Nano antibody of antibacterial hair adhesion protein CfaE as well as preparation method and application of nano antibody

Abstract

The invention belongs to the field of biological pharmacy and animal medicine, and particularly relates to a nano antibody of antibacterial hair adhesin protein CfaE as well as a preparation method and application of the nano antibody. The invention provides a nano antibody mVHH-IgA of antibacterial hair adhesin protein CfaE, the nano antibody at least comprises a VHH fragment, the VHH fragment comprises three amino acid fragments of CDR1, CDR2 and CDR3, the amino acid sequence of the CDR1 is shown as SEQ ID NO.1, the amino acid sequence of the CDR2 is shown as SEQ ID NO.2, the amino acid sequence of the CDR3 is shown as SEQ ID NO.3, and the nano antibody mVHH-IgA is fused with a secreting type IgA alpha chain constant region. The nano-antibody mVHH-IgA provided by the invention has high specificity and stability, the nano-antibody mVHH-IgA is used as a feed additive and is mixed with a conventional feed to feed animals, and animal experiments show that the feed containing the nano-antibody mVHH-IgA provided by the invention can be used for effectively treating porcine bacterial diarrhea.

Description

Technical Field

[0001] This application belongs to the fields of biopharmaceuticals and veterinary medicine, and specifically relates to nanobodies against the fimbrial adhesin protein CfaE, their preparation methods, and applications. Background Art

[0002] Enterotoxigenic Escherichia coli (ETEC) is one of the main pathogens causing bacterial diarrhea in piglets. It mediates adhesion to host intestinal epithelial cells through its virulence factor, the fimbrial adhesin protein CfaE (Colonization Factor Antigen E). CfaE specifically recognizes receptors on the surface of host intestinal epithelial cells (such as GM1 ganglioside), mediates bacterial colonization in intestinal epithelial cells, and releases enterotoxin, leading to dehydration and death of the host. Currently, the prevention and treatment of piglet bacterial diarrhea mainly rely on antibiotics, but this is prone to cause drug resistance and intestinal flora disorders.

[0003] Nanobodies are single-domain antibodies derived from the heavy-chain antibodies (HcAbs) of camelids (such as camels and alpacas), and only contain the variable heavy-chain region (VHH). Compared with traditional antibodies, the molecular weight of nanobodies is about 15 kDa, which is much smaller than that of traditional antibodies (150 kDa). They can better penetrate tissues and reach the target. At the same time, nanobodies can be highly expressed in prokaryotic expression systems (such as Escherichia coli), are easy to be genetically engineered, bind to target proteins with high affinity, and have excellent selectivity. Therefore, nanobodies can be used in various application scenarios such as treatment, diagnosis, and imaging.

[0004] Currently, in order to improve the stability and function of nanobodies in mucosae, VHH has been designed as an IgA Fc fusion antibody (VHH-IgA), and its effect has been verified in a mouse model by oral administration. The results show that VHH-IgA can effectively reduce the number of pathogenic bacteria in the intestines of mice, and the effect is better than that of commercial antibacterial drugs. However, in practical applications, the binding efficiency and specificity of nanobodies against CfaE are still insufficient. At the same time, the high-level expression and purification of nanobodies are the key to large-scale applications, and different expression systems (such as Escherichia coli, yeast, or mammalian cells) may affect the yield and function. Therefore, there is an urgent need to provide a nanobody against the fimbrial adhesin protein CfaE with high specificity and stability to provide a better treatment approach for piglet bacterial diarrhea. Summary of the Invention

[0005] In order to overcome the above technical problems, this application provides nanobodies against the fimbrial adhesin protein CfaE with good specificity and high affinity, their preparation methods, and applications.

[0006] On the one hand, the present application provides a nanobody mVHH-IgA against the fimbrial adhesin protein CfaE. The nanobody comprises at least one VHH fragment, and the VHH fragment comprises three amino acid fragments, CDR1, CDR2 and CDR3. The amino acid sequence of CDR1 is as shown in SEQ ID NO.1, the amino acid sequence of CDR2 is as shown in SEQ ID NO.2, and the amino acid sequence of CDR3 is as shown in SEQ ID NO.3.

[0007] In some embodiments, the amino acid sequence of the VHH fragment is as shown in SEQ ID NO.4 or SEQ ID NO.5.

[0008] With the above technical solution, based on the camel VHH antibody library against the F4-ETEC fimbrial adhesin CfaE, the present application screens high-affinity candidate clones through phage display technology. ELISA and SPR detections show that the affinity of the mVHH-IgA provided by the present application for CfaE reaches KD = 1.2×10 -9 M, which is significantly higher than that of traditional monoclonal antibodies (KD = 5×10 -8 M).

[0009] In some embodiments, the nanobody further comprises a secretory IgA alpha chain constant region fused to the VHH fragment. The amino acid sequence of the secretory IgA alpha chain constant region is as shown in SEQ ID NO.6, and the nucleotide sequence is as shown in SEQ ID NO.7.

[0010] By adopting the above technical solution, the present application can effectively enhance the stability and mucosal penetrability of the antibody in the intestine by fusing the VHH sequence with the secretory IgA alpha chain constant region.

[0011] In some embodiments, the amino acid sequence of the nanobody mVHH-IgA is as shown in SEQ ID NO.8 or SEQ ID NO.9.

[0012] On the other hand, the present application also provides a preparation method of the nanobody mVHH-IgA, and the preparation method comprises the following steps: Step 1), constructing an expression vector of the nanobody mVHH-IgA; Step 2), transforming the expression vector obtained in Step 1 into Pichia pastoris, and obtaining an expression strain through screening; Step 3), fermenting and expressing the expression strain obtained in Step 2, and purifying the expressed protein to obtain the product.

[0013] With the above technical solution, the present application uses Pichia pastoris for secretory expression, achieving high protein yield (>500 mg / L) through methanol induction, and without glycosylation modification, reducing costs.

[0014] In some embodiments, the expression vector contains a gene sequence capable of stably expressing the nanobody mVHH-IgA, and the gene sequence is as shown in SEQ ID NO.10 or SEQ ID NO.11.

[0015] With the above technical solution, in order to avoid yeast glycosylation interference, the N-glycosylation site (Asn297→Gln) of IgA is deleted, and the codons are optimized to adapt to the Pichia pastoris expression system (the GC content after optimization is reduced from 58% to 42%).

[0016] On the other hand, the present application also provides an animal feed containing the nanobody mVHH-IgA, and the nanobody mVHH-IgA in the animal feed.

[0017] In some embodiments, the nanobody mVHH-IgA is a freeze-dried powder.

[0018] On the other hand, the present application also provides the use of the nanobody mVHH-IgA in the preparation of a drug or feed for treating animal diarrhea.

[0019] In some embodiments, the animal is a livestock, preferably a pig.

[0020] In some embodiments, the pathogenic bacteria causing animal diarrhea are enterotoxigenic Escherichia coli, Salmonella, and enterotoxigenic Clostridium.

[0021] Compared with the prior art, the nanobody mVHH-IgA provided by the present application has high specificity and stability. ELISA and SPR detections show that the affinity of mVHH-IgA for CfaE is KD = 1.2×10 -9 M), significantly higher than that of traditional monoclonal antibodies (KD = 5×10 -8 M). At the same time, in the present application, the nanobody mVHH-IgA is used as a feed additive and mixed with conventional feed to feed animals. Animal experiments show that feeding the feed containing the nanobody mVHH-IgA provided by the present application can simultaneously inhibit enterotoxigenic Escherichia coli, Salmonella, and enterotoxigenic Clostridium colonized in the intestine, and the antibacterial rate > 85%. Therefore, the nanobody mVHH-IgA and the feed containing this antibody provided by the present application can effectively treat porcine bacterial diarrhea. Description of the Drawings

[0022] Figure 1It is a diagram of the mVHH-IgA expression vector.

[0023] Figure 2 It is the SDS-PAGE analysis of the expression product of Pichia pastoris, where 96h-1 and 120h-1 are the nanobody mVHH-IgA#1 protein, and 96h-2 and 120h-2 are the nanobody mVHH-IgA#2 protein. Specific implementation manners

[0024] The following further elaborates the present invention in combination with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out according to conventional conditions, the conditions described in laboratory manuals, or the conditions recommended by the manufacturers.

[0025] Example 1 Design and synthesis of mVHH-IgA gene VHH sequence screening and optimization: Based on the camel VHH antibody library against the F4-ETEC fimbrial adhesin CfaE, high-affinity candidate clones (KD = 1.2×10 -9 M) were screened by phage display technology. After sequencing, the amino acid sequences of CDR1-3 in the VHH fragment were SEQ ID NO.1-3 respectively, CDR1: SGSISSINAM (SEQ ID NO.1), CDR2: ITNTGVTEFA (SEQ ID NO.2), CDR3: YYCAATD WGTLLIKGID (SEQ ID NO.3). At the same time, two VHH fragments were obtained, and their amino acid sequences were as shown in SEQ ID NO.4 or SEQ ID NO.5.

[0026] IgAα chain fusion design: The VHH sequence was fused with the constant region of the camel-derived secretory IgAα chain. The amino acid sequence of the camel-derived secretory IgAα chain constant region was as shown in SEQ ID NO.6, and the nucleotide sequence was as shown in SEQ ID NO.7. A linker peptide (Gly-Ser)3 was introduced by overlap extension PCR to enhance the structural flexibility. To avoid yeast glycosylation interference, the N-glycosylation site of IgA (Asn297→Gln) was deleted, and the codons were optimized to adapt to the Pichia pastoris expression system (the GC content decreased from 58% to 42% after optimization).

[0027] Finally, the nanobodies mVHH-IgA#1 and mVHH-IgA#2 were obtained, and their amino acid sequences were as shown in SEQ ID NO.8 and SEQ ID NO.9 respectively, and the nucleotide sequences were as shown in SEQ ID NO.10 and SEQ ID NO.11 respectively.

[0028] Example 2: Construction and Transformation of mVHH-IgA Expression Vector Vector Selection and Cloning: The Pichia pastoris expression vector pPICZα was used, and the genes of engineered nanobody VHH-IgA#1 or nanobody VHH-IgA#2 were inserted downstream of the AOX1 promoter (such as Figure 1 ), and the nucleotide sequences are shown in SEQ ID NO.10 or SEQ ID NO.11.

[0029] The gene was inserted at the cloning site using restriction enzymes XhoI and NotI, and the sequence correctness was verified by Sanger sequencing.

[0030] Double Digestion Reaction System: 2 μg of the target vector, 2 μL of 10× buffer, 1.5 μL of restriction enzyme Xho I (enzyme activity 10 U / μL), 1.5 μL of restriction enzyme Not I (enzyme activity 10 U / μL), and ddH2O was added to make up to 20 μL; Reaction Conditions: 37 °C, 1 - 2 hours.

[0031] Ligation Reaction System: 1.5 μL of the digested vector, 3.5 μL of mVHH-IgA gene, 1 μL of 10× T4 ligase buffer, 1 μL of T4 DNA ligase (5 U / μL), and ddH2O was added to make up to 10 μL; Reaction Conditions: 16 °C, 10 - 14 hours.

[0032] Electroporation and Screening: The linearized recombinant plasmid was electroporated into Pichia pastoris X-33 strain (electroporation parameters: 1.5 kV, 25 μF, 200 Ω). After transformation, it was spread on YPDS plates containing 100 μg / mL Zeocin to screen for high-copy integration strains. The gene copy number was verified by qPCR (target copy number ≥10). PCR upstream primer: AGAAAAGAGAGGCTGAAGCTGAATTCCAGGTGCAGCTGCAGGAG (SEQ ID NO.12), PCR downstream primer: ACTGTGGACATGGGTCGGTACCTGAGGAGACGGTGACCTG (SEQ ID NO.13).

[0033] Table 1 PCR Reaction System Component Volume / Dosage Final Concentration / Dosage Template DNA 1 - 5 μL 10 - 100 ng (Genomic DNA) Forward Primer (10 μM) 2 μL 0.2 - 0.5 μM Reverse Primer (10 μM) 2 μL 0.2 - 0.5 μM dNTP Mix (10 mM) 1 μL 200 μM (each dNTP) 10×PCR Buffer 5 μL <![CDATA[1×(containing Mg 2+ 1.5 - 2 mM)]]> Taq DNA Polymerase 0.5 - 1 μL 1-2.5U <![CDATA[ddH2O]]> Make up to 50 μL The PCR reaction system was: pre-denaturation at 94 - 95 °C for 3 - 5 min, denaturation at 94 - 95 °C for 30 s for 25 - 35 cycles, annealing at 55 - 65 °C for 30 s, extension at 72 °C for 1 min / kb, and final extension at 72 °C for 5 - 10 min.

[0034] After sequencing and alignment, the strains with high copy numbers, strain #1 (containing the nanobody mVHH-IgA#1) and strain #2 (containing the nanobody mVHH-IgA#2), were screened and used for the fermentation expression of proteins.

[0035] Example 3 Expression and purification process 1) High-density fermentation The screened strains, strain #1 (containing the nanobody mVHH-IgA#1) and strain #2 (containing the nanobody mVHH-IgA#2), were inoculated into BMGY medium (at 30 °C, 250 rpm) and pre-cultured until OD600 = 0.6 - 1.5. Then they were transferred to BMMY medium (containing 0.5% methanol) for staged induction.

[0036] Stage 1 (0 - 24 h): Methanol concentration 0.5 - 1.0%, pH 5.0, dissolved oxygen (DO) maintained at 30%; Stage 2 (24 - 96 h): Methanol concentration increased to 1.0 - 1.5%, pH 6.0, DO ≥ 20%.

[0037] Samples were taken every 24 h to detect the antibody expression level (ELISA endpoint titer ≥ 1:10 6 ).

[0038] 2) Collection of secreted products After fermentation, the cells were removed by centrifugation (8,000 × g, 4 °C, 20 min), and the supernatant was filtered through a 0.22 μm filter membrane.

[0039] 3) Affinity chromatography purification A Protein A affinity chromatography column (Cytiva) was used. The equilibration buffer was 20 mM sodium phosphate (pH 7.4), and the elution buffer was 0.1 M glycine (pH 3.0). The elution peak was neutralized with Tris-HCl (pH 8.0) and ultrafiltered and concentrated to 5 mg / mL (cut-off molecular weight 30 kDa).

[0040] The results were as Figure 2 shown. SDS-PAGE (12% gel) analysis showed the target band (molecular weight 40 - 55 kDa) with a purity > 95%.

[0041] Example 4 Preparation of lyophilized powder The purified antibodies mVHH-IgA#1 and mVHH-IgA#2 were respectively mixed with trehalose at a volume ratio of 10:1, pre-frozen to -40 ≈ -60 °C, and vacuum-dried until the water content ≤ 3 - 10%. Taking mVHH-IgA#1 as an example, 1 g of the nanobody lyophilized powder was respectively dissolved in 100 mL of phosphate buffer solutions with different pH values, and left for 2 hr. Then, 1 mL of the solution was taken to measure the biological activity of the nanobody treated with solutions of different pH values through the immunoprecipitation method. The pH range was 3 - 8, and the storage time of the lyophilized powder at each pH was 2 h. The measurement results are shown in Table 2.

[0042] Table 2 Detection results of biological activities treated with solutions of different pH values By comparing the activity retention rates of the lyophilized powder at different pH values, the activity was maintained at about 90% under the acidic condition of pH 3.

[0043] Example 5 Animal experiment The lyophilized powders containing the antibodies mVHH-IgA#1 and mVHH-IgA#2 were respectively mixed with commercial piglet feed (Anyou piglet feed, Anyou 999) at a mass ratio of 1:1000. The ELISA kit was used for detection, and the antibody activity retention rate was determined by enzyme-linked immunosorbent assay. The detected antibody activity retention rate > 98%.

[0044] Sixty 7-day-old piglets were divided into an experimental group (feed containing antibodies) and a control group (conventional feed), with 30 piglets in each of the experimental group and the control group. The antibody group feed and the conventional group feed were respectively smeared on the nipples of sows, and fed 3 - 4 times a day for 14 consecutive days with the mVHH-IgA nanobody.

[0045] F4-ETEC was cultured in LB medium (the conventional medium was purchased from Qingdao Haibo Biotechnology) until OD0.6 - 0.8, and the bacterial content was 10 8 ~10 9 cfu / mL. 50 μL of the cultured bacterial liquid was aspirated with a sterile syringe and inoculated into the ileum of the piglets in the two experimental groups. Subsequently, by observing the clinical symptoms such as the fecal traits, bloody stools, and vomiting of the piglets, it was determined whether the piglets were infected. The incidence rate = the number of diseased piglets in each group / the number of artificially infected piglets in each group × 100%.

[0046] Table 3 Animal experiment results Group Number of Diseased Animals Incidence of Diarrhea Number of Dead Animals Mortality Rate Experimental Group - 1 5 16.7％ 1 3.3％ Experimental Group - 2 4 13.3％ 1 3.3％ Control Group 30 100％ 17 56.7％ The results showed that, as shown in Table 3, after artificial infection with F4-ETEC, the diarrhea incidence rates of piglets in experimental group-1 and experimental group-2 fed with antibody-containing feed were 16.7% and 13.3% respectively, while the diarrhea incidence rate of piglets in the control group fed with conventional feed was 100%. It can be seen that feeding the feed containing the antibody of the present application can significantly reduce the diarrhea incidence rate of piglets. At the same time, for experimental group-1 and experimental group-2 fed with antibody-containing feed, the mortality rates of piglets were both 3.3%, while among the 30 diseased piglets in the control group, 17 died, with a mortality rate of 56.7%. It can be seen that using the feed containing the antibody of the present application can significantly reduce the mortality rate of piglets.

[0047] This specific embodiment is only an interpretation of the present application and is not a limitation thereto. Those skilled in the art can make modifications without creative contributions to this embodiment according to needs after reading this specification, but as long as it is within the scope of the claims of the present application, it is protected by the patent law.

Claims

1. A nanobody mVHH-IgA against the fimbriae adhesin protein CfaE, characterized in that: The nanobody comprises at least one VHH fragment, and the VHH fragment comprises three amino acid fragments, CDR1, CDR2 and CDR3, the amino acid sequence of the CDR1 is shown in SEQ ID NO.1, the amino acid sequence of the CDR2 is shown in SEQ ID NO.2, and the amino acid sequence of the CDR3 is shown in SEQ ID NO.

3.

2. The nanobody mVHH-IgA according to claim 1, characterized in that The amino acid sequence of the VHH fragment is shown in SEQ ID NO.4 or SEQ ID NO.

5.

3. The nanobody mVHH-IgA according to claim 1, characterized in that The nanobody also includes a secretory IgA α chain constant region fused to the VHH fragment, the amino acid sequence of the secretory IgA α chain constant region is shown in SEQ ID NO.6, and the nucleotide sequence is shown in SEQ ID NO.

7.

4. The nanobody mVHH-IgA according to claim 1, characterized in that The amino acid sequence of the nanobody mVHH-IgA is shown in SEQ ID NO.8 or SEQ ID NO.

9.

5. The method for preparing the nanobody mVHH-IgA according to any one of claims 1 to 4, characterized in that: The preparation method comprises the following steps: Step 1), constructing an expression vector of the nanobody mVHH-IgA; Step 2), transforming the expression vector described in step 1) into Pichia pastoris, and obtaining an expression strain through screening; Step 3), fermenting and expressing the expression strain described in step 2), and purifying the expressed protein to obtain.

6. The preparation method according to claim 5, characterized in that: The expression vector contains a gene sequence encoding the nanobody mVHH-IgA, and the gene sequence is shown in SEQ ID NO.10 or SEQ ID NO.

11.

7. An animal feed containing the nanobody mVHH-IgA according to any one of claims 1 to 4, characterized in that: The animal feed contains the nanobody mVHH-IgA described in any one of claims 1-4.

8. The animal feed according to claim 7, characterized in that The nano antibody mVHH-IgA is a freeze-dried powder, and each gram of the animal feed contains ≥1 mg of the nano antibody.

9. Use of the nanobody mVHH-IgA according to any one of claims 1 to 4 in the preparation of a medicament or feed for preventing or treating diarrhea in animals.

10. The use according to claim 8, characterized in that: The animals are livestock, and the pathogenic bacteria causing diarrhea in the animals are enterotoxigenic Escherichia coli, Salmonella and enterotoxigenic Clostridium.

Images