Methods for producing recombinant proteins, dna fragments, expression vectors, transgenic lettuce and oral hypoglycemic agents

Abstract

The application discloses a recombinant protein, a DNA fragment, an expression vector, a preparation method of a transgenic lettuce and an oral hypoglycemic drug, relates to the technical field of biological medicines, and the amino acid sequence of the recombinant protein is shown as SEQ ID NO:1.The recombinant protein, i.e., a human transferrin-proinsulin fusion protein, can utilize the natural combination of the human transferrin-transferrin receptor to mediate the endocytosis transport of proinsulin after being orally taken, pass through the intestinal tract to enter the blood system, and reduce blood sugar.According to animal experiments, the effect of the recombinant protein is close to that of natural insulin, and the recombinant protein realizes oral delivery of insulin.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to recombinant proteins, DNA fragments, expression vectors, methods for preparing transgenic lettuce, and oral hypoglycemic drugs. Background Technology

[0002] Diabetes is a silent epidemic that poses a significant threat to human health. Currently, insulin administration is an effective treatment option for diabetic patients. Significant progress has been made in insulin delivery methods, including syringes, pumps, pens, artificial pancreas, skin patches, and inhalers. Although the use of insulin pens continues to increase worldwide, syringes remain the preferred method in low-income countries (83.1%). However, injection methods have many drawbacks, including local pain, injection site infection, inflexibility, hypoglycemia, discomfort, irritation, and economic burden.

[0003] Therefore, achieving oral delivery of insulin would be of great significance. Summary of the Invention

[0004] In view of the shortcomings of the prior art, the purpose of this invention is to provide a method for preparing recombinant protein, DNA fragment, expression vector, and transgenic lettuce, as well as an oral hypoglycemic drug, with the aim of providing a hypoglycemic drug that can be delivered orally to solve the problems of pain and discomfort caused by patients taking insulin by injection.

[0005] The technical solution of the present invention is as follows:

[0006] In a first aspect, the present invention provides a recombinant protein, wherein the amino acid sequence of the recombinant protein is shown in SEQ ID NO: 1.

[0007] A second aspect of the present invention provides a DNA fragment comprising a nucleotide sequence encoding the recombinant protein of the present invention as described above.

[0008] Optionally, the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO:2 or SEQ ID NO:3.

[0009] A third aspect of the present invention provides an expression vector, wherein the expression vector comprises a vector and a DNA fragment of the present invention as described above contained in the vector.

[0010] Optionally, the carrier is a lettuce leaf chloroplast.

[0011] A fourth aspect of the present invention provides a method for preparing transgenic lettuce expressing the recombinant protein of the present invention as described above, wherein the lettuce chloroplast-based genetic transformation method includes the following steps:

[0012] The DNA fragment with the nucleotide sequence shown in SEQ ID NO:4 was introduced into the MoChlo plasmid using homologous recombination to obtain the vector ChlMF-tf347-H4-ins;

[0013] The vector ChlMF-tf347-H4-ins was transferred into lettuce chloroplasts, and after screening, transgenic lettuce expressing the recombinant protein was obtained.

[0014] A fifth aspect of the present invention provides a method for preparing transgenic lettuce expressing the recombinant protein of the present invention as described above, wherein the lettuce chloroplast-based genetic transformation method includes the following steps:

[0015] The DNA fragment with the nucleotide sequence shown in SEQ ID NO:4 was amplified by PCR and transformed into lettuce chloroplasts. After screening, transgenic lettuce expressing the recombinant protein and without the resistance gene was obtained.

[0016] In a sixth aspect, the present invention provides an oral hypoglycemic drug comprising the recombinant protein of the present invention as described above.

[0017] Optionally, the oral hypoglycemic agent may also include a pharmaceutically acceptable carrier.

[0018] In a seventh aspect, the present invention provides an oral hypoglycemic drug, wherein the oral hypoglycemic drug is a plant-derived oral hypoglycemic drug, and the oral hypoglycemic drug is prepared by freeze-drying and grinding transgenic lettuce prepared by the preparation method of the present invention as described above into powder, or by freeze-drying and grinding transgenic lettuce prepared by the preparation method of the present invention as described above into powder, and then mixing it with a pharmaceutically acceptable carrier.

[0019] Beneficial Effects: The recombinant protein provided by this invention, namely the human transferrin-proinsulin fusion protein, can mediate the endocytic transport of proinsulin through the natural binding of human transferrin-transferrin receptors after oral administration, crossing the intestines into the bloodstream and lowering blood sugar. Furthermore, animal experiments show that the recombinant protein provided by this invention has effects close to natural insulin. This recombinant protein achieves oral delivery of insulin, effectively solving the pain and discomfort problems caused by insulin injection for patients. Attached Figure Description

[0020] Figure 1 This is a diagram illustrating the design of the LsLH-LsRH fragment and the genetic transformation mechanism of lettuce chloroplasts in this invention. (a) is a schematic diagram of the LsLH-LsRH fragment, (b) is a schematic diagram of the knockout of the aadA resistance gene, and (c) is a schematic diagram of the remaining fragment after the knockout of the aadA resistance gene.

[0021] Figure 2 In Example 3, (a) shows the nucleic acid bands of 16 seedlings derived from the vector ChlMF-tf347-H4-ins, and (b) shows the nucleic acid bands of 16 seedlings derived from the PCR fragment LsLH-LsRH.

[0022] Figure 3 This is a diagram showing the results of screening eight seedlings obtained from the PCR fragment LsLH-LsRH in Example 3 to determine whether the aadA resistance gene expression frame was knocked out.

[0023] Figure 4 This is a diagram showing the expression results of the recombinant protein tf347-H4-ins in Example 5.

[0024] Figure 5 This is a schematic diagram of the process of establishing a diabetic mouse model and treating it in Example 6.

[0025] Figure 6 This is a diagram showing the in vivo verification results of the therapeutic effect of oral recombinant protein tf347-H4-ins in Example 6. Detailed Implementation

[0026] This invention provides a method for preparing recombinant proteins, DNA fragments, expression vectors, transgenic lettuce, and an oral hypoglycemic drug. To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention is further described in detail below. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.

[0027] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0028] If the embodiments of the present invention involve descriptions such as "first" or "second", such descriptions are for descriptive purposes only and should not be construed as indicating or implying their relative importance or implicitly specifying the number of technical features indicated.

[0029] This invention provides a recombinant protein, wherein the amino acid sequence of the recombinant protein is shown in SEQ ID NO: 1.

[0030] In this embodiment of the invention, amino acids 1-347 (tf347) of human transferrin, a long helical linker sequence H4-2, and human insulin precursor (i.e., human proinsulin; to modify it into active insulin in vivo, four amino acids were replaced based on the human insulin precursor shown in Genbank NP_000198.1, resulting in two Furin restriction sites) were fused and expressed to obtain a recombinant protein with the amino acid sequence shown in SEQ ID NO: 1 (also known as recombinant protein tf347-H4-ins, see the Examples section).

[0031] The recombinant protein provided by this invention, namely the human transferrin-proinsulin fusion protein, can mediate the endocytic transport of proinsulin through the natural binding of human transferrin-transferrin receptors after oral administration. This allows proinsulin to cross the intestines and enter the bloodstream, thereby lowering blood glucose levels. Specifically, the tf347 portion of the recombinant protein can bind to the transferrin receptor (TfR) in the intestines, mediating the endocytic transport of human proinsulin across intestinal epithelial cells into the bloodstream, achieving oral insulin delivery. Furthermore, animal experiments show that the recombinant protein provided by this invention has effects close to natural insulin. This recombinant protein enables oral insulin delivery, effectively solving the pain and discomfort problems caused by insulin injection for patients.

[0032] Embodiments of the present invention also provide a DNA fragment containing a nucleotide sequence encoding the recombinant protein of the present invention as described above. The recombinant protein encoded by the DNA fragment, upon oral administration, can utilize the natural binding of human transferrin-transferrin receptors to mediate the endocytic transport of proinsulin, cross the intestine into the bloodstream, and lower blood glucose. Furthermore, animal experiments show that the recombinant protein provided by the present invention has an effect close to that of natural insulin, and the recombinant protein provided by the present invention achieves oral delivery of insulin.

[0033] In some embodiments, the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO: 2 or SEQ ID NO: 3.

[0034] This invention also provides an expression vector, wherein the expression vector includes a vector and the DNA fragment of this invention as described above contained in the vector.

[0035] In some embodiments, the vector is a lettuce chloroplast. Existing protein expression hosts are human HEK293 cells or tobacco cells, therefore the proteins need to be isolated and purified before oral delivery. This invention uses lettuce chloroplasts as the expression host, enabling direct oral drug delivery, avoiding the cumbersome protein isolation and purification steps, and significantly reducing costs.

[0036] The present invention also provides two methods for preparing transgenic lettuce expressing the recombinant protein of the present invention as described above, one of which is a plasmid-based genetic transformation method for lettuce chloroplasts, and the other is a PCR-amplified fragment-based genetic transformation method for lettuce chloroplasts.

[0037] The plasmid-based genetic transformation method for lettuce chloroplasts, the method for preparing the transgenic lettuce (which is also an efficient genetic transformation method for removing resistance genes from plant chloroplasts), includes the following steps:

[0038] S1. Using homologous recombination, the DNA fragment with the nucleotide sequence shown in SEQ ID NO:4 was introduced into the MoChlo plasmid to obtain the vector ChlMF-tf347-H4-ins, whose nucleotide sequence is shown in SEQ ID NO:5.

[0039] S2. The vector ChlMF-tf347-H4-ins is transferred into lettuce chloroplasts, and after screening, transgenic lettuce expressing the recombinant protein is obtained.

[0040] Currently, the main methods used to remove antibiotic resistance genes are: 1. Site-specific recombinase. When the aadA gene has a 34bp loxP site directly repeated in the plastid DNA, the aadA gene can be removed by introducing Cre recombinase into the plastid. The disadvantage of this method is that the loxP site needs to be pre-constructed in the vector, and an exogenous Cre recombinase gene needs to be introduced into the chloroplast. 2. Stepwise removal. The first transformation is performed with a vector containing the resistance gene. After successful transformation, a vector without the resistance gene but containing the same homologous arm sequence is used for transformation to replace the previous resistance gene. The disadvantage of this method is that it requires two chloroplast transformations, increasing the difficulty and time. 3. Introduction of repetitive sequences. Identical repetitive sequences are added to both sides of aadA. After transformation, the endogenous homologous recombination mechanism in the chloroplast can perform double crossover between the repetitive sequences at both ends, excising the aadA gene. Excising is a spontaneous process, and its frequency depends on the specific sequence and length of the directly repeated sequence. Although this method is the simplest, its drawback is that it requires the introduction of additional repetitive sequences, which remain in the chloroplast genome after excision, making it impossible to achieve "scarless" excision.

[0041] In this embodiment of the invention, without introducing additional repeating sequences, such as Figure 1 As shown, by simply adding a fragment (LsLH-3'699bp) inherent to LsLH itself as a repetitive sequence to the end of the aadA expression frame, the resistance gene aadA can be easily and efficiently removed using the repetitive sequence-mediated homologous recombination mechanism. After removal, the genome contains no non-genomic sequences other than the expressed recombinant protein sequence, achieving the goal of "scarless" removal.

[0042] This plasmid-based genetic transformation method for lettuce chloroplasts requires the purchase of specific vectors, and the plasmid vectors also need to be purified using a DNA extraction kit (this helps to eliminate the influence of bacterial endotoxins on plasmid transformation efficiency). Furthermore, the genetic transformation efficiency of the aforementioned plasmid-based genetic transformation method for lettuce chloroplasts needs further improvement.

[0043] To address the problems existing in the aforementioned plasmid-based genetic transformation methods for lettuce chloroplasts, this invention utilizes PCR amplification of linearized homologous recombination fragments to prepare transgenic lettuce. The method for preparing transgenic lettuce based on PCR-amplified fragments for genetic transformation of lettuce chloroplasts includes the following steps:

[0044] The DNA fragment with the nucleotide sequence shown in SEQ ID NO:4 (i.e., as shown in...) Figure 1 As shown in (a), the sequence from LsLH to LsRH was amplified by PCR (polymerase chain reaction) and transformed into lettuce chloroplasts (specifically, it can be transformed into lettuce chloroplasts by gene gun). After screening (specifically, it can be screened in three rounds), transgenic lettuce expressing the recombinant protein without the resistance gene (aadA) was obtained.

[0045] In this invention, the DNA fragment with the nucleotide sequence shown in SEQ ID NO: 4 is designed with the 16S rRNA / trnV site of the lettuce chloroplast genome as the insertion site, significantly improving the genetic transformation efficiency. Furthermore, in this embodiment of the invention, PCR amplification fragments are used instead of plasmid DNA for chloroplast genetic transformation, achieving a transformation efficiency 5.33 times higher than the aforementioned plasmid-based method without introducing additional repetitive sequences. Additionally, as... Figure 1 As shown in (a), this invention only requires adding a fragment (LsLH-3'699bp) contained within LsLH itself as a repeat sequence to the end of the aadA expression frame. This allows for a simple and efficient removal of the resistance gene aadA (e.g., ...) using the repeat sequence-mediated homologous recombination mechanism. Figure 1 As shown in (b) above, the sequence after removing the resistance gene aadA was obtained (as shown in [image]). Figure 1(As shown in (c)). After removing the resistance gene, the genome contains no non-genomic sequences other than the expressed recombinant protein sequence, achieving the goal of "scarless" removal. Moreover, this design greatly improves the efficiency of resistance gene removal, reaching 62.5% after one transformation / screening. The transgenic lettuce with the resistance gene aadA removed has normal expression function and can successfully express the recombinant protein. Furthermore, by adding one copy of the promoter LsPpsbA, a 2xLsPpsbA promoter was constructed, which significantly increased the expression level of the recombinant protein.

[0046] This invention also provides an oral hypoglycemic drug, which includes the recombinant protein of this invention as described above.

[0047] In some embodiments, the oral hypoglycemic agent further includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier includes at least one of a glidant, diluent, wetting agent, suspending agent, solvent, and emulsifier.

[0048] In some embodiments, the oral hypoglycemic drug further includes an excipient, which includes at least one of a preservative, a colorant, a flavoring agent, a stabilizer, and an isotonic agent.

[0049] The present invention also provides another oral hypoglycemic drug, wherein the oral hypoglycemic drug is a plant-derived oral hypoglycemic drug, which is prepared by freeze-drying and grinding transgenic lettuce prepared by the preparation method of the present invention as described above, or by freeze-drying and grinding transgenic lettuce prepared by the preparation method of the present invention as described above, and then mixing it with a pharmaceutically acceptable carrier.

[0050] This invention uses lettuce chloroplasts as the recombinant protein expression host. The resulting transgenic lettuce can deliver drugs directly via oral administration, avoiding cumbersome protein separation and purification steps and significantly reducing costs. The oral hypoglycemic drug provided by this invention utilizes the natural binding of transferrin-transferrin receptors in humans to mediate the endocytic transport of proinsulin, allowing it to cross the intestines and enter the bloodstream to lower blood sugar.

[0051] The present invention will be further described below through specific embodiments.

[0052] In the following examples, the RMOP medium (1L) comprises the following components: 4.33g MS salt (Murashige and Skoog), 100mg inositol, 1mg thiamine hydrochloride, 1mg 6-benzyladenine (BAP), 0.1mg 1-naphthaleneacetic acid (NAA), 30g sucrose, and 6g plant agar, pH=5.8. The RMOP medium may or may not contain spectinomycin. Unless otherwise specified in the following examples, the RMOP medium does not contain spectinomycin; when specifically stated to contain spectinomycin, the RMOP medium contains spectinomycin.

[0053] MS medium consists of the following components: 4.33 g MS salt (Murashige and Skoog), 30 g sucrose and 6 g plant agar, pH = 5.8.

[0054] In the following embodiments, some symbols have the following meanings:

[0055] v / v: volume to volume ratio;

[0056] w / v: mass to volume ratio;

[0057] mM: mmol / L;

[0058] PBS: Phosphate Buffered Salt

[0059] Example 1: Construction of fragment LsLH-LsRH and vector ChlMF-tf347-H4-ins

[0060] (1) As Figure 1 As shown in (a), the 8476bp fragment from LsLH to LsRH (i.e., LsLH-5'LsLH-3'LsPrbclaadA LsTpsbA LsLH-3'2xLsPpsbA tf347 H4-2 proinsulin Trbcl LsRH) is denoted as fragment LsLH-LsRH. The nucleotide sequence of fragment LsLH-LsRH is shown in SEQ ID NO: 4, which contains a gene fragment encoding the amino acid sequence shown in SEQ ID NO: 1.

[0061] The nucleotide sequence of the chloroplast genome-LsLH-5'LsLH-3'LsPrbcl aadA LsTpsbA LsLH-3'2xLsPpsbAtf347 H4-2proinsulin Trbcl LsRH- is shown in SEQ ID NO: 6 (the genome sequences at both ends are only partial excerpts of the lettuce chloroplast genome).

[0062] The construction process of fragment LsLH-LsRH is as follows:

[0063] Using the 16S rRNA / trnV site in the lettuce (Lactuca sativa) chloroplast genome (Genbank: AP007232.1) as the insertion site, fragments of 1928 bp upstream (nucleotide positions: 98,041-99,968) and 2010 bp downstream (nucleotide positions: 99,969-101,978) were selected as the upstream and downstream homologous arm fragments LsLH and LsRH, respectively.

[0064] The repetitive sequence LsLH-3' required to remove the resistance gene originates from a 699bp nucleotide fragment at the 3' end of the LsLH fragment.

[0065] The fragment LsPrbcl originates from the lettuce chloroplast genome, and its nucleotide sequence corresponds to the nucleotide sequence at positions 54588-55063 of the lettuce chloroplast genome.

[0066] LsTpsbA originates from the lettuce chloroplast genome, and its nucleotide sequence corresponds to the nucleotide sequence at positions 173-478 of the lettuce chloroplast genome.

[0067] LsPpsbA originates from the lettuce chloroplast genome, and its nucleotide sequence corresponds to positions 1541-1765 in the lettuce chloroplast genome. In this embodiment, a 2xLsPpsbA promoter was constructed by adding one copy of the promoter LsPpsbA.

[0068] LsTrbcl originates from the lettuce chloroplast genome, and its nucleotide sequence corresponds to the nucleotide sequence at positions 56498-56759 of the lettuce chloroplast genome.

[0069] The amino acid sequence encoded by fragment tf347 corresponds to the amino acid sequence of human transferrin (Genbank: NP_001054.2) from position 1 to position 347.

[0070] The amino acid sequence encoded by the Proinsulin fragment is based on the human insulin precursor (Genbank NP_000198.1), with four amino acids replaced, resulting in a sequence with two Furin restriction sites.

[0071] The 8476bp gene fragment from LsLH to LsRH, namely fragment LsLH-LsRH, was synthesized by Shanghai Langjing Biotechnology Co., Ltd.

[0072] (2) Construction of the vector ChlMF-tf347-H4-ins

[0073] Using homologous recombination, the above-mentioned fragment LsLH-LsRH (i.e., the 8476bp gene fragment from LsLH to LsRH) replaced the trnI and trnA fragments in the MoChlo vector (purchased from https: / / www.addgene.org / , Kit#1000000156) to obtain the vector ChlMF-tf347-H4-ins (its nucleotide sequence is shown in SEQ ID NO: 5).

[0074] (3) Obtain the fragment LsLH-LsRH (denoted as PCR fragment LsLH-LsRH) by PCR.

[0075] Using the LsLH-LsRH fragment synthesized by Shanghai Langjing Biotechnology Co., Ltd. as a DNA template, the genetically transformed whole fragment LsLH-LsRH (denoted as PCR fragment LsLH-LsRH) was obtained by PCR using primers Clone-F (its nucleotide sequence is shown in SEQ ID NO: 7, specifically ggaaaagttgacagataagtcaccct) and Clone-R (its nucleotide sequence is shown in SEQ ID NO: 8, specifically gtcgtgcgagcccccc)

[0076] The PCR reaction system is as follows:

[0077] 1 μL DNA template, 1 μL primer clone-F, 1 μL primer clone-R, 10 μL 2xOne Shot LA PCR Mix (purchased from TaKaRa, containing DNA polymerase) and 7 μL H2O.

[0078] The PCR reaction conditions are as follows:

[0079] Pre-denaturation at 95℃ for 5 minutes;

[0080] Denaturation at 95℃ for 30 seconds;

[0081] Anneal at 60℃ for 30 seconds;

[0082] Extend at 72℃ for 5 minutes;

[0083] There are 35 cycles in total.

[0084] Example 2: Gene gun-mediated genetic transformation of lettuce chloroplasts

[0085] In this embodiment, two methods were used for the genetic transformation of lettuce chloroplasts. One method was based on plasmid DNA, using the vector ChlMF-tf347-H4-ins constructed in Example 1; the other method was based on PCR amplification fragments, using the PCR fragment LsLH-LsRH from Example 1. The specific steps included are as follows:

[0086] (1) Place about 100 lettuce seeds (Simpson Elite) into a 1.5 mL Eppendorf test tube and wash with 1 mL of 75% (v / v) ethanol solution for 30 s to remove any oily substances.

[0087] (2) Add 1 mL of commercially available bleach diluted with water to the Eppendorf tube, specifically containing 1.5% (v / v) sodium hypochlorite and 0.1% (v / v) Tween 20. Incubate for 10 minutes, gently mixing by inverting the Eppendorf tube.

[0088] (3) Wash the seeds five times with 1 mL of sterile deionized water to remove commercial bleach.

[0089] (4) Take 40 treated lettuce seeds and inoculate them into MS medium. Place them in a culture room at 26°C and grow them under a white fluorescent lamp (1900 lux) for 16 hours of light and 8 hours of darkness (i.e., 16 hours of light, then 8 hours of darkness, then 16 hours of light, then 8 hours of darkness, and so on) for 7-10 days.

[0090] (5) Transfer individual germinating seedlings to plant culture boxes containing MS medium and store them in the culture room for 4-7 weeks.

[0091] (6) Harvest the leaves when the plant has 5-7 leaves. Place a 70 mm high-pressure Whatman circular filter tray on the RMOP medium in the petri dish. Place the leaves on the filter tray with their upper surface facing the medium.

[0092] (7) Add 10 μmol of ChlMF-tf347-H4-ins plasmid DNA (i.e., the vector ChlMF-tf347-H4-ins), 50 μg of gold powder particles, 10 μL of 2.5 M calcium chloride solution, and 20 μL of 0.1 M spermidine solution to a sterile ruptured membrane and allow it to dry in a laminar flow hood. Follow the manufacturer's instructions and use the standard particle bombardment method (also known as the gene gun method) for DNA delivery. This method is a chloroplast genetic transformation method based on plasmid DNA.

[0093] Simultaneously, 10 μmol of the PCR fragment LsLH-LsRH, 50 μg of gold powder, 10 μL of 2.5 M calcium chloride solution, and 20 μL of 0.1 M spermidine solution were added to a sterile, ruptured membrane and allowed to dry in a laminar flow hood. Following the manufacturer's instructions, DNA delivery was performed using the standard particle bombardment method, a genetic transformation method for chloroplasts based on PCR amplification.

[0094] (8) After placing the bombarded blades in the dark for 2 days, cut them into 5mm pieces. 2 The fragments were placed on RMOP medium (containing 50 mg / mL spectinomycin) so that the bombardment side was in contact with the medium. The petri dish was then sealed with plastic wrap for the first round of selection.

[0095] Example 3: Screening and identification of positive plants and positive resistance gene knockout plants

[0096] Use 50 mg / mL spectinomycin to effectively select transformants from lettuce. Add the antibiotic when the culture medium cools to 45-50°C.

[0097] Prior to the second round of screening, 100 mg of leaf material was harvested from the assumed positive seedlings. DNA was isolated using the DNeasy Plant Mini kit according to the manufacturer's instructions. This process typically yields 20–30 μg of DNA.

[0098] Two separate 50 μL PCR reactions were performed in two 0.2 mL PCR tubes. Primers PCR-F (nucleotide sequence as shown in SEQ ID NO: 9, specifically TTCCCCTGGATCGAGACAGGTATC) and PCR-R (nucleotide sequence as shown in SEQ ID NO: 10, specifically aatccgaactgaggacgggt) were used to check whether the target gene expression cassette was integrated into the chloroplast genome in the two methods of Example 2. Simultaneously, untransformed wild-type lettuce leaf DNA was detected in a separate PCR tube as a negative control. The 5 μL PCR products were detected by agarose gel electrophoresis. The amplified PCR products were observed by ethidium bromide staining. Plants confirmed by PCR to be capable of transgene integration underwent a second and third round of selection.

[0099] Sixteen seedlings derived from the vector ChlMF-tf347-H4-ins and sixteen seedlings derived from the PCR fragment LsLH-LsRH, which were initially screened, were molecularly identified using transgene-specific primers PCR-F and PCR-R. The PCR results are as follows: Figure 2 As shown, only 3 out of 16 seedlings derived from the vector ChlMF-tf347-H4-ins were positive (e.g., Figure 2 As shown in (a)), all 16 seedlings derived from the PCR fragment LsLH-LsRH were positive (as shown in (a)). Figure 2 As shown in (b) in the figure, the transformation efficiency of the PCR fragment LsLH-LsRH method is much higher than that of the plasmid DNA method (the transformation efficiency is 5.33 times that of the plasmid DNA method).

[0100] Positive plants derived from the PCR fragment LsLH-LsRH (referred to as PCR-positive plants) were used for the second and third rounds of screening.

[0101] Second round of screening: 2mm samples were cut from PCR-positive plants. 2 Leaves were placed on RMOP medium (containing 50 mg / mL spectinomycin). They were placed in a culture room at 26°C and grown under a white fluorescent lamp (1900 lux) with a light cycle of 16 h / dark. Transgenic buds were produced from the leaves within 3-4 weeks.

[0102] The third round of screening: Regenerated shoots (i.e., the resulting transgenic shoots) were removed and transferred to rooting medium (MS medium + 0.5 mg / L auxin IAA) containing 50 mg / mL spectinomycin. The plants were placed in a 26°C incubator under white fluorescent light (1900 lux) with a 16-hour light / 8-hour dark cycle, and rooting occurred after 3-4 weeks. PCR was performed again on these seedlings using primers MF-F (nucleotide sequence shown in SEQ ID NO: 11, specifically agtttggtttttttggggtgatagt) and MF-R (nucleotide sequence shown in SEQ ID NO: 12, specifically tatcagggaccatATGggttccc).

[0103] The results are as follows Figure 3 As shown, 5 out of 8 PCR-positive seedlings successfully knocked out the aadA resistance gene expression cassette (the result for successful knockout was 2466 bp, and the result for unsuccessful knockout was 4793 bp), achieving a resistance gene knockout rate of 62.5%. These 5 plants that successfully knocked out the aadA resistance gene expression cassette are considered positive resistance gene knockout plants.

[0104] Example 4: Growth and cultivation of positive plants

[0105] Take the PCR-positive plants with roots obtained in Example 3 (specifically, as shown in Example 3). Figure 3(As shown), thoroughly rinse with water to remove the plant mix or agar (be sure to remove all plant mix or agar, otherwise the plant may become infected with fungi and eventually die). Soak the jiffy pellet culture medium (http: / / www.jiffypot.com / ) in water for 20 minutes. Transfer the plant to a small container containing the jiffy pellet, add enough water to cover the surface. Cover with a plastic bag to maintain humidity. Maintain 26°C in the growth chamber, with 16 hours of light and 8 hours of darkness daily at 1900 lux. After 4 days, make a small hole in the plastic bag for air exchange. Remove the bag after another 3 days. After removing the bag, grow the plant in the growth chamber for one week, watering every 2 days. Transfer the soil containing the plant to a pot containing soil in the greenhouse. Water the plant every 2 days according to the manufacturer's instructions, and add water-soluble all-purpose plant feed weekly. After 5 weeks, collect healthy leaves for transgenic protein identification.

[0106] When flower heads appear, cover them with a waterproof paper bag (moisture inside the pods increases the risk of fungal infection), and secure the bag tightly to the stem below the flower stalk with string or rubber band. Once the seed pods are mature, remove the bag, collect the pods, and dry them in a desiccator to obtain the seeds. These seeds can be further used to grow genetically modified lettuce. The seeds can be stored for 2-3 years in sealed Eppendorf tubes at 24-26°C, and for even longer at 4°C or 70°C.

[0107] Example 5: Extraction of soluble total protein and Western blot detection of expression

[0108] (1) Extraction of total soluble protein

[0109] Green and healthy leaves were collected from genetically transformed and untransformed lettuce grown in a greenhouse (i.e., the former being lettuce leaves obtained in Example 4, and the latter being wild-type lettuce leaves). The leaves were washed to remove dirt and debris, and the midrib was removed. The leaf material was ground into a fine powder in liquid nitrogen. 200 μL of freshly prepared plant protein extract (100 mM sodium chloride, 200 mM Tris-HCl pH 8.0, 14 mM β-mercaptoethanol, 200 mM sucrose, 0.05% (v / v) Tween-20, 0.2% (w / v) sodium dodecyl sulfate) was added to each of the two powdered plant samples (100 mg of powder per sample). The homogenized samples were centrifuged at 15000 g for 10 min at 4°C, and the supernatant (containing soluble protein) was collected.

[0110] (2) Confirmation of transgenic expression by Western blot analysis

[0111] Dilute different amounts of the supernatant prepared in the previous step (e.g., 100 mg, 10 mg, and 1 mg) with an equal volume (by volume) of sample buffer and boil for 4–20 min. Load the samples (including the unboiled control sample) into the wells of a 12% (w / v) sodium dodecyl sulfate-polyacrylamide gel. Separate the proteins by electrophoresis. Set the initial current to 85 V in 1x electrode buffer until the proteins migrate into the dissolving gel, then increase the current to 110 V and electrophoresis until the dye reaches the bottom of the gel. Using a Western blot, transfer the separated proteins onto a nitrocellulose or polyvinylidene fluoride (PVDF) membrane at 120 V for approximately 2 hours. Before use, pre-wet the PVDF membrane in methanol for 15 s, then soak it in water for 2 min, and then equilibrate it in transfer buffer for 5 min. After transfer, soak the membrane in a sufficient volume of PBS-T (i.e., obtained by adding 0.1% v / v Tween-20 to PBS) to completely cover the membrane for 5 min at room temperature (25°C). Pour out the PBS-T. To prevent nonspecific binding, gently agitate the membrane in PTM (i.e., PBS-T with 3% w / v skim milk) at room temperature for 1 hour to completely cover the membrane. Discard the PTM. For total protein detection, completely cover the membrane with primary antibody diluted in PTM (R&D system, MAB13361) (dilution depends on antibody titer). Gently agitate the membrane and primary antibody solution at room temperature for 2 hours (or overnight at 4°C). Wash the membrane once with 1x PBS-T for 5 minutes at room temperature, then add appropriately diluted secondary antibody (R&D system, VC002) to the PTM. Incubate gently with agitation for 1.5 hours. Wash the membrane three times with PBS-T for 15 minutes each time, and once with 1-inch PBS for 10 minutes. Add chemiluminescent substrate (ECL) and incubate gently with agitation for 5 minutes at room temperature. Generate a chemiluminescent signal by exposing the membrane to X-ray film. The initial exposure time is 1 minute; subsequent exposure times can be extended to 30 minutes depending on the obtained signal.

[0112] The results are as follows Figure 4 As shown, the negative and positive controls were wild-type lettuce (WT) and recombinant human proinsulin (R&D system, 1336-PN), respectively. The recombinant protein tf347-H4-ins was... Figure 3 The 8 independent positive plants shown (3 plants with the aadA resistance gene not knocked out and 5 plants with the aadA resistance gene knocked out) all expressed the gene, with an expression rate of 100% and a maximum expression level of 19.88 mg / gDW. This also indicates that the transgenic lettuce plants with the aadA resistance gene knocked out have normal expression function and can successfully express the recombinant protein tf347-H4-ins, which has a molecular weight of 51.3 kDa.

[0113] Lettuce leaves containing the recombinant protein tf347-H4-ins were harvested, freeze-dried, ground, and made into dried freeze-dried plant powder. The powder was then mixed with PBS buffer in a certain proportion to form a suspension for downstream animal experiments.

[0114] Example 6: In vivo verification of the therapeutic effect of oral recombinant protein TF347-H4-ins

[0115] 112-week-old C57BL / 6 mice were purchased from the Animal Experiment Research Center of Zhejiang University of Traditional Chinese Medicine. After fasting overnight, as... Figure 5 As shown, streptozotocin (STZ) citrate buffer (50 μg STZ per gram of mouse) was injected intraperitoneally daily for 5 consecutive days to induce diabetes. Blood glucose levels were measured two weeks after the last STZ injection (i.e., day 19 of the experiment) using a OneTouch Ultra2Meter kit, and animals with blood glucose levels ≥300 mg / dL were included in the study.

[0116] Mice with diabetes were randomly divided into three groups: PBS (negative control), TF347-H4-ins, and commercially available insulin (positive control), with six mice in each group (three males and three females). All animals were fasted overnight before the experiment.

[0117] In addition, six healthy 12-week-old C57BL / 6 mice (three males and three females) were selected as the healthy group.

[0118] The administration method is as follows:

[0119] tf347-H4-ins group: 20 mg of freeze-dried plant powder (obtained from the positive resistance gene knockout plant in Example 3 by freeze-drying and grinding) containing 171.6 μg of recombinant protein tf347-H4-ins was rehydrated in PBS (pH 7.4) to a final volume of 200 μL for each gavage and administered via a 20-gauge gavage syringe. Thirty minutes before gavage, the plant powder suspension was gently stirred in PBS until homogeneous.

[0120] Negative control group: Mice were intraperitoneally injected with 100 μL of sterile PBS by gavage.

[0121] Positive control group: Mice were injected intraperitoneally with 100 μL of commercially available insulin (0.04 U / kg body weight).

[0122] Healthy group: No medication will be given.

[0123] All mice were intraperitoneally injected with 100 μL of glucose solution (2 g glucose / kg body weight) 60 min after administration.

[0124] Thirty minutes later, the starting point for blood glucose monitoring (0 min) was used. Blood glucose levels were measured using the tail vein bleeding method at 0 min, 30 min, 60 min, 90 min, 120 min, 150 min and 210 min, respectively. Each animal was measured 3 times.

[0125] The results are as follows Figure 6 As shown, freeze-dried plant powder containing recombinant protein tf347-H4-ins has a good hypoglycemic effect, which is close to that of natural insulin, and can be used to treat diabetes.

[0126] In summary, the recombinant protein provided by this invention can be delivered orally to lower blood sugar. This invention selected the superior integration site 16S rRNA / trnV in the lettuce chloroplast genome, utilizing upstream and downstream homologous sequences (LsLH 1928bp and LsRH 2010bp), significantly improving genetic transformation efficiency. This invention obtained 16 PCR-positive seedlings using PCR, 5.33 times the number of 3 positive seedlings obtained using traditional plasmid DNA methods. This invention, without introducing additional repetitive sequences, simply adds a fragment (LsLH-3'699bp) already contained within LsLH as a repetitive sequence to the end of the aadA expression frame, enabling a simple and efficient removal of the resistance gene aadA expression frame using a repetitive sequence-mediated chloroplast homologous recombination mechanism. Currently, the most convenient technique for removing resistance genes mainly involves introducing two identical non-coding repetitive sequences on either side of the aadA gene expression frame. The natural homologous recombination mechanism of chloroplasts can then remove the resistance gene expression frame between the repetitive sequences with a low probability (generally <1%). However, due to the inherent limitations of homologous recombination, a copy of the repetitive sequence remains after removal, leaving a "trace" on the genome. In contrast, this invention removes resistance genes without any non-genomic sequences in the genome except for the expressed recombinant protein sequence, achieving "traceless" removal. Furthermore, this invention significantly improves the efficiency of resistance gene removal, achieving a 62.5% knockout rate and 100% target protein expression rate after a single transformation and screening.

[0127] In this invention, transgenic lettuce plants with the resistance gene aadA removed exhibit normal expression function and can successfully express recombinant proteins. Furthermore, this invention constructs a 2xLsPpsbA promoter by adding one copy of the promoter LsPpsbA, significantly increasing the expression level of the recombinant protein. Referring to previous research, the maximum expression level of CTB-proinsulin in chloroplasts is ~12 mg / g DW. The expression level of the recombinant protein tf347-H4-ins in this invention reaches 19.88 mg / g DW, which is 1.65 times that of the former.

[0128] It should be understood that the application of the present invention is not limited to the examples above. Those skilled in the art can make improvements or modifications based on the above description, and all such improvements and modifications should fall within the protection scope of the appended claims.

Claims

1. A recombinant protein, characterized in that, The amino acid sequence of the recombinant protein is shown as SEQ ID NO:

1.

2. A DNA fragment, characterized in that, The DNA fragment comprises a nucleotide sequence encoding the recombinant protein of claim 1.

3. The DNA fragment according to claim 2, characterized in that, The nucleotide sequence of the DNA fragment is shown as SEQ ID NO: 2 or SEQ ID NO:

3.

4. An expression vector, characterized by, The expression vector comprises the DNA fragment of claim 2 or 3.

5. A method of preparing a transgenic lettuce expressing the recombinant protein of claim 1, comprising the steps of: a) introducing into a lettuce plant a nucleic acid molecule encoding the recombinant protein of claim 1; b) growing the lettuce plant; and c) harvesting the transgenic lettuce plant. The method for genetic transformation of lettuce chloroplast comprises the following steps: The DNA fragment with the nucleotide sequence shown as SEQ ID NO: 4 is introduced into the MoChlo plasmid by homologous recombination to obtain the vector ChlMF-tf347-H4-ins; The vector ChlMF-tf347-H4-ins is transformed into the lettuce chloroplast, and after screening, the transgenic lettuce expressing the recombinant protein is obtained.

6. A method of preparing a transgenic lettuce expressing the recombinant protein of claim 1, comprising the steps of: The method for genetic transformation of lettuce chloroplast comprises the following steps: After the DNA fragment with the nucleotide sequence shown as SEQ ID NO: 4 is amplified by PCR, it is transformed into the lettuce chloroplast, and after screening, the transgenic lettuce expressing the recombinant protein without resistance gene is obtained.

7. An oral hypoglycemic medicament, characterized by comprising The recombinant protein of claim 1.

8. The oral hypoglycemic medicament according to claim 7, characterized in that, The oral hypoglycemic drug further comprises a pharmaceutically acceptable carrier.

9. An oral hypoglycemic medicament, characterized by, The oral hypoglycemic drug is a plant-derived oral hypoglycemic drug, which is prepared by freeze-drying and grinding the transgenic lettuce prepared by the preparation method of any one of claims 5-6 into powder, or by freeze-drying and grinding the transgenic lettuce prepared by the preparation method of any one of claims 5-6 into powder and mixing with a pharmaceutically acceptable carrier. The amino acid sequence of the recombinant protein is shown as SEQ ID NO:

1. The DNA fragment comprises a nucleotide sequence encoding the recombinant protein of claim 1. The nucleotide sequence of the DNA fragment is shown as SEQ ID NO: 2 or SEQ ID NO:

3. The expression vector comprises the DNA fragment of claim 2 or 3. The method for genetic transformation of lettuce chloroplast comprises the following steps: The DNA fragment with the nucleotide sequence shown as SEQ ID NO: 4 is introduced into the MoChlo plasmid by homologous recombination to obtain the vector ChlMF-tf347-H4-ins; The vector ChlMF-tf347-H4-ins is transformed into the lettuce chloroplast, and after screening, the transgenic lettuce expressing the recombinant protein is obtained. The method for genetic transformation of lettuce chloroplast comprises the following steps: After the DNA fragment with the nucleotide sequence shown as SEQ ID NO: 4 is amplified by PCR, it is transformed into the lettuce chloroplast, and after screening, the transgenic lettuce expressing the recombinant protein without resistance gene is obtained. The recombinant protein of claim 1. The oral hypoglycemic drug further comprises a pharmaceutically acceptable carrier. The oral hypoglycemic drug is a plant-derived oral hypoglycemic drug, which is prepared by freeze-drying and grinding the transgenic lettuce prepared by the preparation method of any one of claims 5-6 into powder, or by freeze-drying and grinding the transgenic lettuce prepared by the preparation method of any one of claims 5-6 into powder and mixing with a pharmaceutically acceptable carrier.

Images