Eel positive reovirus AORV-1025 as well as primer group, kit and method for detecting eel positive reovirus

By providing AORV-1025 and its primer set and kit for fluorescence quantitative detection, the problem of lack of methods for quickly and accurately identifying AORV in the prior art is solved, and high sensitivity, high specificity and good repeatability of virus detection is achieved, and effective monitoring and prevention and control of viral diseases of AORV-1025 is supported.

CN120192934APending Publication Date: 2025-06-24BIOLOGICAL TECH INST OF FUJIAN ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510546123.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-28
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

The existing technology lacks methods that can quickly and accurately identify eel reovirus, which leads to difficulties in monitoring and prevention and control management of viral diseases in eel farming.

Method used

A primer set and kit for fluorescence quantitative detection of AORV-1025 are provided, and a TaqMan fluorescence quantitative PCR method can achieve rapid and accurate virus detection.

Benefits of technology

This method has the characteristics of high sensitivity, strong specificity and good repeatability. It can quickly and accurately detect eel reovirus in the sample, supporting the monitoring and prevention of eel viral diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192934A_ABST
    Figure CN120192934A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of virus detection, and particularly relates to an anguilla positive reovirus (Anguilla positive reovirus) AORV-1025 as well as a primer group, a kit and a method for detecting the anguilla positive reovirus. According to the invention, a conserved sequence of an RdRp gene coded by an L3 segment of an eel positive reovirus genome is taken as a target, a primer group consisting of a primer pair and a probe is designed, and the primer group is used for detecting several different positive reoviruses including the eel positive reovirus and viruses possibly existing in a detection sample. The detection result is high in sensitivity, strong in specificity and excellent in repeatability, the eel positive reovirus in a sample can be rapidly and accurately detected in a fluorescent quantitative mode, the method is applied to research on eel positive reovirus infection, and the method has important significance on pathogen monitoring, differential diagnosis and guide prevention and control of eel viral diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of virus detection, and particularly relates to an anguillid orthoreovirus virus strain AORV-1025, a primer set for detecting anguillid orthoreovirus, a kit and a method. Background Art

[0002] Anguilla anguilla is an important high-quality economic fish in China, with delicious taste and balanced nutrition, and is known as the "ginseng in water". In recent years, the aquaculture volume of Anguilla rostrata has been increasing year by year and has become the main aquaculture variety of Anguilla anguilla in China. The growth of Anguilla rostrata requires a high-quality water environment. The artificially cultured Anguilla anguilla is in a relatively open fish pond, and there are characteristics such as high density and high feeding rate in the aquaculture process to pursue high growth performance. The microecological balance in the body of Anguilla anguilla and the stability of the ecological system of the aquaculture water environment are quite fragile and are extremely easy to be damaged by the stimulation of the external environment, leading to abnormal reproduction of pathogenic microorganisms inside and outside the cultured Anguilla anguilla. The immune disease resistance of Anguilla anguilla itself is inhibited and damaged, and it is extremely vulnerable to the invasion of exogenous pathogenic microorganisms, resulting in the breeding of diseases. Among them, the diseases caused by viral pathogen infections have a high mortality rate of Anguilla anguilla and cause serious economic losses. Previous studies have found that the common viral diseases of Anguilla rostrata include "sloughing hemorrhagic syndrome", "hemorrhagic gill rot", "swimming frenzy", etc. After detection, a variety of viruses such as Anguillid herpesvirus (AngHV), American eel adomavirus (AEAdoV), and Anguillid orthoreovirus (AORV) are singly / mixedly infected in the Anguilla anguilla with the above-mentioned diseases (symptoms). However, there is currently a lack of a method for quickly and accurately identifying Anguillid orthoreovirus. Summary of the Invention

[0003] The purpose of the present invention is to provide an anguillid orthoreovirus AORV-1025, a primer set for detecting anguillid orthoreovirus, a kit and a method. The primer set and the kit can quickly and accurately perform fluorescence quantitative detection on anguillid orthoreovirus, and have the characteristics of high sensitivity, strong specificity, good repeatability, etc.

[0004] The present invention provides an anguillid orthoreovirus AORV-1025, and the preservation number is CCTCC NO: V202504.

[0005] The present invention provides a method for identifying the RdRp gene of Anguilla anguilla reovirus AORV-1025 described in the above technical solution, and the conserved sequence of the RdRp gene is shown in SEQ ID NO:6.

[0006] The present invention provides a primer pair for amplifying the RdRp gene described in the above technical solution. The primer pair includes the upstream primer AORV-F and the downstream primer AORV-R, and the nucleotide sequences of the upstream primer AORV-F and the downstream primer AORV-R are shown in SEQ ID NO:4 and SEQ ID NO:5 respectively.

[0007] The present invention provides a primer set for detecting Anguilla anguilla reovirus. The primer set includes the upstream primer AORV-qF, the downstream primer AORV-qR and the probe primer AORV-P, and the nucleotide sequences of the upstream primer AORV-qF, the downstream primer AORV-qR and the probe primer AORV-P are shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 respectively.

[0008] The present invention provides a kit for detecting Anguilla anguilla reovirus. The kit includes the primer set described in the above technical solution and PCR amplification reagents.

[0009] Preferably, the PCR amplification reagents include TaqMan fluorescence quantitative PCR detection reagents.

[0010] Preferably, the kit further includes a positive control and a negative control; the positive control is a recombinant plasmid containing the nucleotide sequence shown in SEQ IDNO:6, and the negative control is ddH2O.

[0011] The present invention provides the application of the primer set described in the above technical solution or the kit described in the above technical solution in the preparation of products for detecting Anguilla anguilla reovirus.

[0012] The present invention provides a TaqMan fluorescence quantitative PCR method for detecting Anguilla anguilla reovirus for non-diagnostic and non-therapeutic purposes, including the following steps:

[0013] Performing fluorescence quantitative PCR detection on a sample to be tested using the primer set to obtain a Ct value and an amplification curve; the primer set is the primer set described in the above technical solution or the primer set in the kit described in the above technical solution;

[0014] Judging the detection result based on the Ct value and the amplification curve:

[0015] When the Ct value of the sample to be tested < 35 and the amplification curve is in an "S" shape, the detection result is positive, and the sample to be tested contains Anguilla anguilla reovirus.

[0016] When the Ct value of the sample to be tested is ≥ 35 or no "S"-shaped amplification curve appears, the test result is negative, and the sample to be tested does not contain Anguillid orthoreovirus.

[0017] The present invention provides the application of Anguillid orthoreovirus AORV-1025, the primer set, the kit, or the TaqMan fluorescence quantitative PCR method described in the above technical solutions in the preparation of products for preventing, controlling, and / or monitoring Anguillid viral diseases.

[0018] Beneficial effects:

[0019] The present invention provides a strain of Anguillid orthoreovirus AORV-1025 with the preservation number of CCTCC NO: V202504. On this basis, the present invention uses the conserved sequence (shown as SEQ ID NO: 6) of the RdRp gene of the Anguillid orthoreovirus as a target, designs primer pairs and probes, and constructs a kit containing the primer set. Using this kit to detect Anguillid orthoreovirus including Anguillid orthoreovirus AORV-1025 not only has high sensitivity, strong specificity, but also has good repeatability, can quickly and accurately perform fluorescence quantitative detection of Anguillid orthoreovirus in samples, monitor the infection dynamics of Anguillid orthoreovirus, and is also of great significance for the monitoring and prevention and control management of viral diseases in farmed eels.

[0020] Biological preservation information

[0021] Anguillid orthoreovirus AROV-1025, scientifically described as Anguillid orthoreovirus AROV-1025, was preserved in the China Center for Type Culture Collection (CCTCC) on January 9, 2025. Address: Wuhan University, Wuhan, China. The preservation number is CCTCC NO: V202504, and the postal code is 430072. Brief description of the drawings

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments.

[0023] Figure 1 PCR amplification result of the genomic target sequence of Anguillid orthoreovirus AORV-1025 in Example 1;

[0024] Figure 2 Standard curve of the AORV TaqMan fluorescence quantitative PCR detection method in Example 3;

[0025] Figure 3 The sensitivity test results of AORV TaqMan fluorescence quantitative PCR in Example 3; among them, 1-9 are recombinant plasmids with 10 8 ~10 0 copies in sequence, and 10 is the negative control;

[0026] Figure 4 The specificity test results of AORV TaqMan fluorescence quantitative PCR in Example 3; among them, 1-12 are AORV-1025, positive control, ARV, IPNV, SVCV, GCRV, AEAdoV-FJ, AngHV, RGV, LMBV, MDRV, and negative control in sequence;

[0027] Figure 5 The distribution of Anguillid orthoreovirus in different tissues and organs of American eel diseased materials detected by AORV TaqMan fluorescence quantitative PCR in Example 4; among them, 1-11 are mucus, fin, blood, skin, muscle, gill, liver, spleen, kidney, intestine, and heart in sequence. Detailed implementation mode

[0028] The purpose of the present invention is to provide a strain of Anguillid orthoreovirus AORV-1025, a primer set, a kit and a method for detecting Anguillid orthoreovirus. The primer set and the kit can quickly and accurately perform fluorescence quantitative detection on Anguillid orthoreovirus, and have the characteristics of high sensitivity, strong specificity, good repeatability, etc.

[0029] The present invention provides a strain of Anguillid orthoreovirus AORV-1025 with the preservation number of CCTCC NO: V202504.

[0030] The present invention isolates a novel eel virus from farmed American eels. Through electron microscopy morphological observation and analysis of virus genome sequencing results, it is confirmed that the virus is a fish-derived orthoreovirus, named Anguillid orthoreovirus AORV-1025, and is deposited.

[0031] The present invention provides an RdRp gene for identifying the Anguillid orthoreovirus AORV-1025 described in the above technical solution. The conserved sequence of the RdRp gene is shown in SEQ ID NO: 6, specifically:

[0032] 5'-AGGCCTGCGCTACCGAGTCTTATAACCACACACAGTTGAAACTAAA GAAGATGATACCGGCAGCGTCGCTATACACGATATACTCAAACCCAACAACAGGCACGGTTCCCATCATAAATTGGGATGAGCCACGTCATGAGTATCGATTCCGTTTGGATGGTATCCGACCCCTACCCCATGGTTGGCGTAACGACTCACCCGACGCATTGGAGCTGAAAACGAAAGGGATAGACCTAGCCAAACAGTTTGGGATGATGACGGAATTCACCGAGATAGAGAGCATTTTCTCTTCACTGGACTGTCATGGACATTCTAGCATGAAAGCGTTGCGTGACGCGCTAGCCGGTGTGTCGTCTCTATTCATAACCCGCTCCCCGACGGACACTGTGCTGCAAGAGTATACGCATGCCCCCGTGATTCTCCGGCCAATACCCGAAGCCGACTGGGAACCGCCACTAGGCGCAGTACGTTACCTACGATCTGACGCGCAACACGACACTGCTAGATCGCTCTATGGAGTCTGGAAGGAAGCTGCCATTCATGTTGCGAATGACCCCAGAATGT-3'.

[0033] The RdRp gene provided by the present invention is an RNA-dependent RNA polymerase gene (RdRp) encoded by segment L3, which is a conserved gene sequence of the genus Orthoreovirus and an important basis for virus species identification and biological classification. It can be used to identify the Anguilla anguilla orthoreovirus AORV-1025 described in the above technical solution.

[0034] The present invention provides a primer pair for amplifying the RdRp gene described in the above technical solution. The primer pair includes the upstream primer AORV-F and the downstream primer AORV-R, and the nucleotide sequences of the upstream primer AORV-F and the downstream primer AORV-R are shown in SEQ ID NO:4 and SEQ ID NO:5 respectively.

[0035] The present invention provides a primer set for detecting Anguilla anguilla reovirus, the primer set includes an upstream primer AORV-qF, a downstream primer AORV-qR and a probe primer AORV-P, and the nucleotide sequences of the upstream primer AORV-qF, the downstream primer AORV-qR and the probe primer AORV-P are shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 respectively. The primer set of the present invention is a TaqMan fluorescence quantitative PCR detection primer set designed with the conserved sequence of the RdRp gene of Anguilla anguilla reovirus described in the above technical solution as the target.

[0036] The present invention also provides a kit for detecting Anguilla anguilla reovirus, the kit includes the primer set described in the above technical solution and PCR amplification reagents. As an implementation manner, the PCR amplification reagents can be TaqMan fluorescence quantitative PCR detection reagents. As an implementation manner, the kit further includes a positive control and / or a negative control; as another implementation manner, the kit further includes a positive control and a negative control. As an implementation manner, the positive control is a recombinant plasmid containing the nucleotide sequence shown in SEQ ID NO:6; as another implementation manner, the initial plasmid in the recombinant plasmid can be pCE2-TA / Blunt. As an implementation manner, the negative control is ddH2O; as another implementation manner, the negative control is sterilized ddH2O.

[0037] The present invention also provides the application of the primer set described in the above technical solution or the kit described in the above technical solution in the preparation of products for detecting Anguilla anguilla reovirus. As an implementation manner, the Anguilla anguilla reovirus can be Anguilla anguilla reovirus AORV-1025. As an implementation manner, the products include reagents or kits.

[0038] The present invention also provides a TaqMan fluorescence quantitative PCR method for detecting Anguilla anguilla reovirus for non-diagnostic and non-therapeutic purposes, including the following steps:

[0039] Performing fluorescence quantitative PCR detection on the sample to be tested using the primer set to obtain a Ct value and an amplification curve; the primer set is the primer set described in the above technical solution or the primer set in the kit described in the above technical solution;

[0040] Judging the detection result based on the Ct value and the amplification curve:

[0041] When the Ct value of the sample to be tested < 35 and the amplification curve is in an "S" shape, the detection result is positive, and the sample to be tested contains Anguilla anguilla reovirus;

[0042] When the Ct value of the sample to be tested ≥ 35 or no "S"-shaped amplification curve appears, the test result is negative, and the sample to be tested does not contain Anguilla anguilla reovirus.

[0043] As an implementation manner, the method further includes performing TaqMan fluorescence quantitative PCR detection on a negative control using a primer set to obtain the Ct value and amplification curve of the negative control; if the Ct value of the negative control < 35 or the amplification curve is "S"-shaped, the test result is invalid this time.

[0044] As an implementation manner, the Anguilla anguilla reovirus may be Anguilla anguilla reovirus AORV-1025. As an implementation manner, the reaction system of the TaqMan fluorescence quantitative PCR detection of the present invention is calculated based on 20 μL and is: 2×OneStep PrimeScript TM III RT-qPCR Mix 10 μL, 50×ROX Reference Dye II 0.4 μL, 10 μM upstream primer 0.6 μL, 10 μM downstream primer 0.6 μL, 10 μM probe primer 0.4 μL, template 2 μL, and ddH2O 6.0 μL. As an implementation manner, the reaction program of the TaqMan fluorescence quantitative PCR detection is: 52°C for 5 min; 95°C for 10 s, 95°C for 5 s, 60°C for 30 s, for 40 cycles.

[0045] As an implementation manner, in the TaqMan fluorescence quantitative PCR method of the present invention, a standard curve is constructed with a positive control. The construction method of the standard curve is not particularly limited, and the method for constructing a standard curve in the conventional TaqMan fluorescence quantitative PCR method in the art can be used. For example, a TaqMan fluorescence quantitative PCR reaction system is established with the positive control as the template, and the relationship between the positive control with different copy numbers and its C T value is used to draw the standard curve; as an implementation manner, the linear relationship between the copy number of the positive control and the C T value is y = -3.208x + 39.677, the correlation coefficient R 2 is 0.998, and the amplification efficiency is 105.003%. It can be seen that the copy number of the positive control and the C T value have a good linear relationship.

[0046] The present invention provides the application of the Anguilla anguilla orthoreovirus AORV-1025 described in the above technical solution, or the primer set described in the above technical solution, or the kit described in the above technical solution, or the TaqMan fluorescence quantitative PCR method described in the above technical solution in the preparation of products for preventing, controlling and / or monitoring viral diseases of Anguilla anguilla. As an implementation manner, the application is the application in the preparation of products for preventing, controlling and monitoring viral diseases of Anguilla anguilla. As an implementation manner, the product may be a reagent, a drug or a kit.

[0047] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0048] The following virus strains, cell lines and test materials used in the embodiments:

[0049] The eel ovary cell line (EO) is preserved by the Institute of Biotechnology, Fujian Academy of Agricultural Sciences. The Anguilla anguilla reovirus AORV-1025 is isolated, identified and preserved by the Institute of Biotechnology, Fujian Academy of Agricultural Sciences. Infectious pancreatic necrosis virus (IPNV), Spring viremia of carp virus (SVCV), Grass carp reovirus (GCRV), American Eel adomavirus Fujian strain (AEAdoV-FJ), Anguillid herpesvirus (AngHV), Rana grylio virus (RGV) and Largemouth bass ranavirus (LMBV) are isolated or preserved by the Institute of Biotechnology, Fujian Academy of Agricultural Sciences. Avian reovirus (ARV s1133 strain) and Muscovy duck reovirus (MDRV) are both identified and generously provided by the Institute of Animal Husbandry and Veterinary Medicine, Fujian Academy of Agricultural Sciences.

[0050] Example 1

[0051] Isolation and identification of a strain of Anguilla anguilla orthoreovirus, the steps are as follows:

[0052] A novel anguillid virus was isolated from cultured eels. Through electron microscopy morphological observation and viral genome sequencing analysis, it was confirmed that the virus was a type of orthoreovirus, named Anguillid orthoreovirus AORV-1025, and was deposited, with the deposit number of CCTCC NO: V202504. Genome homologous evolution analysis showed that Anguillid orthoreovirus was closely related to Piscine orthoreovirus (PRV) and Largemouth bass orthoreovirus (LMBRV), and clustered into a relatively independent branch in the phylogenetic tree.

[0053] AORV belongs to the genus Orthoreovirus of the family Spinareoviridae. Its genome is composed of 10 segments of dsRNA: L1, L2, L3, M1, M2, M3, S1, S2, S3, S4. Among them, the L3 segment encodes the RNA-dependent RNA polymerase gene (RdRp), which is a conserved gene sequence of the genus Orthoreovirus and an important basis for virus species identification and biological classification.

[0054] Example 2

[0055] Primer design and screening for the kit of fluorescence quantitative detection of Anguillid orthoreovirus are as follows:

[0056] The RdRp gene sequences of 3 strains of Anguillid orthoreovirus were compared with related viruses in GenBank. Specific primers for Anguillid orthoreovirus were designed for the species-specific gene fragment sequence interval of AORV, which were used as alternative primers for the detection method in the present invention and were synthesized by Shanghai Sangon Biological Engineering Technology & Services Co., Ltd.

[0057] Anguillid orthoreovirus AORV-1025 was inoculated into the eel ovary cell line (EO). After typical cytopathic effects occurred in the cells, the culture supernatant and cytopathic cells were collected, and total RNA was extracted as a template. TaqMan fluorescence quantitative PCR amplification was performed using the synthesized primer set. According to the Ct value and amplification curve, a pair of primers with high amplification efficiency and strong specificity, AORV-qF (SEQ ID NO: 1) / AORV-qR (SEQ ID NO: 2), and a probe AORV-P (SEQ ID NO: 3) were screened out for the establishment of the subsequent detection method.

[0058] Table 1 Primer pairs and probes for TaqMan fluorescence quantitative PCR detection of AORV

[0059]

[0060] Note: In the sequences of Table 1, W, R, Y, etc. represent degenerate primer codes. The 5' end of the AORV-P is modified with a FAM group, and the 3' end of the AORV-P is modified with a BHQ group.

[0061] Example 3

[0062] Kit for Fluorescent Quantitative Detection of Anguillid Orthoreovirus

[0063] 1. Preparation of Positive Plasmid Standard

[0064] Inoculate the EO cell line with Anguillid orthoreovirus AORV-1025. After typical cytopathic effects occur in the cells, collect and centrifuge to obtain the cell culture supernatant. Extract total RNA and reverse transcribe it into cDNA. Use the primer pair AORV-F / AORV-R to perform PCR amplification on the extracted cDNA;

[0065] AORV-F: 5'-AGGCCTGCGCTACCGAGTCTTAT-3' (SEQ ID NO:4);

[0066] AORV-R: 5'-ACATTCTGGGGTCATTCGCAACAT-3' (SEQ ID NO:5);

[0067] Reaction system: 1 μL of cDNA, 12.5 μL of 2×TaqMasterMix, 1 μL each of 10 μmol / L AORV-F and 10 μmol / L AORV-R, and add ddH2O to make up to 25 μL;

[0068] Reaction program: Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 20 s, for a total of 30 cycles; finally, extension at 72°C for 7 min.

[0069] The amplified product was detected by 1.5% agarose gel electrophoresis, and the target fragment was cut out, recovered and purified. The results are as Figure 1 shown, where lane 1 is the target fragment and lane 2 is the negative control (ddH2O).

[0070] The target fragment was ligated into the plasmid pCE2-TA / Blunt, transformed into competent DH5α, and positive clones were picked and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing identification. The nucleotide sequence of the target fragment is as shown in SEQ ID NO:6. The sequencing results indicate that the target gene was cloned into the pCE2-TA / Blunt vector, and the standard plasmid pCE2-TA / L3 was successfully constructed.

[0071] Positive clones were taken and pCE2-TA / L3 positive plasmid was extracted as positive control DNA according to the instructions of the plasmid small-dose extraction kit. Its concentration and purity were determined by ultra-micro UV spectrophotometer. A single target band was observed by 1.5% agarose gel electrophoresis. The copy number per unit volume (μL) was calculated by DNA / RNA Copy Number Calculator (http: / / www.endmemo.com / bio / dnacopynum.php) as a standard. After aliquoting, it was stored at -80°C for future use. The measured plasmid concentration was 87.64 ng / μL, and the calculated plasmid copy number was 1.89×10 10 copies / μL.

[0072] 2. Establish a standard curve

[0073] The positive plasmid DNA was serially diluted 10-fold to 10 8 ~10 1 8 concentration gradients of 10 copies / μL were used as templates for fluorescence quantitative PCR amplification using primer pair AORV-qF (SEQ ID NO: 1) / AORV-qR (SEQ ID NO: 2) and probe AORV-p (SEQ ID NO: 3). Three replicates were set for each concentration, and ddH2O was used instead of template for the negative control to prepare a standard curve.

[0074] The total reaction volume is 20 μL: One Step PrimeScript TM III RT-qPCR Mix (2×) 10 μL, ROX Reference Dye II (50×) 0.4 μL, 10 μM upstream and downstream primers 0.6 μL each, 10 μM probe primer 0.4 μL, template 2 μL, ddH2O 6.0 μL.

[0075] Amplification conditions: 52°C for 5 min; 95°C for 10 s, 95°C for 5 s, 60°C for 30 s, for 40 cycles.

[0076] Result determination: The present invention determines the test result based on the Ct value and the amplification curve. When the Ct value is less than 35 and the amplification curve is "S" shaped, the test result is positive, that is, the test sample contains eel orthoreovirus;

[0077] When the Ct value is ≥35 or no "S"-shaped amplification curve appears, the test result is negative, that is, the test sample does not contain eel orthoreovirus;

[0078] If the negative control Ct value is less than 35 or the amplification curve is "S" shaped, the experimental results are invalid.

[0079] Plasmid copy number and CT Values were used to plot a standard curve ( Figure 2 ). The linear relationship between the plasmid copy number and the C T value was y = -3.208x + 39.677, and the correlation coefficient R 2 was 0.998, and the amplification efficiency was 105.003%, indicating that there was a good linear relationship between the C T value and the copy number of this TaqMan fluorescence quantitative PCR.

[0080] 3. Sensitivity detection

[0081] Using 10 8 - 10 0 copies / μL plasmid pCE2-TA / L3 DNA serially diluted 10-fold as templates, TaqMan fluorescence quantitative PCR amplification was performed using the designed primer pair AORV-qF (SEQ ID NO:1) / AORV-qR (SEQ ID NO:2) and probe AORV-p (SEQ ID NO:3). The amplification system and amplification conditions were the same as those shown in step 2, and the results are shown in Figure 3 . The results showed that the detection limit of TaqMan fluorescence quantitative PCR was 10 copies.

[0082] 4. Specificity detection

[0083] Using the genomes of AORV-1025, ARV, IPNV, SVCV, GCRV, AEAdoV-FJ, AngHV, RGV, LMBV, MDRV and plasmid pCE2-TA / L3 as templates, TaqMan fluorescence quantitative PCR amplification was performed according to the established detection method to judge the specificity of this method, and the results are shown in Figure 4 . The results showed that both AORV-1025 and plasmid pCE2-TA / L3 had amplification signals, while other templates and negative controls had no specific amplification signals. The above results indicated that the established TaqMan fluorescence quantitative PCR detection method had good specificity.

[0084] 5. Repeatability detection

[0085] Taking 10 4 , 10 5 and 10 6 copies / μL of 3 concentrations of positive plasmids as templates, repeatability detection of TaqMan fluorescence quantitative PCR was performed. Each concentration was set with 3 replicates. According to the coefficient of variation of the C t value, the within-group repeatability of this method was analyzed; the experiment was repeated 3 times to analyze the between-group repeatability, and the results are shown in Table 2.

[0086] Table 2 Repeatability of AORV TaqMan fluorescence quantitative PCR detection method

[0087]

[0088] It can be obtained from Table 2 that the within-group coefficient of variation is less than 1%, which are 0.25%, 0.21% and 0.15% respectively; the between-group coefficient of variation is less than 2%, which are 1.82%, 1.19% and 0.61% respectively, indicating that this method has good repeatability and can ensure the stability and reliability of the detection results.

[0089] Example 4

[0090] Application of the Fluorescent Quantitative Detection Kit for Anguillid Orthoreovirus

[0091] 1. Use the TaqMan fluorescent quantitative PCR method established in Example 3 to detect AORV in 46 collected suspected anguillid disease samples.

[0092] The 46 disease samples are as follows: 23 pieces of anguillid gill tissues collected from 2015 to 2024, and the positive detection rate is 21.74% (5 / 23); 23 pieces of visceral tissues such as anguillid liver, spleen and kidney collected from 2010 to 2024, and the positive detection rate is 30.43% (7 / 23) (Table 3).

[0093] Table 3 TaqMan Fluorescent Quantitative PCR Detection of AORV in Anguillid Disease Samples

[0094] Tissue site Year Number of samples to be tested Number of positive samples Positive sample rate (%) Gill 2015-2024 23 5 21.74 Liver, spleen and kidney 2010-2024 23 7 30.43

[0095] 2. Use the TaqMan fluorescent quantitative PCR method established in Example 3 to detect AORV in different tissues of anguillid disease samples. The results show that AORV can be detected in the blood and various tissues of infected anguillids. Among them, the viral load in the spleen is relatively high, while the viral loads in muscle and liver tissues are relatively low ( Figure 5 ).

[0096] It can be seen from the results in Example 4 that the kit for anguillid orthoreovirus established by the present invention has good application effects.

[0097] In summary, the primer pair and kit for fluorescent quantitative detection of anguillid orthoreovirus provided by the present invention have high sensitivity, strong specificity, good repeatability, and good application effects. They can be used for the rapid and fluorescent quantitative detection of anguillid orthoreovirus, and also have important significance for the prevention and control of anguillid viral diseases.

[0098] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all belong to the protection scope of the present invention.

Claims

1. An eel orthoreovirus (AORV-1025), with a deposit number of CCTCCNO: V202504.

2. A RdRp gene for identifying the eel orthoreovirus AORV-1025 according to claim 1, characterized in that: The conservative sequence of the RdRp gene is shown in SEQ ID NO:

6.

3. A primer pair for amplifying the RdRp gene according to claim 2, characterized in that: The primer pair includes an upstream primer AORV-F and a downstream primer AORV-R, and the nucleotide sequences of the upstream primer AORV-F and the downstream primer AORV-R are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.

4. A primer set for detecting eel orthoreovirus, characterized in that: The primer set includes an upstream primer AORV-qF, a downstream primer AORV-qR and a probe primer AORV-P, and the nucleotide sequences of the upstream primer AORV-qF, the downstream primer AORV-qR and the probe primer AORV-P are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

5. A kit for detecting eel orthoreovirus, characterized in that: The kit comprises the primer set according to claim 4 and a PCR amplification reagent.

6. The kit according to claim 5, characterized in that The PCR amplification reagent includes TaqMan fluorescent quantitative PCR detection reagent.

7. The kit according to claim 5 or 6, characterized in that The kit also includes a positive control and a negative control; the positive control is a recombinant plasmid containing the nucleotide sequence shown in SEQ ID NO: 6, and the negative control is ddH2O.

8. Use of the primer set according to claim 4 or the kit according to any one of claims 5 to 7 in the preparation of a product for detecting eel orthoreovirus.

9. A TaqMan fluorescent quantitative PCR method for detecting eel orthoreovirus for non-diagnostic and non-therapeutic purposes, characterized in that: The steps include: Performing fluorescent quantitative PCR detection on the sample to be tested using the primer set to obtain a Ct value and an amplification curve; the primer set is the primer set according to claim 4 or the primer set in the kit according to any one of claims 5 to 7; The test results are determined based on the Ct value and the amplification curve: When the Ct value of the sample to be tested is less than 35 and the amplification curve is "S" shaped, the test result is positive, and the sample to be tested contains eel orthoreovirus; When the Ct value of the sample to be tested is ≥35 or no "S"-shaped amplification curve appears, the test result is negative, and the sample to be tested does not contain eel orthoreovirus.

10. Use of the eel orthoreovirus AORV-1025 described in claim 1, or the primer set described in claim 4, or the kit described in any one of claims 5 to 7, or the TaqMan fluorescent quantitative PCR method described in claim 9 in the preparation of products for preventing, controlling and / or monitoring eel viral diseases.