[0057] Figure 3 :EMX1 gene methylation positive result diagram;

[0058] Figure 4 :Positive results of OTX2 gene methylation;

[0059] Figure 5 :DAB2IP gene methylation positive result diagram;

[0060] Figure 6 :EMX1, OTX2, DAB2IP three genes methylation negative results diagram;

[0061] Figure 7 : Septin9, CDKL2, GSTP1 three genes hypomethylation positive results diagram;

[0062] Figure 8 : Septin9, CDKL2, GSTP1 three genes hypermethylation positive results diagram;

[0063] Figure 9 :Septin9 gene methylation positive result diagram;

[0064] Figure 10 :CDKL2 gene methylation positive result diagram;

[0065] Figure 11 : GSTP1 gene methylation positive result diagram;

[0066] Figure 12 :Negative results of Septin9, CDKL2, and GSTP1 gene methylation;

[0067] Figure 13 : Receiver operating characteristic curve established by the method for detecting liver cancer of the present invention. DETAILED DESCRIPTION

[0068] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0069] Example 1 A nucleic acid composition for detecting methylation of liver cancer-related genes

[0070] This embodiment provides a nucleic acid composition for detecting methylation of liver cancer-related genes. The nucleic acid composition targets the methylation sequences of the EMX1, OTX1, DAB2IP, Septin9, CDKL2, and GSTP1 genes, and comprises primers and probes designed for the target genes EMX1, OTX1, DAB2IP, Septin9, CDKL2, and GSTP1 genes, for detecting the degree of methylation in at least one target region of the promoter region of the EMX1, OTX1, DAB2IP, Septin9, CDKL2, and GSTP1 genes in a test sample. The promoter region is not strictly limited to a region within a promoter fragment, but rather a gene fragment in the vicinity of the promoter.

[0071] The methylation regions of the EMX1, OTX1, DAB2IP, Septin9, CDKL2, and GSTP1 genes all contain multiple CpGs. The nucleotide sequences of the methylation regions of each gene (sulfite conversion sequences of each gene) are shown in Table 1.

[0072] Table 1

[0073] gene sequence information EMX1 AGTATAAATAGTTGGATTTTTTTTTTAAGAATCGAGTTTGGACGCGGAGATGGAGTTAAGTGTGGTTGTATTTTCGGATTCGGAAATTCGTTGGGTATTGAAGGATTTTTCGAATTTTGTAGCGTTGTTGTTTCGCGGTTTATCGTCGTCGTTGTAGACGGATGCGTTTTTCGGCGGTTTTACGTTTTTTAGTTTCGGTTAGGTTTTTGGGTTGGGAGTCGAGTCGTTTCGGGTTTTTCG (SEQ IDNO:22) OTX2 GGCGTTTAGTTTTTTCGTTAATTTAGCGGTTGTAGCGGTTGCGGGATTAGGTGGGAATTCGGTGGCGGTCGCGTCGTCGTTGAGTATATTAGTTGTTTTATTTATTTGGAGTTCGGTTTTTATTTCGTTAGGTTTAGCGTTCGCGTTCGTGTCGGTGTCGGAGTTATTGGTCGCGTTTAGTAATATTTCGTGTATGTAGCGTTTCGTAGTTGTAGGCGTCGTTATCGTAGTAGTTTTTTATTTTATGTTTTACGGTTAGGGCGGTAGTTACGGTTAAGGTTATTTTACGTTTTTTTTTTTTTATTTTGGCGGCGTGGAT (SEQ ID NO:23) DAB2IP TTTTAGTTGTTAGTATTTGATTAGAATTATATTTTTCGTCGGGAGTGGTCGCGCGGTTTCGAAGTTTTCGGTCGGCGGTTATTTAAGCGAGGTTCGTCGTATTCGTTGCGTTGTAGTTTGGAGGTTTCGGGCGCGGGGAAGTTATGTTCGTTTTACGGAGGTAATAGTTAGTCGGTGAGTAGTTTCGAAATTTTTTTTTTTTTTGGTTTTATTTTTTTTTTAAAGATTTTTTTTTTTTTTTTG (SEQID NO:24) Septin9 TTGATTTTTTGTTCGGTTTTGAGTTATGTGATTCGGTGGGCGGGTCGCGGTTTTCGGCGCGTTTAGCGTAGTTCGACGTTTCGTTGTTGGGGTGAGTTTTGTTTTTTTGTTTTTTTTAGTTTTGTATTATTGGTTCGGGGGTTTTTAGGTGGCGCGGTCGC (SEQ ID NO:25) CDKL2 TGGGGACGTAGGGTTTTTGCGTGTTAGGGAGTAGAATTTGGGTCGAGTTTTAGGTGAAGGGGCGGGGTGGTTGGTTTTGAGTTAATTATGGTTCGTGACGATTCGGTTCGGTTAATTAGAAGAAGGGAGGTTTGGCGTTTTCGGGGCGGGTGAGAAATCGTTTTTTTTTGTAGTTTCGCGGTTAACGTTTTCGTTTAGGGGTAGTTGGAGCGGTGTAGGTTTTTAGGTTTTAGGTAT (SEQ ID NO:26) GSTP1 CGGGGATTTTAGGGCGTTTTTTTGCGGTCGACGTTCGGGGTGTAGCGGTCGTCGGGGTTGGGGTCGGCGGGAGTTCGCGGGATTTTTTAGAAGAGCGGTCGGCGTCGTGATTTAGTATTGGGGCGGAGCGGGGCGGGATTATTTTTATAAGGTTCGGAGGTCGCGAGGTTTTCGTTGGAGTTTCGTCGTCGTAGTTTTCGTTATTAGTGAGTACGCGCGGTTCGCGTTTTCG (SEQ ID NO:27)

[0074] The primers and probes designed for EMX1, OTX2, DAB2IP, Septin9, CDKL2, GSTP1, and the internal reference gene ACTB are shown in Table 2. The 5' end of the probe sequence is modified with a fluorescent group selected from any one of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5, and the 3' end is labeled with a fluorescence quencher selected from any one of MGB, BHQ-1, BHQ-2, and BHQ-3.

[0075] Table 2

[0076]

[0077] Example 2 A detection kit for detecting methylation of liver cancer-related genes

[0078] This example provides a detection kit for detecting methylation of liver cancer-related genes. The kit contains a first nucleic acid composition, a second nucleic acid composition, a PCR reaction solution, a positive control, and a negative control. The specific ratios are shown in Table 3. The methylation PCR reaction solution is composed of the following components: EMX1, OTX2, DAB2IP, Septin9, CDKL2, GSTP1, and internal reference primers at a concentration of 0.4 μM, a probe at a concentration of 0.2 μM, a PCR buffer at a concentration of 10 nM Tris pH 8.3, 500 mM KCl, 15 mM ammonium sulfate, MgCl2 at a concentration of 4 mmol / L, dNTPs at a concentration of 0.4 mmol / L, and Taq enzyme at a concentration of 200 U / mL.

[0079] Table 3: Ratio of liver cancer gene methylation detection kit

[0080]

[0081] Example 3 Method for detecting liver cancer using a liver cancer methylation detection kit

[0082] This embodiment provides a method for detecting liver cancer using a liver cancer methylation detection kit, comprising the following steps:

[0083] 1. Extract DNA from the sample to be tested. For human plasma samples, extract CfDNA. The amount of plasma sample used is 1-4 mL.

[0084] 2. Bisulfite conversion: The extracted DNA is subjected to bisulfite conversion, converting unmethylated cytosine C in the DNA to uracil (U), while methylated cytosine (C) remains unchanged, resulting in purified BisDNA. The converted DNA serves as a genomic DNA sample for PCR template. The conversion reagent used is bisulfite or bisulfite. Designing sequences after bisulfite treatment can ensure quality control of the sample by housekeeping genes.

[0085] 3. Prepare the PCR reaction system: Dispense methylation PCR reaction solutions 1 and 2 in the liver cancer methylation detection kit into eight tube strips at a volume of 15 μL / tube, and then add 10 μL of purified BisDNA to each of the methylation PCR reaction solutions 1 and 2;

[0086] 4. PCR fluorescence detection: After adding the sample, the eight-tube strip was tightly capped and placed in a qPCR instrument. The fluorescence detection channel and amplification cycle parameters were set for the qPCR instrument. The PCR amplification reaction program was as follows: denaturation at 95°C for 5 minutes; 45 cycles at 95°C for 15 seconds and 60°C for 30 seconds. Using the multi-channel fluorescent probe labeling of the qPCR instrument, EMX1, OTX2, DAB2IP, Septin9, CDKL2, GSTP1, and the internal reference gene ACTB were simultaneously detected, and the Δ Ct values ​​of the six target genes (target Ct value - internal reference Ct value) were obtained.

[0087] 5. Interpretation of test results: Calculate the difference in CT values ​​for EMX1, OTX2, DAB2IP, Septin9, CDKL2, GSTP1, and the internal reference gene ACTB, respectively, and substitute it into the fitting formula in Table 4 to calculate the P value. If the P value of any tube is greater than 0.6, the methylation test result can be judged as positive.

[0088] Table 4

[0089] Reagent Fitting formula Cutoff value PCR reaction solution 1 1 / (1 + EXP(-(9.637 - 0.321*(ΔCt - EMX1) - 0.343*(ΔCt - OTX2) - 0.353*(ΔCt - DAB2IP)))) 0.6189 PCR reaction solution 2 1 / (1 + EXP(-(9.637 - 0.334*(ΔCt - Septin9) - 0.315*(ΔCt - CDKL2) - 0.321*(ΔCt - GSTP1)))) 0.6205

[0090] The present invention's logistic regression analysis is as follows:

[0091] Through experiments, we established a logistic regression to analyze the joint detection of EMX1, OTX2, DAB2IP, Septin9, CDKL2, and GSTP1 methylation fitting regression in normal samples and liver cancer samples. The sensitivity and specificity were much higher than the detection and analysis results of single genes of EMX1, OTX2, DAB2IP, Septin9, CDKL2, and GSTP1. The statistical results are shown in Table 5.

[0092] Table 5

[0093] Target Sensitivity (%) Specificity (%) EMX1 75.0 100.0 OTX2 65.0 90.0 DAB2IP 75.0 90.0 Septin9 75.0 90.0 CDKL2 80.0 90.0 GSTP1 65.0 100.0 The detection reagent of the present invention 90.00 95.0

[0094] The receiver operating characteristic curve established by the verification experiment of the present invention is as follows: As shown, Figure 13 The results showed that methylation detection using the detection reagent of the present invention can significantly distinguish liver cancer patients from normal subjects, with the area under the ROC curve (AUC) being 0.936 (95% CI 0.916-0.956; P < 0.001).

[0095] Example 4 Accuracy Verification

[0096] This example is a test of the accuracy of the liver cancer methylation detection kit and the method for detecting liver cancer of the present invention. The specific experimental procedures and results are as follows:

[0097] Plasma cfDNA was extracted from 147 human plasma samples, and the nucleic acid was converted into BisDNA using sulfite. Methylation combined detection was then performed using the liver cancer methylation detection kit of Example 2. The qPCR test results and clinical diagnosis information are shown in Table 6.

[0098] Table 6

[0099]

[0100] Figure 13 Figures 1 - 12 This is a typical PCR amplification curve for detecting target genes (EMX1, OTX2, DAB2IP, Septin9, CDKL2, GSTP1) in human plasma samples.

[0101] The experimental data above demonstrate that, when compared with clinical diagnostic results for liver cancer screening using the present detection kit, the liver cancer methylation detection reagent provided by the present invention exhibits a sensitivity and specificity of 86.4% and 92.2%, respectively. The detection reagent provided by the present invention exhibits high sensitivity and specificity, comprehensively determining whether a sample has undergone cancerous transformation by detecting methylation of six target genes. This effectively compensates for variations that may arise from site selection and reaction system, thereby improving the accuracy of liver cancer detection.

[0102] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solutions obtained by equivalent replacement or equivalent transformation fall within the scope of protection of the present invention.

Claims

1. A nucleic acid composition for detecting methylation of liver cancer-related genes, characterized in that: The nucleic acid composition is a combination of a first nucleic acid composition and a second nucleic acid composition; The first nucleic acid composition includes: a methylation-specific primer and probe for the target site of the EMX1 gene, a methylation-specific primer and probe for the target site of the OTX2 gene, and a methylation-specific primer and probe for the target site of the DAB2IP gene; the second nucleic acid composition includes: a methylation-specific primer and probe for the target site of the Septin9 gene, a methylation-specific primer and probe for the target site of the CDKL2 gene, and a methylation-specific primer and probe for the target site of the GSTP1 gene; wherein, The methylation-specific primers and probes for the EMX1 gene target site include: Forward primer: SEQ ID NO: 1, Reverse primer: SEQ ID NO: 2, Probe: SEQ ID NO: 3; The methylation-specific primers and probes for the OTX2 gene target site include: Forward primer: SEQ ID NO: 4, Reverse primer: SEQ ID NO: 5, Probe: SEQ ID NO: 6; The methylation-specific primers and probes for the DAB2IP gene target site include: Forward primer: SEQ ID NO: 7, Reverse primer: SEQ ID NO: 8, Probe: SEQ ID NO: 9; The methylation-specific primers and probes for the target site of the Septin9 gene include: Forward primer: SEQ ID NO: 10, Reverse primer: SEQ ID NO: 11, Probe: SEQ ID NO: 12; The methylation-specific primers and probes for the CDKL2 gene target site include: Forward primer: SEQ ID NO: 13, Reverse primer: SEQ ID NO: 14, Probe: SEQ ID NO: 15; The methylation-specific primers and probes for the GSTP1 gene target site include: Forward primer: SEQ ID NO: 16, Reverse primer: SEQ ID NO: 17, Probe: SEQ ID NO:

18.

2. A nucleic acid composition for detecting methylation of liver cancer-related genes according to claim 1, characterized in that: The 5' end of the probe comprises a fluorescent reporter group, and the fluorescent reporter group is selected from FAM, HEX, ROX, JOE, VIC, TET, NED, FITC, CY3 or CY5.

3. A nucleic acid composition for detecting methylation of liver cancer-related genes according to claim 1, characterized in that: The 3' end of the probe comprises a fluorescence quenching group, and the fluorescence quenching group is selected from BHQ1, BHQ2, BHQ3, TAMRA, Eclipse, and DABCYL.

4. The nucleic acid composition for detecting methylation of liver cancer-related genes according to claim 1, characterized in that: The nucleic acid composition also includes ACTB internal reference gene specific primers and probes, The ACTB internal reference gene specific primers and probes include: Forward primer: SEQ ID NO: 19, Reverse primer: SEQ ID NO: 20, Probe: SEQ ID NO:

21.

5. A kit for detecting methylation of liver cancer-related genes, characterized in that: The kit comprises the nucleic acid composition according to any one of claims 1 to 4, and further comprises a PCR reaction solution, a positive quality control product, and a negative quality control product.

6. A kit for detecting methylation of liver cancer-related genes according to claim 5, characterized in that: The positive quality control product is the genomic DNA of the liver cancer HepG2 cell line.

7. A kit for detecting methylation of liver cancer-related genes according to claim 5, characterized in that: The negative control product is sterile water.

8. The kit for detecting methylation of liver cancer-related genes according to claim 5, characterized in that: The PCR reaction solution includes PCR buffer, dNTP, MgCl2, BSA and Taq enzyme.

Citation Information

Patent Citations

  • Primer and probe composition, kit and application in detection of EMX1 and CHFR gene methylation

    CN118834956A

  • Multi-gene methylation detection kit and detection system for liver cancer and application of multi-gene methylation detection kit and detection system

    CN119372313A