Molecular marker closely linked with coleoptile length under wheat alkali stress and application of molecular marker
By developing KASP-2A, a molecular marker that is closely linked to the long and long colloid sheath under wheat alkali stress, the genetic basis and molecular marker application of wheat under alkali stress was solved, and the efficiency and yield of wheat breeding were improved.
Patent Information
- Application Number
- CN202510648461.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2045-05-20
AI Technical Summary
The prior art is difficult to effectively solve the problem of genetic basis and molecular marker application of wheat in long colloid sheaths under alkali stress, affecting wheat alkali tolerance and yield.
A molecular marker KASP-2A, which is closely linked to the length of the colloid sheath under wheat-line stress, was developed. Through genome-wide association analysis and KASP marking technology, the SNP site AX-108780339, which is associated with the length of the colloid sheath, was identified and verified.
This molecular marker can quickly and accurately determine whether wheat varieties have sheath length-related QTL under alkaline stress, significantly improving the efficiency and yield of wheat breeding.
Smart Images

Figure CN120174148A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a molecular marker and its application, specifically to a molecular marker closely linked to the coleoptile length under alkali stress in wheat and its application in wheat assisted breeding and genetic improvement, belonging to the fields of wheat molecular biotechnology and breeding technology. Background Art
[0002] Soil salinization, as one of the abiotic stresses affecting the normal growth and development of crops, has a great impact on the yield and quality of wheat. Soil alkalization will cause stress on plants, resulting in the destruction of the internal homeostasis of plants, causing symptoms of nutrient deficiency in plants, wilting and even death. The wheat germination stage is more sensitive to the impact of stress than other stages, and the growth and development during the germination stage will affect the subsequent growth stages of wheat and ultimately affect the yield. Wheat alkali tolerance is a quantitative trait controlled by multiple genes, and the alkali tolerance mechanism is complex. Discovering new alkali tolerance genetic loci in wheat and its related species and applying them to breeding work has become the most economical, effective and safe method for cultivating alkali-tolerant wheat varieties.
[0003] As a unique embryonic structure of monocotyledonous plants, the coleoptile plays a key morphological protection role during the seed germination stage. Research shows that the coleoptile length of wheat with good growth under stress is more stable, and the coleoptile length of wheat during the germination stage can be used as one of the indicators for screening alkali tolerance during the germination stage. The wheat coleoptile length is a quantitative trait controlled by multiple genes, with a relatively complex genetic background and being greatly affected by the environment. Therefore, understanding the genetic basis, growth regulation mechanism of wheat coleoptile length and the application of molecular markers has become a key research field for wheat genetic improvement and breeding. Genome-wide association study (GWAS), by conducting a genome-wide molecular marker scan on a natural population and integrating and modeling it with multi-environment phenomics data, can systematically detect quantitative trait loci (QTLs) significantly associated with target traits and has become the core strategy for analyzing the genetic architecture of complex agronomic traits. The GWAS technology based on the principle of linkage disequilibrium can not only reveal the allelic variation characteristics of major genes but also analyze the additive effects of minor polygenes, showing significant advantages in the in-depth mining of crop genetic resources and molecular design breeding.
[0004] Currently, there are a large number of research reports on the growth and physiological response mechanism of coleoptiles. However, there are few research reports on the mapping of wheat coleoptile length under alkali stress. Summary of the Invention
[0005] The purpose of the present invention is to provide a molecular marker closely linked to the coleoptile length under alkali stress in wheat and its application, and to detect whether the wheat varieties (lines) have genes that increase the coleoptile length through the obtained molecular marker closely linked to the coleoptile length under alkali stress in wheat, so as to accelerate the breeding process of new high-yield wheat varieties.
[0006] To achieve the above object, the present invention adopts the following technical solutions: A molecular marker tightly linked to the coleoptile length under alkali stress in wheat, the molecular marker being KASP-2A, which can be amplified by two forward primers shown in SEQ ID NO: 1 and SEQ ID NO: 2 and one reverse primer shown in SEQ ID NO: 3. The molecular marker KASP-2A is tightly linked to the SNP locus AX-108780339. The SNP locus AX-108780339 is located on wheat chromosome 2A, and its physical position in the Chinese Spring reference genome sequence RefSeq v2.1 is 700893662, and the genotype is A / G.
[0007] The application of the aforementioned molecular marker KASP-2A tightly linked to the coleoptile length under alkali stress in wheat in identifying the coleoptile length trait of wheat, and its application in breeding wheat with genes for increasing coleoptile length.
[0008] The advantages of the present invention are as follows: (1) The molecular marker KASP-2A provided by the present invention can quickly and accurately determine whether a wheat variety (line) has QTL related to coleoptile length under alkali stress, providing excellent gene resources and selection tools for molecular breeding of wheat yield traits; (2) Using the molecular marker KASP-2A provided by the present invention in wheat molecular breeding can greatly reduce the workload of phenotypic identification and can be utilized at the wheat germination stage, saving both breeding costs and improving breeding efficiency. Description of the Drawings
[0009] Figure 1 It is a genotype typing result diagram of 96 randomly selected wheat based on the molecular marker KASP-2A. Among them, red represents GG, black represents no detected signal, purple represents a signal but no clear typing, and blue represents AA; Figure 2 It is a single marker analysis result diagram of the coleoptile length of all (305) wheat based on the molecular marker KASP-2A. *** indicates extremely significant difference (P<0.001). Detailed Embodiments
[0010] The present invention will be specifically introduced below with reference to the drawings and embodiments.
[0011] I. Hydroponics and phenotypic identification of the natural population in different experimental environments Thirty plump seeds were separately selected from each strain of the wheat natural population (305) and evenly placed.
[0012] Hydroponic cultures were carried out under alkali treatment (0.15 wt% Na2CO3) and control conditions (deionized water) respectively. The temperature in the culture room was 23 °C, with a light / dark cycle of 16 h / 8 h. The coleoptile length (SHL) was measured on the 8th day. The experiment was repeated three times. Among them, the three replicates under alkali treatment were recorded as environments E1, E2, and E3 respectively.
[0013] Method for measuring coleoptile length: Use a ruler with a precision of 0.01 cm to measure the length of wheat seeds from the root of the coleoptile to the top of the coleoptile. Measure 10 plants for each strain and take the average value.
[0014] II. Obtaining SNP loci Using the R package lme4, the best linear unbiased estimators (BLUEs) of each trait were calculated for the six groups of coleoptile length phenotypic values obtained from the investigation of the wheat natural population (305 accessions) under control conditions and alkali treatment, respectively, for the three replicates under control conditions and alkali treatment.
[0015] Based on the 55K chip of the natural population, a genome-wide association analysis was performed using the BLINK model of the R package GAPIT. The results showed that: under alkali treatment, a SNP locus significantly associated with coleoptile length was detected on chromosome 2A of wheat, which could be stably detected in the three environments of E1, E2, and E3. Referring to the Chinese Spring reference genome sequence RefSeq v2.1, this SNP locus is AX-108780339, located on chromosome 2A of wheat, with a physical position of 700893662 and a genotype of A / G. The P p-values for each environment are shown in Table 1.
[0016] Table 1 Results of genome-wide association analysis of AX-108780339
[0017] Note: ** indicates P < 0.01, * indicates P < 0.05.
[0018] III. Developing molecular markers and designing corresponding primers Currently, marker-assisted selection breeding using kompetitive allele-specific PCR (KASP) molecular markers can select for target traits at the DNA level. It not only has stable results, can reduce the cost of phenotypic evaluation, but also can improve the efficiency of wheat breeding.
[0019] In order to further verify and utilize the previously obtained SNP locus (AX-108780339), KASP markers were further developed. Based on the variation at the AX-108780339 locus and combined with the Chinese Spring wheat reference genome sequence RefSeq v2.1, a primer set for KASP markers was designed by the Wheat Consortium. This KASP marker primer set consists of two forward primers (Allele X, Allele Y) and one reverse primer (Common), where: Allele X is a single-stranded DNA molecule with the nucleotide sequence as follows: GAAGGTGACCAAGTTCATGCTGCCGATGCAGTTCACTATCCT (SEQ ID NO: 1); Allele Y is a single-stranded DNA molecule with the nucleotide sequence as follows: GAAGGTCGGAGTCAACGGATTCCGATGCAGTTCACTATCCC (SEQ ID NO: 2); Common is a single-stranded DNA molecule with the nucleotide sequence as follows: CCCATATGTGAGCTGCACTTGGTTA (SEQ ID NO: 3).
[0020] IV. Genotyping analysis of the wheat natural population using the molecular marker KASP-2A 1. PCR amplification Using the genomic DNA of 305 wheat varieties to be tested as a template, PCR amplification reactions were carried out using the above KAPS marker primer set (Allele X, Allele Y, and Common). The specific PCR reaction system and PCR amplification program are as follows: PCR reaction system: 0.8 μL of DNA template, 0.8 μL of 2×KASP Master Mix, and 0.022 μL of KASP Assay Mix. Among them, the preparation method of KASP Assay Mix is as follows: Mix 12 μL of Allele X with a concentration of 100 μM, 12 μL of Allele Y with a concentration of 100 μM, and 30 μL of Common with a concentration of 100 μM, and make up to 100 μL with Tris-HCl with a concentration of 10 mM.
[0021] PCR amplification program: Heat activation at 95°C for 15 min; denaturation at 95°C for 20 s, annealing and extension at 65 - 55°C for 60 s, 10 cycles, with a decrease of 0.6°C per cycle; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, 30 cycles.
[0022] 2. Fluorescence signal scanning and analysis The fluorescence signals of the PCR amplification products of the wheat samples to be tested were collected using a multifunctional microplate reader (PHERAstar, MG LABTECH, Germany), and the SNPviewer was used to analyze the fluorescence signals. According to the analysis results of the software (red / blue / violet / black), the genotype of the wheat samples to be tested at the AX-108780339 locus was determined as follows: (i) If the analysis result of the software is red, the genotype of the wheat samples to be tested at the AX-108780339 locus is GG; (ii) If the analysis result of the software is blue, the genotype of the wheat samples to be tested at the AX-108780339 locus is AA; (iii) If the analysis result of the software is violet, it indicates that there is a signal but no clear genotyping; (iv) If the analysis result of the software is black, it indicates that no signal was detected.
[0023] Ninety-six samples were randomly selected from 305 wheat varieties (lines), and the genotype typing results based on the molecular marker KASP-2A are shown in Figure 1 . The results showed that the genotype typing results based on the molecular marker KASP-2A were satisfactory.
[0024] In addition, it was found by comparison that the genotype typing results based on the molecular marker KASP-2A were consistent with those based on the wheat 55K chip, indicating that the KASP marker (KASP-2A) was successfully developed and could be further applied to the detection of breeding materials.
[0025] V. Association analysis between the molecular marker KASP-2A and coleoptile length In three replicates under alkali treatment, the 305 materials in the wheat natural population were genotyped using the molecular marker KASP-2A, and a significant difference analysis was performed on the coleoptile lengths of different genotypes. The single-marker analysis results of the coleoptile lengths of the 305 materials based on the molecular marker KASP-2A in three replicates are shown in Figure 2 .
[0026] The results showed that the GG genotype could significantly increase the coleoptile length compared to the AA genotype, and this result could be verified in three replicates under alkali treatment.
[0027] The above results proved that the molecular marker KASP-2A was a molecular marker tightly linked to the coleoptile length of wheat, and this molecular marker could be effectively applied to the molecular marker-assisted selection breeding program for wheat coleoptile length.
[0028] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, rather than limitations on the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is impossible to list all the implementation manners here. Any obvious changes or modifications derived from the technical solution of the present invention still fall within the protection scope of the present invention.
Claims
1. A molecular marker tightly linked to wheat coleoptile length under alkali stress, characterized in that: The molecular marker is KASP-2A, which can be amplified by two front primers shown in SEQ ID NO:1 and SEQ ID NO:2 and one rear primer shown in SEQ ID NO:
3. The molecular marker KASP-2A is tightly linked to the SNP site AX-108780339. The SNP site AX-108780339 is located on the wheat chromosome 2A, and its physical position in the Chinese spring reference genome sequence RefSeq v2.1 is 700893662, and its genotype is A / G.
2. Use of the molecular marker KASP-2A tightly linked to wheat coleoptile length under alkali stress as claimed in claim 1 in identifying the trait of wheat coleoptile length.
3. Use of the molecular marker KASP-2A tightly linked to the length of wheat coleoptiles under alkali stress as claimed in claim 1 in breeding wheat with a gene for increasing the length of coleoptiles.
Citation Information
Patent Citations
Major QTL for regulating and controlling synergistic elongation of mesocotyl and coleoptile of corn as well as molecular marker and application of major QTL
CN113957170A
KASP marker closely linked with wheat dwarf gene Rht15 and application of KASP marker in wheat
CN115521992A
Molecular marker closely linked with thousand grain weight of wheat and application of molecular marker
CN117965801A
Molecular marker closely linked with major QTL-qSHL-3B of coleoptile length under wheat drought stress and application of molecular marker
CN119162376A
Cited By
Molecular marker closely linked with major QTL-qSHL-1B of coleoptile length under wheat alkali stress and application of molecular marker
CN120442854A
Molecular markers tightly linked to the major QTL-qSHL-1B for coleoptile length under alkali stress in wheat and their application
CN120442854B