Fluorescent quantitative PCR detection reagent, detection method and application thereof

Abstract

The invention discloses a fluorescent quantitative PCR detection reagent, a detection method and application thereof, and relates to the technical field of biology. The kit comprises specific primers and probes aiming at mouse carried first virus, hantaan virus, arenavirus, coronavirus, norovirus, fiveleaf virus, group A rotavirus and paramyxovirus; the reagent disclosed by the invention is used for detecting nucleic acids of eight viruses carried by mice, is high in sensitivity and good in specificity, and can be used for accurately distinguishing eight pathogens; according to the present invention, the important viruses carried by murine animals can be detected, and the important significance is provided for the monitoring, the prevention and the control of the epidemic disease of the wild animal epidemic source.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a fluorescence quantitative PCR detection reagent, a detection method and their applications. Background Art

[0002] Mice belong to the rodent family Muridae and are also the most numerous and widely distributed mammals. Compared with common infectious diseases, emerging infectious diseases spread faster and originate from wild animals. The latest research suggests that the number of pathogens carried by wild animals is at least in the millions. Rodents are important reservoirs and transmitters of viruses in nature. Currently, through next-generation sequencing technology, the pathogen spectrum on mice has been screened, and eight pathogens have been identified, including: Seoul virus, with the English name Seoululvirus and the English abbreviation SEOV; Hantaan virus, with the English name Hantaan virus and the English abbreviation HTNV; arenavirus, with the English name arenavirus and the English abbreviation AREV; Coronavirus, with the English name Coronavirus and the English abbreviation COV; Norovirus, with the English name Norovirus and the English abbreviation NV; Sapovirus, with the English name Sapovirus and the English abbreviation SAV; group A Rotavirus, with the English name group A Rotavirus and the English abbreviation RVA; paramyxovirus, with the English name paramyxovirus and the English abbreviation PARV. Rodents generally transmit diseases to humans through two routes: the first is direct transmission to humans: rodents bite humans or humans eat food contaminated by rodents; the second is indirect transmission. At the same time, rodents can help maintain the transmission cycle of pathogens in many different environments, and the global climate change and the expansion of the human migration area further strengthen the transmission of pathogens, providing more favorable conditions for the spread of viruses.

[0003] Hantaviruses belong to the Bunyavirales order and originate from Apodemus agrarius. So far, only hantaviruses transmitted by rodents are related to human diseases, hemorrhagic fever with renal syndrome (HFRS for short) and hantavirus cardiopulmonary syndrome (HCPS for short). The main clinical symptoms of HFRS are bleeding, petechiae, eye inflammation, acute myopia, and acute renal failure to varying degrees. The clinical symptoms of HCPS are dry cough, rapidly worsening dyspnea on chest radiographs, and rapidly evolving bilateral interstitial edema. Among them, the genus Hantaan virus and the genus Seoul virus both have the possibility of being zoonotic; arenaviruses cause chronic infections in rodents around the world. Humans generally contract arenavirus diseases through mucosal exposure to aerosols or direct contact of abraded skin with infectious substances. Several arenaviruses can cause human hemorrhagic fever (HF for short) and pose serious public health problems in their endemic areas; the coronavirus of rodents was reported early and has an ancestral relationship with the human coronavirus HCoV-OC43. Alpha and beta coronaviruses are mainly found in mammals; noroviruses are now considered the main cause of human non-bacterial acute gastroenteritis outbreaks and cases. Noroviruses are highly contagious and can infect people of all ages who consume contaminated food and water or have close contact with infected individuals; paramyxoviruses have been isolated from rodents and have obvious hemorrhagic lung lesions; sapoviruses are a type of enterovirus in the family Caliciviridae, and the full-length viral genome has been obtained from rats; group A rotaviruses can cause diarrhea in humans and various animals. Recent studies have found evidence of zoonotic transmission and genomic reassortment of RVAs in bats and rodents.

[0004] Traditional serological detection reagents such as antigen-antibody have problems with poor sensitivity when detecting rodent viruses. Summary of the Invention

[0005] To solve the above problems, the present invention provides a fluorescence quantitative PCR detection reagent, a detection method, and their applications to solve the problem of poor sensitivity of existing detection methods.

[0006] The present invention is achieved through the following technical solutions: A fluorescence quantitative PCR detection reagent includes specific primers and probes for rodent-carried Seoul virus, Hantaan virus, arenavirus, coronavirus, norovirus, sapovirus, group A rotavirus, and paramyxovirus.

[0007] The specific primers for the Seoul virus include the upstream primer shown in SEQ ID NO: 1, the downstream primer shown in SEQ ID NO: 2, and the probe shown in SEQ ID NO: 3.

[0008] The specific primers for the Hantaan virus include the upstream primer shown in SEQ ID NO: 4, the downstream primer shown in SEQ ID NO: 5, and the probe shown in SEQ ID NO: 6.

[0009] The specific primers for the arenavirus include the upstream primer shown in SEQ ID NO: 7, the downstream primer shown in SEQ ID NO: 8, and the probe shown in SEQ ID NO: 9.

[0010] The specific primers for the coronavirus include the upstream primer shown in SEQ ID NO: 10, the downstream primer shown in SEQ ID NO: 11, and the probe shown in SEQ ID NO: 12.

[0011] The specific primers for the norovirus include the upstream primer shown in SEQ ID NO: 13, the downstream primer shown in SEQ ID NO: 14, and the probe shown in SEQ ID NO: 15.

[0012] The specific primers for the sapovirus include the upstream primer shown in SEQ ID NO: 16, the downstream primer shown in SEQ ID NO: 17, and the probe shown in SEQ ID NO: 18.

[0013] The specific primers for group A rotavirus include the upstream primer shown in SEQ ID NO: 19, the downstream primer shown in SEQ ID NO: 20, and the probe shown in SEQ ID NO: 21.

[0014] The specific primers for the paramyxovirus include the upstream primer shown in SEQ ID NO: 22, the downstream primer shown in SEQ ID NO: 23, and the probe shown in SEQ ID NO: 24.

[0015] Application of the fluorescence quantitative PCR detection reagent in murine viruses.

[0016] Preferably, the murine virus is one or more of Seoul virus, Hantaan virus, arenavirus, coronavirus, norovirus, sapovirus, group A rotavirus, and paramyxovirus.

[0017] A two-tube quadruple fluorescence quantitative PCR detection method using the fluorescence quantitative PCR detection reagent for detection.

[0018] Preferably, the specific steps include: (1) Extract RNA from the tissue sample to be tested.

[0019] (2) Reverse transcribe the RNA obtained in step (1) into cDNA.

[0020] (3) Using the cDNA obtained in step (2) as a template, divide the specific primers and probes into combination 1 and combination 2 for fluorescence quantitative PCR detection, and determine the results according to the Ct values.

[0021] The combination 1 is: specific primers and probes for Seoul virus, coronavirus, Hantaan virus and arenavirus; the combination 2 is: specific primers and probes for group A rotavirus, paramyxovirus, sapovirus and norovirus.

[0022] Preferably, the reaction program for the fluorescence quantitative PCR detection in step (3) is pre-denaturation at 95 °C for 30 s; denaturation at 95 °C for 5 s, the annealing temperature of combination 1 is 56 °C and extension for 30 s, the annealing temperature of combination 2 is 60 °C and extension for 30 s, for 40 cycles.

[0023] Preferably, the reaction system for the fluorescence quantitative PCR detection in step (3) is 20 μL of 2×Pro TaqHS ProbePremixⅡ, 4 μL of cDNA, the dosage of each of the upstream and downstream primers is 0.8 μL - 1.2 μL, the dosage of the probe is 0.4 μL - 0.6 μL, and sterile water is added to make up to 40 μL.

[0024] Preferably, the reaction system for the fluorescence quantitative PCR detection in step (3) is 20 μL of 2×Pro TaqHS ProbePremixⅡ, 4 μL of cDNA, the dosage of each of the upstream and downstream primers is 1 μL, the dosage of the probe is 0.5 μL, and sterile water is added to make up to 40 μL.

[0025] Preferably, the method for determining the results according to the Ct values in step (3) is that if the pathogen Ct value ≤ 36.0, it is positive; if 36 < Ct ≤ 40, and it is still 36 < Ct ≤ 40 after rechecking once, it is negative; if the CT value shows UNDFT and the sample is below the detection limit, the result is negative.

[0026] The application includes the following specific steps: 1. Extract the RNA in the intestine and lung of wild mice using the Tiangen virus group total RNA extraction kit.

[0027] 2. The RNA extracted in step 1 was reversed into DNA using the TAKARA6210 kit, and the reversed sample was used as a template, and specific primers and probes for eight pathogens were used to perform two-tube quadruple fluorescence quantitative PCR detection. Among them, combination 1 is: Seoul virus, coronavirus, Hantan virus, and arenavirus, and combination 2 is: Group A rotavirus, paramyxovirus, Zaru virus, and norovirus. The results were determined based on the Ct value; the reaction procedure was pre-denaturation at 95°C for 30s; denaturation at 95°C for 5s, annealing and extension at 56°C for 30s for combination one, annealing and extension at 60°C for combination two for 30s, and 40 cycles; the fluorescence signal was collected during the annealing and extension stage of each cycle.

[0028] The result determination based on the Ct value includes the following: (1) The amplification curve is a standard "S" shape with no abnormal fluctuations. If there is no Ct value in the negative control group and the template-free control group, the experiment is considered valid. If it does not meet the requirements, multiple fluorescence quantitative PCR detection must be performed again, or nucleic acid must be re-extracted for quadruple fluorescence quantitative PCR detection; (2) If the pathogen Ct value is ≤36.0, it is positive. If 36<Ct≤40, and the re-test is still 36<Ct≤40, it is negative; (3) If the CT value shows UNDFT, the sample is below the detection limit and the result is negative.

[0029] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention provides a fluorescent quantitative PCR detection reagent, a detection method and its application for detecting eight viruses carried by rodents, namely Seoul virus, coronavirus, Hantan virus, arenavirus, group A rotavirus, paramyxovirus, saprovirus and norovirus. The detection reagent has high sensitivity. The sensitivity evaluation found that the sensitivity of the eight pathogens reached 10 2 copies / μL; and it is efficient, safe, highly specific, time-saving and low-cost, which reduces the workload of pathogen detection to a certain extent and can be promoted and applied on a large scale.

[0030] (2) The two-tube quadruple fluorescent quantitative PCR detection method provided by the present invention was used to evaluate the specificity of the detection reagent, and it was found that there was no cross-reaction between pathogens, and the specificity was good, and the eight pathogens could be accurately distinguished; the repeatability of the method was evaluated and it was found that the coefficient of variation CV of each group of pathogens between and within batches was less than 5, and the repeatability was good; by testing RNA extracted from 12 rodent samples, the accuracy of the two-tube quadruple qPCR was evaluated, and the results showed that the two-tube quadruple qPCR method had good accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0032] Figure 1 This is a graph showing the reaction results of combination 1 in the quadruple fluorescent quantitative PCR system of the present invention.

[0033] Figure 2 This is a graph showing the reaction results of combination 2 in the quadruple fluorescent quantitative PCR system of the present invention.

[0034] Figure 3 This is a graph showing the results of the single-plex qPCR specificity experiment for Seoul virus and Hantan virus of the present invention.

[0035] Figure 3 In the figure, A is a graph showing the results of a single-plex qPCR specificity experiment for Seoul virus; B is a graph showing the results of a single-plex qPCR specificity experiment for Hantan virus.

[0036] Figure 4 This is a graph showing the specific experimental results of single-plex qPCR of arenavirus and coronavirus of the present invention.

[0037] Figure 4 In the figure, A is the result of single-plex qPCR specific experiment of arenavirus; B is the result of single-plex qPCR specific experiment of coronavirus.

[0038] Figure 5 This is a graph showing the results of the single-plex qPCR specificity experiment of Norovirus and Sazavirus of the present invention.

[0039] Figure 5 In the figure, A is the result of a single-plex qPCR specific experiment for Norovirus; B is the result of a single-plex qPCR specific experiment for Serranovirus.

[0040] Figure 6 This is a graph showing the results of a single-plex qPCR specificity experiment of group A rotavirus and paramyxovirus of the present invention.

[0041] Figure 6 In the figure, A is the result of the single-plex qPCR specific experiment of rotavirus in group A; B is the result of the single-plex qPCR specific experiment of paramyxovirus.

[0042] Figure 7 This is a graph showing the results of the single-plex qPCR sensitivity experiment of Seoul virus and Hantan virus of the present invention.

[0043] Figure 7Among them, A is the result graph of the single qPCR sensitivity experiment of Seoul virus; B is the result graph of the single qPCR sensitivity experiment of Hantaan virus.

[0044] Figure 8 This is the result graph of the single qPCR sensitivity experiment of Arenavirus and Coronavirus of the present invention.

[0045] Figure 8 Among them, A is the result graph of the single qPCR sensitivity experiment of Arenavirus; B is the result graph of the single qPCR sensitivity experiment of Coronavirus.

[0046] Figure 9 This is the result graph of the single qPCR sensitivity experiment of Norovirus and Sapovirus of the present invention.

[0047] Figure 9 Among them, A is the result graph of the single qPCR sensitivity experiment of Norovirus; B is the result graph of the single qPCR sensitivity experiment of Sapovirus.

[0048] Figure 10 This is the result graph of the single qPCR sensitivity experiment of Rotavirus group A and Paramyxovirus of the present invention.

[0049] Figure 10 Among them, A is the result graph of the single qPCR sensitivity experiment of Rotavirus group A; B is the result graph of the single qPCR sensitivity experiment of Paramyxovirus. Detailed implementation manners

[0050] For the convenience of understanding the present invention, the present invention will be described more comprehensively below, and preferred embodiments of the present invention are given. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure content of the present invention more thorough and comprehensive.

[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0052] The inventive concept of the present invention: Traditional serological detection methods such as antigen-antibody detect viruses through specific antigens or antibodies in serum. Although this method is widely used, its sensitivity is relatively low, and sometimes it may not be able to detect low-level pathogens, resulting in poor sensitivity.

[0053] Based on this, the present invention provides a fluorescence quantitative PCR detection reagent, which includes specific primers and probes for murine Seoul virus, Hantaan virus, Arenavirus, Coronavirus, Norovirus, Sapovirus, Rotavirus A and Paramyxovirus.

[0054] The specific primers for Seoul virus include an upstream primer as shown in SEQ ID NO: 1, a downstream primer as shown in SEQ ID NO: 2, and a probe as shown in SEQ ID NO: 3.

[0055] The upstream primer for Hantaan virus is as shown in SEQ ID NO: 4, the downstream primer is as shown in SEQ ID NO: 5, and the probe is as shown in SEQ ID NO: 6.

[0056] The upstream primer for Arenavirus is as shown in SEQ ID NO: 7, the downstream primer is as shown in SEQ ID NO: 8, and the probe is as shown in SEQ ID NO: 9.

[0057] The upstream primer for Coronavirus is as shown in SEQ ID NO: 10, the downstream primer is as shown in SEQ ID NO: 11, and the probe is as shown in SEQ ID NO: 12.

[0058] The upstream primer for Norovirus is as shown in SEQ ID NO: 13, the downstream primer is as shown in SEQ ID NO: 14, and the probe is as shown in SEQ ID NO: 15.

[0059] The upstream primer for Sapovirus is as shown in SEQ ID NO: 16, the downstream primer is as shown in SEQ ID NO: 17, and the probe is as shown in SEQ ID NO: 18.

[0060] The upstream primer for Rotavirus A is as shown in SEQ ID NO: 19, the downstream primer is as shown in SEQ ID NO: 20, and the probe is as shown in SEQ ID NO: 21.

[0061] The upstream primer for Paramyxovirus is as shown in SEQ ID NO: 22, the downstream primer is as shown in SEQ ID NO: 23, and the probe is as shown in SEQ ID NO: 24.

[0062] A method for rapidly detecting pathogens carried by rodents is established through multiplex fluorescence quantitative PCR technology, which can rapidly detect eight viruses carried by rodents, namely Seoul virus, coronavirus, Hantaan virus, arenavirus, group A rotavirus, paramyxovirus, sapovirus, and norovirus. It solves the problem of poor sensitivity in traditional methods and has the characteristics of high efficiency, safety, strong specificity, short time consumption, and low cost. To a certain extent, it reduces the workload of pathogen detection and can be widely promoted and applied on a large scale.

[0063] Based on the same inventive concept, the present invention provides a two-tube fourplex fluorescence quantitative PCR detection method, and the specific steps include: (1) Extract RNA from the tissue sample to be tested.

[0064] (2) Reverse transcribe the RNA extracted in step (1) into cDNA.

[0065] (3) Using the cDNA obtained in step (2) as a template, divide the specific primers and probes described in claim 1 into combination 1 and combination 2 for fluorescence quantitative PCR detection, and determine the results according to the Ct value.

[0066] The combination 1 is: specific primers and probes for Seoul virus, coronavirus, Hantaan virus, and arenavirus; the combination 2 is: specific primers and probes for group A rotavirus, paramyxovirus, sapovirus, and norovirus. This application has established a two-tube fourplex fluorescence quantitative PCR detection method for eight viruses SEOV, COV, HTNV, AREV, RVA, PARV, SAV, and NV carried by rodents. Specificity evaluation of this method found that there was no cross-reaction between pathogens, and the specificity was good, and it could accurately distinguish eight pathogens; repeatability evaluation of this method found that the coefficient of variation (CV) of each group of pathogens between batches and within batches was less than 5, and the repeatability was good; by detecting RNA extracted from 12 rodent samples and performing accuracy evaluation of two-tube fourplex qPCR, the results found that the accuracy of the two-tube fourplex qPCR method was good.

[0067] To better illustrate the present invention, the technical solution of the present invention will be further elaborated below in conjunction with specific embodiments.

[0068] Example 1. Design of specific primers and probes 1. Download the pathogen gene reference sequences on the NCBI website as follows: 197 in total, including the L gene of Seoul virus, the RDRP gene of coronavirus, the S gene of Hantaan virus, the RDRP gene of arenavirus, the L gene of paramyxovirus, the VP1 gene of norovirus, the VP1 gene of sapovirus, and the VP4 gene of group A rotavirus. NCBI website: https: / / www.ncbi.nlm.nih.gov / .

[0069] 2. Align the nucleotide sequences using Mega 7 software and design primers and probes using Primer Select software.

[0070] 3. Primer and probe BLAST evaluation: For the nucleotide sequences of the primers and probes preliminarily designed, use the BLAST search function on the NCBI website again for alignment and select the primer and probe sequences with high specificity.

[0071] The nucleotide sequences of the specific primers and probes targeting the pathogens carried by 8 species of mice are shown as SEQ ID NO: 1 to SEQ ID NO: 24 in Table 1.

[0072] Table 1 Nucleotide sequences of specific primers and probes for pathogens carried by 8 species of mice

[0073] Example 2. Establishment of a two-tube multiplex fluorescence quantitative PCR method 1. Construction of plasmids Connect the specific gene sequences of Seoul virus, Hantaan virus, coronavirus, and arenavirus to the pBluescript IISK(+) vector to construct plasmid A. The specific gene sequences are shown as SEQ ID NO: 25 to SEQ ID NO: 28. Connect the specific gene sequences of Zhalv virus, norovirus, group A rotavirus, and paramyxovirus to the pBluescript II SK(+) vector to construct plasmid B. The specific gene sequences are shown as SEQ ID NO: 29 to SEQ ID NO: 32. The virus positive reference products A and B carried by mice, and the plasmid construction was completed by Sangon Biotech (Shanghai) Co., Ltd.; perform concentration determination using an ultraviolet spectrophotometer, and calculate the copy number of the plasmid according to the length and concentration of each plasmid. The calculation formula is as follows: 。

[0074] The copy number results of plasmid A are shown in Table 2; the copy number results of plasmid B are shown in Table 3.

[0075] Table 2 Plasmid A

[0076] Table 3 Plasmid B

[0077] The specific gene sequence of Seoul virus is shown as SEQ ID NO: 25 and is: GAATTCAGGCAAGGAACATGGTAAGCCCTGTCATGAGTGTAGTTGGGTTTTTGGCACTGGCAAAAGACTGGACATCTAGAATTGAAGAATGGCTTGGCGCACCCTGCAAGTTCATGGCAGAGTCTCCCATTGCCGGGAGTTTATCTGGGAATCCTGTAAATCGTGACTATATCAGACAGAGACAAGGTGCACTTGCAGGAATGGAGCCAAAGGGGATCC。

[0078] The specific gene sequence of Hantaan virus is shown in SEQ ID NO: 26 and is as follows: GAATTCATGGCAACTATGGAGGAATTACAGAGGGAAATCAATGCCCATGAGGGTCAATTAGTGATAGCCAGGCAGAAGGTGAGGGATGCAGAAAAACAGTATGAAAAGGATCCAGATGAGTTGAACAAGAGAACATTAACTGACCGAGAGGGCGTTGCAGTATCTATCCAGGCAAAAATTGATGGGATCC。

[0079] The specific gene sequence of Arenavirus is shown in SEQ ID NO: 27 and is as follows: GAATTCAGTCTAGTAAACATCTTTGTTCTAAGATCACCAATATATAATTCTCTGTTACCACCCACTTGTTCTTTATATGACAAAGAAAACTTAAGCCTTCCTGTATCAGGTCCCACTGAGTCATAAGATTGTGGCGACTCTTGGCTATAAAAACACAAATTCTTTAACATTGCTGTGGTACAGTTTGTCAGTGACAGAGCCTTACTAAGTGCCTCTGAATTGGATCC。

[0080] The specific gene sequence of Coronavirus is shown in SEQ ID NO: 28 and is as follows: GAATTCGAATGTTTCATCAAAAGTGTTTAAAGAGTATAGCAGCTACTCGTGGTGTTCCTGTTGTTATAGGCACCACGAAGTTTTATGGCGGATGGGATGACATGTTACGCCGCCTTATTAAAGATGTTGATAGTCCTGTACTCATGGGTTGGGACTATCCTAAATGTGATCGTGCTATGCCAAACATACTGCGTATGGATCC。

[0081] The specific gene sequence of norovirus is shown in SEQ ID NO: 29 and is as follows: GAATTCCTCACCACTGCTCAGATCACATGCTTCCCACATGTCATGTGTGATGTGCGCACCCTGGAGCCCATTCAACTCCCTCTTCTTGACGTGCGTCGAGTTCTTTGGCATGCTACCCAGGATCAGGAGGAATCTATGCGCCTGGTTTGCATGCTGTACACGCCACTCCGCACAAACAGCCCGGGTGATGAGTCTTTTGTGGTCTCTGGCCGCCTTCTTTCTAAGCCGGCGGCTGATTTTAATTTTGTATACCTGACCCCCCCGGATCC。

[0082] The specific gene sequence of sapovirus is shown in SEQ ID NO: 30 and is as follows: GAATTCCCTGTTTTTGATGTTAGGAATGTGGATTTCCATTATTATAATGATCAAATGGTGCAAAGTCTTGGCATCTGGGTCTTCCAACCCCTGATAAATCCCTTTGATGTTGCTGGTAACACCACCGCAACTGTAACTGTGGAGACCTGCCCTGGGCCTGATTTCCAGTTCATGCTTCTTAGACCCCCTGGTGATTCAACTGGTGCTTCTGATCCTTCTGACCTGTTTCCCACCAATCTTCTCCTGGCCCGGGATAACCGGGTGGGGGATCC。

[0083] The specific gene sequence of group A rotavirus is shown in SEQ ID NO: 31 and is as follows: GAATTCAAGTGATTAAGGAGAATTCATTCGTGTACATAGACTATTGGGACGACTCTCAGGCTTTCAGAAATATGGTCTATGTGCGCTCACTAGCGGCTGATTTGAACACTGTCGAATGCACTGGGGGGGCGTACAGCTTTTCACTACCAGTTGGGCAATGGCCGGTGATGACGGGTGGTGCAGTGTCTTTGCGAGCTGCCGGAGTTACACTAGGATCC。

[0084] The specific gene sequence of paramyxovirus is shown in SEQ ID NO: 32 and is as follows: GAATTCGGTCATGCATTGTTCTGCGGTATAATCATTAATGGTTTCAGAGATAGACATGGAGGAGCATGGCCACCTCACACTTTTCCTGACCATGTAGACAAGCCGGTTAGAGAGGCATCAATGAACTCAGAGGCTCTAACTCATGAATTGTGTATACAGAACTGGAAATCATTTGTTGGATTCAAATTTAAGTGTTTCATGCCTCTTACTCTAGATGAAGACCTCACCATGTATATGAAGGACAAAGCACTTGCTGCGATAAAGCCAGAGTGGGGGATCC。

[0085] 2. Confirmation of the two-tube quadruple fluorescence quantitative reaction system Using the positive reference product with a copy number of 10 4 copies / μL as a template, and using the Premix Ex Taq premixed probe method kit from TAKARA Bio Inc., two-tube quadruple fluorescence quantitative PCR detection was performed. The real-time fluorescence quantitative PCR instrument was the Bio-Rad FQD-96a; among them, the two tubes were: Group 1 was Seoul virus, Hantaan virus, coronavirus, and arenavirus, and Group 2 was sapovirus, norovirus, rotavirus A, and paramyxovirus.

[0086] The reaction system consists of 20 μL of 2×Pro TaqHS Probe PremixⅡ, 4 μL of template, upstream primer, downstream primer, and probe, and sterile water is added to make up to 40 μL; the amounts of the upstream or downstream primer for each gene in the reaction system are 0.8 μL, 1 μL, and 1.2 μL respectively, the primer concentration is 10 μM, the amount of the probe in the reaction system is 0.4 μL, 0.5 μL, and 0.6 μL, the probe concentration is 10 μM, and the final concentration of the probe in the reaction system is 100 nmol / L; the Tm values are 56°C, 58°C, and 60°C respectively; the reaction program is: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing and extension at 60°C for 30 s, for 40 cycles; fluorescence signals are collected during the annealing and extension stage of each cycle; after reacting under the above condition combinations.

[0087] When the annealing temperature is 56°C, the primer and probe combinations are divided into 9 groups, and the two-tube fourplex fluorescence quantitative PCR combinations are shown in Tables 4 and 5.

[0088] Table 4 Two-tube fourplex fluorescence quantitative PCR combination 1 when the annealing temperature is 56°C

[0089] Table 5 Two-tube fourplex fluorescence quantitative PCR combination 2 when the annealing temperature is 56°C

[0090] When the annealing temperature is 58°C, the primer and probe combinations are divided into 9 groups, and the two-tube fourplex fluorescence quantitative PCR combinations are shown in Tables 6 and 7.

[0091] Table 6 Two-tube fourplex fluorescence quantitative PCR combination 1 when the annealing temperature is 58°C

[0092] Table 7 Two-tube fourplex fluorescence quantitative PCR combination 2 when the annealing temperature is 58°C

[0093] When the annealing temperature is 60°C, the primer and probe combinations are divided into 9 groups, and the two-tube fourplex fluorescence quantitative PCR combinations are shown in Tables 8 and 9.

[0094] Table 8 Two-tube fourplex fluorescence quantitative PCR combination 1 when the annealing temperature is 60°C

[0095] Table 9 Two-tube fourplex fluorescence quantitative PCR combination 2 when the annealing temperature is 60°C

[0096] By comparing the average Ct value and the standard deviation of the Ct value, as well as comprehensive indexes such as the amplification curve of the experimental group, when the upstream or downstream primer dosage is determined to be 1.0 μL, the final concentration of the probe is 0.5 μL, the Tm value of combination 1 is 56 °C, and the Tm value of combination 2 is 60 °C, the reaction system is optimal, and it is confirmed that the detection results of the reaction system are as Figures 1 - 2 shown.

[0097] Example 3. Evaluation of the specificity, sensitivity, and repeatability of the detection primers of the present invention by fluorescence quantitative PCR Collect 4 other pathogens from wild mice - bocavirus, hepatitis B virus, picornavirus, and astrovirus. Using the pathogen DNA as a template, the DNA of hepatitis B virus and bocavirus is extracted through the Tiangen kit DP315, and the DNA of astrovirus and picornavirus is extracted through the Tiangen total viral RNA kit. Reverse transcribe astrovirus and picornavirus into DNA using the TAKARA 6210A reverse transcription kit, set the corresponding viral positive reference products as controls, add the primers and probes of the four murine viruses into two groups respectively, and set a negative control group with ddH2O as the template.

[0098] Combination 1 is shown in Table 10.

[0099] Table 10 Combination 1

[0100] Combination 2 is shown in Table 11.

[0101] Table 11 Combination 2

[0102] The amplification program is: pre-denaturation at 95 °C for 30 s; denaturation at 95 °C for 15 s, annealing and extension at 56 °C for 30 s for combination 1, annealing and extension at 60 °C for 30 s for combination 2, 40 cycles, and fluorescence signals are collected at the annealing and extension stage of each cycle.

[0103] The results are as Figures 3 - 10 shown; it can be seen from the above results that there is no cross-reaction between the pathogens in each group.

[0104] 2. Evaluation of the sensitivity of fluorescence quantitative PCR Using the viral positive reference product as a template, the positive plasmid prepared in step 1 of Example 2 is serially diluted by a factor of 10 to 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2copies / μL, 10 1 copies / μL, and specific primers and probes for eight viruses carried by mice were used to detect the minimum detection concentration of each virus. The reaction system and amplification procedure were the same as step 1 of this embodiment.

[0105] The results are as follows Figures 3 - 10 As shown in the figure, the amplification curves are 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 The results showed that the detection limit of the detection system of the present invention for eight viruses can reach 10 2 copies / μL.

[0106] 3. Repeatability evaluation of two-tube quadruple fluorescence quantitative PCR In order to verify the repeatability of the two-tube quadruple qPCR assay, a concentration of 10 5 The mouse virus positive reference samples A and B with a concentration of 100 copies / μL were used as templates for a two-tube quadruple experiment, and the detection was performed using a Biori FQD-96a real-time fluorescence quantitative PCR instrument. The reaction system and amplification procedure were the same as step 1 of this embodiment; the fluorescence signal was collected during the annealing and extension phase of each cycle; the two tubes were: combination 1 was Seoul virus, Hantan virus, coronavirus, and arenavirus, and combination 2 was Zarovirus, Norovirus, Group A rotavirus, and paramyxovirus; Repeatability experiments were performed within and between groups respectively; the plasmid templates were tested with specific primers and probes of eight viruses. Repeat within the batch: repeat three times at the same time, observe and record the Ct value; repeat between batches: repeatability test was performed every Wednesday for three consecutive weeks, and the Ct value was observed and recorded. The CV value was calculated according to the following formula: CV%=sample standard deviation / sample mean×100%.

[0107] The coefficient of variation of each virus under the same template concentration, English name is Coefficient of Variation, English abbreviation is CV, which is less than 5, indicating that the mqPCR method has good repeatability. The repeatability results are shown in Table 12 below.

[0108] Table 12 Repeatability results

[0109] Example 4: Detection of Samples by Two-Tube Quadruple Fluorescent Quantitative PCR 1. Sample Source Collect the intestinal and lung tissues of 12 existing positive samples in the research group, mark information such as date, collection location, and number, and store them at -80°C until nucleic acid extraction.

[0110] 2. Nucleic Acid Extraction Use the Tiangen Total RNA Extraction Kit for Viral Genomes DP210831 to extract RNA. The specific operation steps are as follows: a. Preparation before the experiment: Before the first use, add absolute ethanol to the protein removal solution RD and the washing solution RW. The added amount can be found on the bottle label.

[0111] b. Sample aliquoting: Aliquot 200 μL of blood into a new EP tube, and grind the tissue in liquid nitrogen. Add 1 mL of lysis buffer RZ to every 50 mg - 100 mg of tissue, and homogenize with a homogenizer. The sample volume should not exceed one-tenth of the volume of lysis buffer RZ.

[0112] c. Let the homogenized sample stand at room temperature for 5 min to completely separate the nucleic acid-protein complex.

[0113] d. Add 200 μL of chloroform, cover the tube cap, shake vigorously for 15 sec, and let it stand at room temperature for 3 min.

[0114] e. Centrifuge at 12000 rpm at 4°C for 10 min. The sample will be divided into three layers: the yellow organic phase, the middle layer, and the colorless aqueous phase. RNA is mainly in the aqueous phase, and the volume of the aqueous phase is approximately 50% of the volume of the lysis buffer RZ reagent used. Transfer the aqueous phase to a new tube for the next step.

[0115] f. Slowly add 0.5 volume of absolute ethanol and mix well. Precipitation may occur at this time. Transfer the resulting solution and precipitate together into the adsorption column CR3, centrifuge at 12000 rpm at 4°C for 30 sec. If all the solution and mixture cannot be added to the adsorption column CR3 at one time, transfer them to the adsorption column CR3 in two portions and centrifuge at 12000 rpm at 4°C for 30 sec. Discard the waste liquid in the collection tube.

[0116] g. Add 500 μL of protein removal solution RD to the adsorption column CR3, centrifuge at 12000 rpm at 4°C for 30 sec, discard the waste liquid, and place CR3 in the collection tube.

[0117] h. Add 500 μL of washing solution RW to the adsorption column CR3, let it stand at room temperature for 2 min, centrifuge at 12000 rpm at 4°C for 30 sec, and discard the waste liquid.

[0118] i. Repeat step h.

[0119] j. Place the adsorption column into a 2 mL collection tube, centrifuge at 12,000 rpm for 2 min at 4°C, and remove the residual liquid.

[0120] k. Transfer the adsorption column CR3 into a new 1.5 mL centrifuge tube, add 50 μL of RNase-Free ddH2O, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 2 min at 4°C.

[0121] 3. Reverse transcription Reverse transcribe the extracted sample RNA into DNA using the reverse transcription kit TAKARA6210A.

[0122] a. Prepare the following reaction mixture in a Microtube. The usage amounts of each reagent in the reaction mixture are shown in Table 13.

[0123] Table 13 Usage amounts of each reagent in the reaction mixture

[0124] b. Incubate at 65°C for 5 min and then quickly cool on ice.

[0125] c. Prepare the following reverse transcription reaction solution in the above Microtube, with a total volume of 20 μL. The usage amounts of each reagent in the reverse transcription reaction solution are shown in Table 14.

[0126] Table 14 Usage amounts of each reagent in the reverse transcription reaction solution

[0127] d. Mix gently.

[0128] e. Perform the reverse transcription reaction according to the following conditions.

[0129] f. 42°C for 30 min.

[0130] g. After 95°C for 5 min, cool on ice.

[0131] 4. Two-tube quadruple qPCR detection.

[0132] Using the reverse-transcribed DNA as a template, detect it using the Bioer FQD-96a real-time fluorescence quantitative PCR instrument. The amplification reaction program is: pre-denaturation at 95°C for 30 s; denaturation at 95°C for 5 s, annealing at 56°C for combination 1, annealing at 60°C and extension for 30 s for combination 2, 40 cycles; collect fluorescence signals during the annealing and extension stage of each cycle; the reaction system is the same as in step 1 of Example 3.

[0133] At the same time, molecular sequencing detection is used as a control, and the results are shown in Table 15.

[0134] Table 15 Control results of molecular sequencing detection

[0135] As can be seen from the above table, the two-tube quadruple fluorescence quantitative PCR species detection reagent for eight viruses carried on rodents provided by the present invention, namely Seoul virus, coronavirus, Hantaan virus, arenavirus, group A rotavirus, paramyxovirus, sapovirus, and norovirus, has the advantages of high efficiency, sensitivity, safety, etc., can play a very good complementary role in the results of first-generation sequencing, and provides strong support for the prevention, control and monitoring of the customs quarantine and inspection department.

[0136] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of concise description, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered to be within the scope described in this specification.

[0137] The above-described embodiments only represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. A fluorescent quantitative PCR detection reagent, characterized in that: Includes specific primers and probes for Seoul virus, Hantan virus, arenavirus, coronavirus, norovirus, Zarovirus, group A rotavirus, and paramyxovirus carried by rodents; The Seoul virus specific primers include an upstream primer as shown in SEQ ID NO: 1, a downstream primer as shown in SEQ ID NO: 2, and a probe as shown in SEQ ID NO: 3; The specific primers for Hantaan virus include an upstream primer as shown in SEQ ID NO: 4, a downstream primer as shown in SEQ ID NO: 5, and a probe as shown in SEQ ID NO: 6; The specific primers for the arenavirus include an upstream primer as shown in SEQ ID NO: 7, a downstream primer as shown in SEQ ID NO: 8, and a probe as shown in SEQ ID NO: 9; The coronavirus-specific primers include an upstream primer as shown in SEQ ID NO: 10, a downstream primer as shown in SEQ ID NO: 11, and a probe as shown in SEQ ID NO: 12; The norovirus-specific primers include an upstream primer as shown in SEQ ID NO: 13, a downstream primer as shown in SEQ ID NO: 14, and a probe as shown in SEQ ID NO: 15; The specific primers for the Zaru virus include an upstream primer as shown in SEQ ID NO: 16, a downstream primer as shown in SEQ ID NO: 17, and a probe as shown in SEQ ID NO: 18; The specific primers for group A rotavirus include an upstream primer as shown in SEQ ID NO: 19, a downstream primer as shown in SEQ ID NO: 20, and a probe as shown in SEQ ID NO: 21; The specific primers for the paramyxovirus include an upstream primer as shown in SEQ ID NO: 22, a downstream primer as shown in SEQ ID NO: 23, and a probe as shown in SEQ ID NO:

24.

2. The use of the fluorescent quantitative PCR detection reagent in murine viruses according to claim 1, characterized in that: The murine virus is one or more of Seoul virus, Hantan virus, arenavirus, coronavirus, norovirus, saprovirus, group A rotavirus and paramyxovirus.

3. A two-tube quadruple fluorescence quantitative PCR detection method, characterized in that: The detection is performed using the fluorescent quantitative PCR detection reagent described in claim 1.

4. The two-tube quadruple fluorescence quantitative PCR detection method according to claim 3, characterized in that: The specific steps include: (1) Extracting RNA from the tissue sample to be tested; (2) reverse transcribing the RNA extracted in step (1) into cDNA; (3) Using the cDNA obtained in step (2) as a template, the specific primers and probes described in claim 1 are divided into combination 1 and combination 2 for fluorescence quantitative PCR detection, and the results are determined according to the Ct value; The combination 1 is: specific primers and probes for Seoul virus, coronavirus, Hantaan virus and arenavirus; the combination 2 is: specific primers and probes for group A rotavirus, paramyxovirus, Zarovirus and Norovirus.

5. The two-tube quadruple fluorescence quantitative PCR detection method according to claim 4, characterized in that: The reaction procedure of the fluorescence quantitative PCR detection in step (3) is pre-denaturation at 95°C for 30s; denaturation at 95°C for 5s, annealing temperature of combination 1 at 56°C and extension for 30s, annealing temperature of combination 2 at 60°C and extension for 30s, and 40 cycles.

6. The two-tube quadruple fluorescence quantitative PCR detection method according to claim 4, characterized in that: The reaction system for the fluorescence quantitative PCR detection in step (3) is 20 μL of 2×Pro TaqHS Probe PremixⅡ, 4 μL of cDNA, 0.8 μL~1.2 μL of upstream and downstream primers respectively, 0.4 μL~0.6 μL of probe, and sterile water is added to make up to 40 μL.

7. The two-tube quadruple fluorescence quantitative PCR detection method according to claim 4, characterized in that: The reaction system for the fluorescence quantitative PCR detection in step (3) is 20 μL of 2×Pro TaqHS Probe PremixⅡ, 4 μL of cDNA, 1 μL of upstream and downstream primers, 0.5 μL of probe, and sterile water is added to make up to 40 μL.

8. The two-tube quadruple fluorescence quantitative PCR detection method according to claim 4, characterized in that: In step (3), the result determination method based on the Ct value is that if the pathogen Ct value is ≤36.0, it is positive; if it is 36<Ct≤40, and the re-test is still 36<Ct≤40, it is negative; if the CT value shows UNDFT, the sample is below the detection limit and the result is negative.

Images