Imine reductase mutant and application thereof in synthesis of brivaracetam
By genetically engineering imine reductase, mutants with increased vitality were obtained, which solved the problem of C4 chiral center synthesis in bovacetam synthesis and achieved efficient and environmentally friendly bovacetam synthesis.
Patent Information
- Application Number
- CN202311721105.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-14
- Publication Date
- 2025-06-24
AI Technical Summary
In the prior art, when synthesizing the antiepileptic drug bovacetam, especially the synthesis of C4 chiral centers, there are problems such as poor environmental protection and low route complexity.
Imine reductase derived from Streptomyces aureocircularatus was directed to evolve the imine reductase mutants with increased enzyme activity and substrate tolerance, and catalyzed asymmetric reduction amination reaction to prepare bovacetam with high chiral purity.
It significantly improves the synthetic vitality of bovacetam, is suitable for large-scale industrial production, has mild reaction conditions and short reaction time, which reduces production costs and improves the market competitiveness of the products.
Smart Images

Figure BDA0004607466860000011 
Figure BDA0004607466860000061 
Figure BDA0004607466860000081
Abstract
Description
Technical Field
[0001] The present invention belongs to the fields of molecular biology and enzyme engineering, and relates to an imine reductase mutant and its application in the synthesis of brivaracetam. Specifically, it relates to an imine reductase mutant, a recombinant host cell, a cell culture, and a method for enzymatically synthesizing the anti-epileptic drug brivaracetam. Background Art
[0002] Epilepsy is one of the most common neurological diseases, with the total number of epilepsy patients worldwide exceeding 50 million. Brivaracetam is the third-generation anti-epileptic drug launched by UCB Belgium after levetiracetam and was approved for marketing by the European Medicines Agency and the US Food and Drug Administration in 2016. Brivaracetam belongs to chiral pyrrolidone derivatives. Compared with levetiracetam, it has a (R)-n-propyl group connected at the 4-position of the pyrrolidine hydrocarbon. The molecular formula of brivaracetam is C 11 H 20 N2O2, and its structural formula is as follows:
[0003]
[0004] Currently, the chiral center at the (2S) position in the brivaracetam molecule is mainly introduced through chiral raw materials such as (R)-2-bromobutyric acid and (S)-2-aminobutyramide. Relatively speaking, the chiral center at the C4 position in the pyrrolidine hydrocarbon has become the key and difficult point in the synthesis. The methods for kilogram-scale synthesis include chiral column chromatography separation (WO2017076738A1) and lipase-catalyzed resolution (A. Schule, A. Merschaert, C. Szczepaniak, C. Marechal, N. Carly, J. O'Rourke, C. Ates, Org. Process Res. Dev. 2016, 20, 1566-1575.), but they have problems of poor environmental protection and complex routes with low yields (9%) respectively. Biocatalytic asymmetric amination of α-substituted carbonyl compounds is one of the most important and direct methods for synthesizing β-chiral amines. Kroutil et al. synthesized an intermediate of brivaracetam by dynamic kinetic resolution amination of α-substituted aldehyde esters catalyzed by transaminase (C.S. Fuchs, J.E. Farnberger, G. Steinkellner, J.H. Sattler, M. Pickl, R.C. Simon, F. Zepeck, K. Gruber, W. Kroutil, Adv. Synth. Catal. 2018, 360, 768-778.), but it needs to react further with (R)-2-bromobutyric acid to obtain the final product, which will cause partial racemization at the C4 position. Therefore, it is very necessary to find a biocatalytic enzyme reagent for efficiently synthesizing brivaracetam. Summary of the Invention
[0005] Problems to be Solved by the Invention
[0006] To solve the above problems, the present invention provides a variety of imine reductases modified by genetic engineering means. Specifically, the activity of the modified imine reductase mutant in synthesizing brivaracetam is significantly improved, which is suitable for large-scale industrial production.
[0007] In previous studies, the inventors screened an imine reductase from a large number of imine reductases that can catalyze the synthesis of brivaracetam from ethyl 3-formylhexanoate and (S)-2-aminobutyramide. This enzyme is derived from Streptomyces aureocirculatus. The present invention uses this imine reductase as the starting point for modification and introduces mutations artificially to change its catalytic performance.
[0008] Solutions for Solving the Problems
[0009] The object of the present invention is to efficiently synthesize brivaracetam under mild reaction conditions. The present invention conducts directed evolution on the imine reductase IR104 (NCBI, WP_078965966.1) derived from Streptomyces aureocirculatus to obtain imine reductase mutants with improved enzyme activity and substrate tolerance, and catalyze asymmetric reductive amination reactions to prepare brivaracetam with high chiral purity.
[0010] The present invention provides an imine reductase mutant, wherein the mutant is selected from any one of the groups consisting of the following (I)-(IV):
[0011] (I) Compared with the sequence shown in SEQ ID NO.1, the imine reductase mutant contains mutations at one or more positions corresponding to positions 191, 195, 253, and 258 of the sequence shown in SEQ ID NO.1;
[0012] (II) A mutant having at least 98% sequence identity with the mutated sequence described in (I) and containing the mutation, but not including the mutant itself described in (I);
[0013] (III) The mutant includes deletion or addition of at least one amino acid residue at the N-terminal or C-terminal part of the mutant of the sequence shown in (I) and contains the mutation.
[0014] Preferably, the amino acid at position 191 of the mutant corresponding to the sequence shown in SEQ ID NO:1 is mutated from aspartic acid (D) to glutamic acid (E); and / or
[0015] The amino acid at position 195 of the sequence shown in SEQ ID NO:1 in the mutant is mutated from leucine (L) to isoleucine (I) and glutamine (N); and / or
[0016] The amino acid at position 253 of the sequence shown in SEQ ID NO:1 in the mutant is mutated from glutamate (E) to serine (S), tryptophan (W), phenylalanine (F), histidine (H) and leucine (L), preferably mutated to serine (S) and tryptophan (W); and / or
[0017] The amino acid at position 258 of the sequence shown in SEQ ID NO:1 in the mutant is mutated from methionine (M) to alanine (A), tryptophan (W), aspartic acid (D), glutamate (E), lysine (K), asparagine (N), glutamine (Q), arginine (R), serine (S), glycine (G), cysteine (C), valine (V) and leucine (L).
[0018] In some specific embodiments, the imine reductase mutant obtained by mutation of the present invention is selected from one of the following mutants:
[0019] (1) Relative to the amino acid sequence of the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamate (E) (denoted as D191E, numbered as mutant 1);
[0020] (2) Relative to the amino acid sequence of the sequence shown in SEQ ID NO:1, leucine (L) at position 195 is mutated to isoleucine (I) (denoted as L195I, numbered as mutant 2);
[0021] (3) Relative to the amino acid sequence of the sequence shown in SEQ ID NO:1, leucine (L) at position 195 is mutated to glutamine (N) (denoted as L195N, numbered as mutant 3);
[0022] (4) Relative to the amino acid sequence of the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamate (E), and leucine (L) at position 195 is mutated to isoleucine (I) (denoted as D191E / L195I, numbered as mutant 4);
[0023] (5) Relative to the amino acid sequence of the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamate (E), leucine (L) at position 195 is mutated to isoleucine (I), and glutamate (E) at position 253 is mutated to serine (S) (denoted as D191E / L195I / E253S, numbered as mutant 5);
[0024] (6) The aspartic acid (D) at position 191 is mutated to glutamic acid (E), the leucine (L) at position 195 is mutated to isoleucine (I), and the glutamic acid (E) at position 253 is mutated to tryptophan (W) with respect to the amino acid sequence shown in SEQ ID NO:1 (denoted as D191E / L195I / E253W, numbered as mutant 6);
[0025] (7) The aspartic acid (D) at position 191 is mutated to glutamic acid (E), the leucine (L) at position 195 is mutated to isoleucine (I), the glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to alanine (A) with respect to the amino acid sequence shown in SEQ ID NO:1 (denoted as D191E / L195I / E253S / M258A, numbered as mutant 7);
[0026] (8) The aspartic acid (D) at position 191 is mutated to glutamic acid (E), the leucine (L) at position 195 is mutated to isoleucine (I), the glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to tryptophan (W) with respect to the amino acid sequence shown in SEQ ID NO:1 (denoted as D191E / L195I / E253S / M258W, numbered as mutant 8);
[0027] (9) The aspartic acid (D) at position 191 is mutated to glutamic acid (E), the leucine (L) at position 195 is mutated to isoleucine (I), the glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to aspartic acid (D) with respect to the amino acid sequence shown in SEQ ID NO:1 (denoted as D191E / L195I / E253S / M258D, numbered as mutant 9);
[0028] (10) The aspartic acid (D) at position 191 is mutated to glutamic acid (E), the leucine (L) at position 195 is mutated to isoleucine (I), the glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to lysine (K) with respect to the amino acid sequence shown in SEQ ID NO:1 (denoted as D191E / L195I / E253S / M258K, numbered as mutant 10);
[0029] (11) In the amino acid sequence relative to the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to glutamic acid (E) (denoted as D191E / L195I / E253S / M258E, numbered as mutant 11);
[0030] (12) In the amino acid sequence relative to the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to asparagine (N) (denoted as D191E / L195I / E253S / M258N, numbered as mutant 12);
[0031] (13) In the amino acid sequence relative to the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to glutamine (Q) (denoted as D191E / L195I / E253S / M258Q, numbered as mutant 13);
[0032] (14) In the amino acid sequence relative to the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to arginine (R) (denoted as D191E / L195I / E253S / M258R, numbered as mutant 14);
[0033] (15) In the amino acid sequence relative to the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to serine (S) (denoted as D191E / L195I / E253S / M258S, numbered as mutant 15);
[0034] (16) In the amino acid sequence relative to the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to glycine (G) (denoted as D191E / L195I / E253S / M258G, numbered as mutant 16);
[0035] (17) In the amino acid sequence relative to the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to cysteine (C) (denoted as D191E / L195I / E253S / M258C, numbered as mutant 17);
[0036] (18) In the amino acid sequence relative to the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to valine (V) (denoted as D191E / L195I / E253S / M258V, numbered as mutant 18);
[0037] (19) In the amino acid sequence relative to the sequence shown in SEQ ID NO:1, aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to leucine (L) (denoted as D191E / L195I / E253S / M258S, numbered as mutant 19);
[0038] In some embodiments, the protein with imine reductase activity provided by the present invention has an addition or deletion of amino acids starting from at least one of the N - terminus and the C - terminus of the mutant of imine reductase.
[0039] In some specific embodiments, starting from at least one of the N - terminus and the C - terminus of the above - mentioned mutant of imine reductase, 1 - 20 amino acids, preferably 1 - 15, more preferably 1 - 10, more preferably 1 - 3, and most preferably 1 amino acid are added or deleted, and it has imine reductase activity.
[0040] The present invention also provides a recombinant polypeptide, wherein the recombinant polypeptide comprises the imine reductase mutant described in any one of the above, and an exogenous polypeptide fused to the mutant.
[0041] The present invention provides an isolated polynucleotide, wherein the polynucleotide comprises a nucleotide sequence encoding the imine reductase mutant, or comprises a nucleotide sequence encoding the recombinant polypeptide;
[0042] The present invention provides a nucleic acid expression cassette, wherein the nucleic acid construct comprises the isolated polynucleotide, optionally, the polynucleotide is operably linked to one or more regulatory sequences, and the regulatory sequence is a nucleotide sequence comprising a promoter and / or a ribosome binding site, and the regulatory sequence directs the expression of the mutant gene in a host cell and synthesizes the mutant enzyme.
[0043] The present invention further provides a recombinant expression vector, wherein the recombinant expression vector comprises the isolated polynucleotide, or the nucleic acid expression cassette.
[0044] The present invention also provides a recombinant genetically engineered bacterium, wherein the recombinant genetically engineered bacterium comprises the imine reductase mutant, the recombinant polypeptide according to the above, the isolated polynucleotide according to the above, the nucleic acid expression cassette according to the above, or the recombinant expression vector according to the above.
[0045] Specifically, the starting bacterium of the recombinant genetically engineered bacterium is a genus of Escherichia, Erwinia, Serratia, Providencia, Enterobacteria, Salmonella, Streptomyces, Pseudomonas, Brevibacterium, Bacillus or Corynebacterium.
[0046] Preferably, the starting bacterium of the recombinant genetically engineered bacterium is Escherichia coli, Corynebacterium glutamicum or Bacillus subtilis.
[0047] The present invention also provides a cell culture comprising the recombinant genetically engineered bacterium.
[0048] The present invention also provides a method for preparing the mutant, the method comprising culturing the recombinant genetically engineered bacterium, and then recovering the imine reductase mutant from the recombinant genetically engineered bacterium or its culture.
[0049] The present invention particularly provides the use of the imine reductase mutant, the recombinant polypeptide, the isolated polynucleotide, the nucleic acid expression cassette, the recombinant expression vector, the recombinant genetically engineered bacterium, or the cell culture in the synthesis of brivaracetam. Optionally, ethyl 3-formylhexanoate and (S)-2-aminobutanamide are used as substrates.
[0050] The present invention further provides a method for synthesizing brivaracetam, the method comprising the step of synthesizing brivaracetam using the imine reductase mutant, the recombinant polypeptide, the isolated polynucleotide, the nucleic acid expression cassette, the recombinant expression vector, the recombinant genetically engineered bacterium, or the cell culture;
[0051] In the method, through the catalytic action of the imine reductase mutant, ethyl 3-formylhexanoate (Formula I) and (S)-2-aminobutanamide (Formula II) are catalytically combined to form (S)-2-((R)-2-oxo-4-propylpyrrolidin-1-yl)butanamide, i.e., brivaracetam (Formula IV).
[0052] The principle is to obtain ethyl (R)-3-(((S)-1-amino-1-oxobutan-2-yl)amino)methyl)hexanoate (Formula III) through asymmetric reductive amination. Compound III can then spontaneously cyclize or the cyclization can be promoted by 2-hydroxypyridine, and finally (S)-2-((R)-2-oxo-4-propylpyrrolidin-1-yl)butanamide, i.e., brivaracetam (Formula IV) is obtained.
[0053]
[0054] Optionally, the method further comprises the step of purifying or isolating brivaracetam;
[0055] Preferably, the concentration of the substrate is 10-200 mM, preferably 50-100 mM; the substrate concentration of (S)-2-aminobutanamide is 1.5-2 times the molar equivalent of the former.
[0056] Optionally, in the step of synthesizing brivaracetam, a coenzyme regeneration system is further included, and the coenzyme regeneration system is a system composed of glucose dehydrogenase and glucose, or a system composed of formate dehydrogenase and formate; optionally, the coenzyme regeneration system further includes the coenzyme of glucose dehydrogenase or formate dehydrogenase to promote the stability of the coenzyme regeneration system reaction.
[0057] In some specific steps of producing brivaracetam, the pH of the reaction system is 5.0 - 10.0, preferably 7.0 - 8.5, more preferably 7.5; the reaction temperature is 20°C - 40°C, preferably 25°C; the reaction time can be selected to be more than 2 h, preferably 4 - 30 h, and further preferably 24 h.
[0058] In some specific embodiments, the imine reductase mutant can participate in the reaction in the form of pure enzyme, crude enzyme solution, host cells expressing it, cell lysates of host cells expressing it, or fermentation broth containing host cells expressing it. The host cells can be collected by centrifugation or filtration for use in the catalytic conversion by host cells.
[0059] In some preferred embodiments, it participates in the reaction in the form of whole cells or crude enzyme solution.
[0060] In some specific steps of producing brivaracetam, ethyl 3-formylhexanoate and (S)-2-aminobutyramide are used as substrates: the concentration of ethyl 3-formylhexanoate is 10 - 200 mM, preferably 50 - 100 mM.
[0061] Effects of the Invention
[0062] The present invention provides an imine reductase mutant and its application. Compared with the wild type, the enzyme activity of the imine reductase mutant is significantly improved. In some embodiments, the relative enzyme activity of the imine reductase mutant of the present invention can reach 2.3 - 120 times that of the wild type, and it still has high enzyme activity at high substrate concentrations (50 - 200 mM), and brivaracetam can be prepared using ethyl 3-formylhexanoate and (S)-2-aminobutyramide as raw materials. Therefore, the mutant of the present invention can catalyze the high-concentration (50 - 100 mM) substrate ethyl 3-formylhexanoate to produce brivaracetam.
[0063] The imine reductase mutant of the present invention has high catalytic efficiency, mild reaction conditions, and short reaction time, saving costs for the synthesis of brivaracetam and improving the market competitiveness of this product.
[0064] Therefore, the recombinant polypeptide, isolated polynucleotide, nucleic acid construct, and recombinant expression vector of the present invention respectively contain or express the above-mentioned imine reductase mutant and can be applied to the industrial production of brivaracetam. The present invention utilizes the above-mentioned imine reductase mutant, or recombinant polypeptide, recombinant host cell, etc., to achieve the stable and efficient synthesis of brivaracetam. Description of the Drawings
[0065] Figure 1 1H NMR spectrum of the product (S)-2-((R)-2-oxo-4-propylpyrrolidin-1-yl)butyramide.
[0066] Figure 213C NMR spectrum of the product (S)-2-((R)-2-oxo-4-propylpyrrolidin-1-yl)butanamide. Specific embodiments
[0067] The experimental techniques and methods used in this example are all conventional technical methods without special instructions. For example, the experimental methods without specific conditions in the following examples are usually carried out under conventional conditions such as those described by Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels without special instructions.
[0068] The imine reductase mutants constructed in this disclosure are all mutants of the wild-type imine reductase (IR104, NCBI Reference Sequence: WP_078965966.1) from Streptomyces aureocirculatus.
[0069] Among them, the amino acid sequence of the wild-type imine reductase is as follows (SEQ ID NO: 1):
[0070]
[0071] Example 1: Construction of a Mutant Library of Imine Reductase IR104 and Screening of Mutants
[0072] 1. First-round activity improvement
[0073] Select the protein with 40% sequence homology to IR104 (PDB ID: 5OCM) as the template, obtain the simulated protein structure of IR104 through homology modeling, and select the amino acid residues within the substrate-binding pocket (residues at positions 35, 87, 113, 115, 139, 140, 141, 142, 143, 144, 147, 191, 192, 195, 198, 199, 229, 233, 236, 253, 254, 258, 259, 262 respectively) for saturation mutagenesis, design mutant primers using degenerate codons NNK, and use pET28a-IR104 as the template. Perform two-step PCR using the high-fidelity polymerase FastPfu-DNA for PCR.
[0074] ① Construction of pET28a-IR141 plasmid
[0075] The amino acid sequence of the wild-type imine reductase is shown in SEQ ID NO: 1. The corresponding nucleotide sequence was fully synthesized and cloned between the restriction enzyme sites NdeI and EcoRI of the pET-28a vector to obtain the recombinant plasmid pET-28a-IR104, which was further transformed into the expression host E. coli BL21(DE3). Positive clones were picked to obtain the recombinant expression transformant E. coli BL21(DE3) / pET-28a-IR104.
[0076] ② Construction of the imine reductase single-point mutant library
[0077] Using pET28a-IR104 as a template, amplification was carried out using the primers in Table 1. The forward primers at positions 35, 87, 113, 115, 139, 140, 141, 142, 143, 144, 147 were respectively combined with the reverse primer R1 for PCR, the forward primers at positions 191, 192, 195, 198, 199 were respectively combined with the reverse primer R2 for PCR, and the reverse primers and forward primer F1 at positions 229, 233, 236, 253, 254, 258, 259, 262 were used for PCR. The PCR reaction system and reaction conditions are as follows:
[0078] a. The first-step PCR reaction system and reaction conditions
[0079] Round 1: In a 25 μL PCR reaction system with a total volume, add 15 ng of template, 5 μL of 10× buffer, 2 μL of dNTP (2.5 mM), 0.5 μL of each pair of mutant primers (10 μM), 0.5 μL of FastPfu DNA polymerase, and add sterilized distilled water to 25 μL.
[0080] The first-step PCR reaction program: ① Pre-denaturation at 95 °C for 2 min, ② Denaturation at 95 °C for 20 sec, ③ Annealing at Tm - 5 °C for 20 sec, ④ Extension at 72 °C for 15 sec, ⑤ Final extension at 72 °C for 5 min. Steps ② - ④ are carried out for 30 cycles.
[0081] b. The second-step PCR reaction system and reaction conditions
[0082] Round 2: In a 50 μL PCR reaction system with a total volume, add 30 ng of template, 10 μL of 5× FastPfuDNApolymerase buffer, 5 μL of dNTP (2 mM), 1 μL of each pair of mutant primers, 1 μL of Pfu polymerase, 2 μL of MgSO4 (25 mM), and add sterilized distilled water to 50 μL.
[0083] Second-step PCR reaction procedure: ① Pre-denaturation at 95°C for 2 min, ② Denaturation at 95°C for 20 sec, ③ Annealing at 60°C for 45 sec, ④ Extension at 72°C for 3 min, ⑤ Final extension at 72°C for 5 min. Steps ② - ④ are repeated for 30 cycles.
[0084] After verifying the PCR products obtained in the above steps by agarose gel electrophoresis analysis, add restriction endonuclease DpnI and digest at 37°C for 2 h. Transfer the digested products into E. coli BL21(DE3) competent cells and spread them on a plate containing 50 μg / mL kanamycin antibiotic. Incubate statically in a 37°C incubator for about 12 h until single colonies grow, obtaining an imine reductase mutant library.
[0085] Meanwhile, transfer the pET28a-IR104 plasmid into E. coli BL21(DE3) competent cells and spread them on a plate containing 50 mg / ml kanamycin antibiotic. Incubate statically in a 37°C incubator for about 12 h until single colonies grow, obtaining a strain expressing the imine reductase mutant.
[0086] Table 1. Primer sequences for the first-round modification
[0087]
[0088]
[0089] ③ Induced expression of imine reductase mutants
[0090] Pick the monoclonal colonies obtained after culturing in the above step 2 into a 4 mL LB liquid medium containing kanamycin (50 mg / L) (peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L), and culture overnight at 37°C and 200 rpm to obtain a culture solution. Inoculate the culture solution into a fermentation medium (LB liquid medium) at an inoculation amount of 1% (v / v), and culture in a shaker at 37°C and 200 rpm until the OD 600 reaches 0.6 - 0.8. Add IPTG to a final concentration of 0.1 mM, and induce in a shaker at 25°C and 200 rpm for 8 - 12 h. Centrifuge the culture solution at 6000 g to collect the cells, perform high-pressure crushing to obtain a crude enzyme solution of imine reductase, and perform subsequent enzyme activity detection.
[0091] ④ Screening of imine reductase mutants
[0092] The screening method is to detect the decrease of NADPH at 340 nm. The specific method of the reaction is as follows: ethyl 3-formylhexanoate 10 mM, (S)-2-aminobutyramide 20 mM, 10% (v / v) dimethyl sulfoxide (DMSO), NADPH 0.25 mg / mL, crude enzyme solution 100 μL, and the volume is made up to 200 μL with sodium phosphate buffer. NADPH has a characteristic absorbance at 340 nm. The decrease in absorbance at 340 nm is detected using a microplate reader. If the enzyme activity is relatively high, the consumption of NADPH is faster, and the slope of the decrease curve is larger. The beneficial mutation sites with increased enzyme activity obtained by screening are 191 and 195, specifically the mutants 1-3 (D191E, L195I, L195N).
[0093] 2. Second-round activity improvement
[0094] According to the saturation mutagenesis results, the combined mutant D191E / L195I of D191E and L195I was constructed. The construction method is as follows (the primers used are shown in Table 2): Using mutant 1 (D191E) as the template, PCR was performed using the forward primer L195I-F and the reverse primer R2 to obtain mutant 4 (D191E / L195I).
[0095] Subsequently, using mutant 4 (D191E / L195I) as the template, a simulated protein was obtained through homology modeling, and amino acid residues within the range of its substrate-binding pocket (specifically the 34th, 140th, 141st, 142nd, 144th, 146th, 147th, 194th, 195th, 197th, 198th, 199th, 201st, 202nd, 229th, 232nd, 233rd, 235th, 236th, 237th, 239th, 240th, 251st, 253rd, 254th, 255th, 258th, 299th positions) were respectively subjected to saturation mutagenesis. Using pET28a-D191E / L195I as the template, amplification was performed using the primers in Table 2. The forward primers at the 34th, 140th, 141st, 142nd, 144th, 146th, 147th positions were respectively combined with the reverse primer R3 for PCR, the forward primers at the 194th, 195th, 197th, 198th, 199th, 201st, 202nd positions were respectively combined with the reverse primer R4 for PCR, and the reverse primers and the forward primer F3 at the 229th, 232nd, 233rd, 235th, 236th, 237th, 239th, 240th, 251st, 253rd, 254th, 255th, 258th, 299th positions were used for PCR. The PCR reaction system and reaction conditions were the same as those in the first-round transformation conditions.
[0096] The cultivation and expression steps of the mutants and the screening steps are the same as those in the first round of modification. Through screening, 253 beneficial mutation sites with improved enzyme activity are obtained, specifically the mutants 5-6 (D191E / L195I / E253S and D191E / L195I / E253W).
[0097] Table 2. Primer sequences for the second round of modification
[0098] Primers 5-3’ F2 CGTGAAGCAGCCAAATGGGCAGATGGTC L195I-R CATGCTGGTCCAAAAAAAATCAATCATGCTCAGCTC A34-F CGTTATTGGTCTGGGTNNKATGGGCCGTGCAC V140-F CTATCTGGATGGTGCANNKATGATTCCGACCGTGATG M141-F CTATCTGGATGGTGCAGTGNNKATTCCGACCGTGATG I142-F GGATGGTGCAGTGATGNNKCCGACCGTGATG T144-F GGTGCAGTGATGATTCCGNNKGTGATGGTGGG M146-F GTGATGATTCCGACCGTGNNKGTGGGTAGCACC V147-F GATGATTCCGACCGTGATGNNKGGTAGCACCGATG R3 CCTTCTGCACCCGGATATTCACCGGCATC M194-F GCCGTTTATGAGCTGAGCNNKATTGATTTTTTTTGGACCAGC I195-F CCGTTTATGAGCTGAGCATGNNKGATTTTTTTTGGACCAGC D196-F GCCGTTTATGAGCTGAGCATGATTNNKTTTTTTTGGACCAGC F197-F GAGCTGAGCATGATTGATNNKTTTTGGACCAGCATGAGTG F198-F GAGCTGAGCATGATTGATTTTNNKTGGACCAGCATGAGTG W199-F GCATGATTGATTTTTTTNNKACCAGCATGAGTGGTCTGG S201-F GCATGATTGATTTTTTTTGGACCNNKATGAGTGGTCTGG M202-F GATTTTTTTTGGACCAGCNNKAGTGGTCTGGTGCATGG R4 CTATCTGCACCATGACCCAGATCAACGGCGC F3 CAGGCTATCCGACCACCGTGTGGAATCGTACC H229-R CTCAGCAGGCTAATTGCTGCTTTCAGAAACGGTG L232-R CGGTAACTTCAATCAGCAGGCTCAGMNNGCTAATATGTGC L233-R CGGTAACTTCAATCAGCAGGCTMNNCAGGCTAATATGTGC L235-R CGGTAACTTCAATCAGMNNGCTCAGCAGGCTAATATGTGC L236-R CGGTAACTTCAATMNNCAGGCTCAGCAGGCTAATATGTGC I237-R GATCTTTTGCGGTAACTTCMNNCAGCAGGCTCAGCAGG V239-R GATCTTTTGCGGTMNNTTCAATCAGCAGGCTCAGCAG T240-R CCAGATCTTTTGCMNNAACTTCAATCAGCAGGCTCAGC G251-R GCCAGATTGCCTTCTGCMNNCGGATATTCACCG E253-R CATTGCCAGATTGCCMNNTGCACCCGGATATTC G254-R CCATTGCCAGATTMNNTTCTGCACCCGGATATTCAC N255-R CTTCAACTTCCATTGCCAGMNNGCCTTCTGCACC M258-R GTTCAATGCCTTCAACTTCMNNTGCCAGATTGCCTTC E259-R GTTCAATGCCTTCAACMNNCATTGCCAGATTGCCTTC
[0099] 3. Third round of stereoselective modification
[0100] Use AlphaFold to construct the structure of mutant 5 (D191E / L195I / E253S), dock the imine intermediate into it, and select 11 amino acid residues that interact with the imine (at positions 140, 141, 142, 143, 198, 199, 229, 236, 255, 258, and 259), and site-directedly mutate them into 8 amino acids with different properties: alanine (A), aspartic acid (D), phenylalanine (F), isoleucine (I), lysine (K), proline (P), threonine (T), tryptophan (W). Using pET28a-D191E / L195I / E253S as a template, amplify using the primers in Table 3. Combine the forward primers at positions 140, 141, 142, 143, 198, and 199 with the reverse primer R5 for PCR respectively, and combine the reverse primers at positions 198, 199, 229, 236, 255, 258, and 259 with the forward primer F4 for PCR respectively. The PCR reaction system and reaction conditions are the same as those in the first round of modification conditions.
[0101] The cultivation and expression steps of the mutants are the same as those in the first round of modification. Subsequently, screening is carried out by establishing a transformation reaction. The 1 mL transformation reaction system contains 100 mM ethyl 3-formylhexanoate, 10% DMSO (v / v), 200 mM (S)-2-aminobutyramide, 200 mM glucose, 0.5 g / L NADP + 、3 U / mL GDH, 50 mg whole cells, and 100 mM sodium phosphate buffer (pH 7.5). Beneficial mutation sites with improved stereoselectivity are obtained at positions 255 and 258, specifically the mutants 7-10 (D191E / L195I / E253S / M258A, D191E / L195I / E253S / M258W, D191E / L195I / E253S / M258D, D191E / L195I / E253S / M258K).
[0102] Given that the M258 site has a significant impact on stereoselectivity, all mutants at positions M2 - M258 were constructed using pET28a - D191E / L195I / E253S as a template and amplified using the primers in Table 3. The reverse primer for position 258 was combined with the forward primer F4 for PCR. Subsequently, screening was carried out through transformation reactions. Mutants 11 - 15 with improved stereoselectivity were obtained (D191E / L195I / E253S / M258E, D191E / L195I / E253S / M258N, D191E / L195I / E253S / M258Q, D191E / L195I / E253S / M258R, D191E / L195I / E253S / M258S).
[0103] Table 3. Primer sequences for the third - round modification
[0104]
[0105]
[0106]
[0107] The obtained mutants were picked into test tubes containing 4 mL of LB medium for cultivation. The expressed proteins were subjected to activity detection and 1 mL of transformation reaction (containing 100 mM ethyl 3 - formylhexanoate, 200 mM (S) - 2 - aminobutyramide, 200 mM glucose, 0.5 g / L NADP+, 3 U / mL GDH, 50 mg / mL whole cells, reacted at 25 °C for 24 hours, carried out in pH 7.5 sodium phosphate buffer). The results are shown in Table 4. Mutants 5 and 6 had the highest activity, which was 117.5 and 92.7 times higher than that of the wild - type. The stereoselectivity of mutants 7 - 19 was improved compared to mutant 5, but the activity decreased to varying degrees. Considering the yield and de value comprehensively, mutant 7 was the best choice.
[0108] Table 4. Relative activity, analytical yield, and stereoselectivity of IR141 and its mutants towards the substrate
[0109] Mutant D191 L195 E253 M258 Relative activity Analysis yield (%) DE value (%) IR104 1.0 0 -- Mutant 1 E 66.0 96 68 Mutant 2 I 26.5 4 84 Mutant 3 N 12.2 4 84 Mutant 4 E I 84.5 96 64 Mutant 5 E I S 92.7 98 84 Mutant 6 E I W 117.5 99 66 Mutant 7 E I S A 86.8 90 92 Mutant 8 E I S W 45.5 37 94 Mutant 9 E I S D 55.9 85 90 Mutant 10 E I S K 32.9 72 92 Mutant 11 E I S E 63.6 45 94 Mutant 12 E I S N 60.9 32 94 Mutant 13 E I S Q 76.8 95 88 Mutant 14 E I S R 49.1 80 92 Mutant 15 E I S S 98.0 84 93 Mutant 16 E I S G 45.5 20 96 Mutant 17 E I S C 46.1 21 94 Mutant 18 E I S V 57.3 30 94 Mutant 19 E I S L 60.5 35 82
[0110] Example 2: Whole-cell catalyzed synthesis of boceprevir using Mutant 7
[0111] Mutant 7 was induced and expressed according to the method of Example 1, and the cells were collected by centrifugation (6000 rpm) and used as a biocatalyst. The cells were resuspended in 20 mL of sodium phosphate buffer (pH 7.5, 100 mM), 100 mM ethyl 3 - formylhexanoate, 200 mM (S) - 2 - aminobutyramide, 200 mM glucose, 0.5 g / L NADP +, 3U / mL GDH, 50mg / mL whole cells, react at 25°C for 24 hours. After the reaction, adjust the pH value to above 10 with saturated sodium carbonate solution, extract the reaction solution with ethyl acetate, dry and rotary evaporate to collect the product. The enzyme product is cyclized in toluene, add 2-hydroxypyridine, react at 80°C, and purify the final product by silica gel column chromatography. de value is 92%, conversion rate is 95%, and separation yield is 80%.
[0112] Example 3: Crude enzyme solution catalyzed synthesis of boceprevir using Mutant 7
[0113] Induce the expression according to the method of Example 1 to obtain Mutant 7, centrifuge to collect the bacterial cells (6000rpm), and use the crude enzyme solution after cell disruption as the biocatalyst. Other conditions are the same as in Example 2. de value is 92%, conversion rate is 96%, and separation yield is 82%.
[0114] Example 4: Whole-cell catalyzed synthesis of boceprevir using Mutant 7
[0115] Induce the expression according to the method of Example 1 to obtain Mutant 7, centrifuge to collect the bacterial cells (6000rpm), and use the bacterial cells as the biocatalyst. The reaction system contains 100mM ethyl 3-formylhexanoate and 150mM (S)-2-aminobutyramide, and other conditions are the same as in Example 2. de value is 92%, conversion rate is 92%, and separation yield is 80%.
[0116] Example 5: Whole-cell catalyzed synthesis of boceprevir using Mutant 7
[0117] Induce the expression according to the method of Example 1 to obtain Mutant 7, centrifuge to collect the bacterial cells (6000rpm), and use the bacterial cells as the biocatalyst. The reaction system contains 50mM ethyl 3-formylhexanoate and 100mM (S)-2-aminobutyramide, and other conditions are the same as in Example 1. de value is 90%, conversion rate is 96%, and separation yield is 85%.
Claims
1. An imine reductase mutant, wherein, The mutant is selected from any one of the group consisting of the following (I)-(IV): The mutant is selected from any one of the group consisting of the following (I)-(IV): (I) Compared with the sequence shown in SEQ ID NO.1, the imine reductase mutant contains mutations at one or more positions corresponding to positions 191, 195, 253, and 258 of the sequence shown in SEQ ID NO.1; (II) A mutant having at least 98% sequence identity with the mutated sequence described in (I) and containing the mutation, but not including the mutant itself described in (I); (III) The mutant includes deletion or addition of at least one amino acid residue at the N-terminal or C-terminal part of the mutant of the sequence shown in (I), specifically, addition or deletion of 1-20 amino acids, preferably 1-15, more preferably 1-10, more preferably 1-3, and most preferably 1, and the mutant containing the mutation.
2. The imine reductase mutant according to claim 1, wherein In the mutant, the amino acid at position 191 corresponding to the sequence shown in SEQ ID NO:1 is mutated from aspartic acid (D) to glutamic acid (E); and / or In the mutant, the amino acid at position 195 corresponding to the sequence shown in SEQ ID NO:1 is mutated from leucine (L) to isoleucine (I) and glutamine (N); and / or In the mutant, the amino acid at position 253 corresponding to the sequence shown in SEQ ID NO:1 is mutated from glutamic acid (E) to serine (S), tryptophan (W), phenylalanine (F), histidine (H), and leucine (L), preferably mutated to serine (S) and tryptophan (W); and / or, In the mutant, the amino acid at position 258 corresponding to the sequence shown in SEQ ID NO:1 is mutated from methionine (M) to alanine (A), tryptophan (W), aspartic acid (D), glutamic acid (E), lysine (K), asparagine (N), glutamine (Q), arginine (R), serine (S), glycine (G), cysteine (C), valine (V), and leucine (L); More specifically, it is selected from one of the following mutants: (1) Compared with the amino acid sequence shown in SEQ ID NO:1, the aspartic acid (D) at position 191 is mutated to glutamic acid (E) (denoted as D191E, numbered as mutant 1); (2) Compared with the amino acid sequence shown in SEQ ID NO:1, the leucine (L) at position 195 is mutated to isoleucine (I) (denoted as L195I, numbered as mutant 2); (3) Compared with the amino acid sequence shown in SEQ ID NO:1, the leucine (L) at position 195 is mutated to glutamine (N) (denoted as L195N, numbered as mutant 3); (4) Compared with the amino acid sequence shown in SEQ ID NO:1, the aspartic acid (D) at position 191 is mutated to glutamic acid (E), and the leucine (L) at position 195 is mutated to isoleucine (I) (denoted as D191E / L195I, numbered as mutant 4); (5) The aspartic acid (D) at position 191 is mutated to glutamic acid (E), the leucine (L) at position 195 is mutated to isoleucine (I), and the glutamic acid (E) at position 253 is mutated to serine (S) with respect to the amino acid sequence shown in SEQ ID NO:1 (denoted as D191E / L195I / E253S, numbered as mutant 5); (6) The aspartic acid (D) at position 191 is mutated to glutamic acid (E), the leucine (L) at position 195 is mutated to isoleucine (I), and the glutamic acid (E) at position 253 is mutated to tryptophan (W) with respect to the amino acid sequence shown in SEQ ID NO:1 (denoted as D191E / L195I / E253W, numbered as mutant 6); (7) The aspartic acid (D) at position 191 is mutated to glutamic acid (E), the leucine (L) at position 195 is mutated to isoleucine (I), the glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to alanine (A) with respect to the amino acid sequence shown in SEQ ID NO:1 (denoted as D191E / L195I / E253S / M258A, numbered as mutant 7); (8) The aspartic acid (D) at position 191 is mutated to glutamic acid (E), the leucine (L) at position 195 is mutated to isoleucine (I), the glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to tryptophan (W) with respect to the amino acid sequence shown in SEQ ID NO:1 (denoted as D191E / L195I / E253S / M258W, numbered as mutant 8); (9) The aspartic acid (D) at position 191 is mutated to glutamic acid (E), the leucine (L) at position 195 is mutated to isoleucine (I), the glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to aspartic acid (D) with respect to the amino acid sequence shown in SEQ ID NO:1 (denoted as D191E / L195I / E253S / M258D, numbered as mutant 9); (10) The aspartic acid (D) at position 191 is mutated to glutamic acid (E), the leucine (L) at position 195 is mutated to isoleucine (I), the glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to lysine (K) with respect to the amino acid sequence shown in SEQ ID NO:1 (denoted as D191E / L195I / E253S / M258K, numbered as mutant 10); (11) The amino acid sequence relative to the sequence shown in SEQ ID NO:1, where aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to glutamic acid (E) (denoted as D191E / L195I / E253S / M258E, numbered as mutant 11); (12) The amino acid sequence relative to the sequence shown in SEQ ID NO:1, where aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to asparagine (N) (denoted as D191E / L195I / E253S / M258N, numbered as mutant 12); (13) The amino acid sequence relative to the sequence shown in SEQ ID NO:1, where aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to glutamine (Q) (denoted as D191E / L195I / E253S / M258Q, numbered as mutant 13); (14) The amino acid sequence relative to the sequence shown in SEQ ID NO:1, where aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to arginine (R) (denoted as D191E / L195I / E253S / M258R, numbered as mutant 14); (15) The amino acid sequence relative to the sequence shown in SEQ ID NO:1, where aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to serine (S) (denoted as D191E / L195I / E253S / M258S, numbered as mutant 15); (16) The amino acid sequence relative to the sequence shown in SEQ ID NO:1, where aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to glycine (G) (denoted as D191E / L195I / E253S / M258G, numbered as mutant 16); (17) The amino acid sequence relative to the sequence shown in SEQ ID NO:1, where aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to cysteine (C) (denoted as D191E / L195I / E253S / M258C, numbered as mutant 17); (18) The amino acid sequence relative to the sequence shown in SEQ ID NO:1, where aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to valine (V) (denoted as D191E / L195I / E253S / M258V, numbered as mutant 18); (19) The amino acid sequence relative to the sequence shown in SEQ ID NO:1, where aspartic acid (D) at position 191 is mutated to glutamic acid (E), leucine (L) at position 195 is mutated to isoleucine (I), glutamic acid (E) at position 253 is mutated to serine (S), and the amino acid at position 258 is mutated from methionine (M) to leucine (L) (denoted as D191E / L195I / E253S / M258S, numbered as mutant 19).
3. An isolated polynucleotide, characterized in that, The polynucleotide comprises a nucleotide sequence encoding an imine reductase mutant as described in any one of claims 1 to 3.
4. A nucleic acid expression cassette, characterized in that, The nucleic acid construct comprises the isolated polynucleotide as described in claim 3, optionally, the polynucleotide is operably linked to one or more regulatory sequences, and the regulatory sequence is a nucleotide sequence comprising a promoter and / or a ribosome binding site, and the regulatory sequence directs the expression of the gene of the mutant in a host cell and synthesizes the mutant enzyme.
5. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the isolated polynucleotide as described in claim 3, or the nucleic acid expression cassette as described in claim 4.
6. A recombinant genetic engineering bacterium, characterized in that, The recombinant genetically engineered bacterium comprises the imine reductase mutant as described in claim 1 or 2, the isolated polynucleotide as described in claim 3, the nucleic acid expression cassette as described in claim 4, or the recombinant expression vector as described in claim 5; Specifically, the starting bacterium of the recombinant genetically engineered bacterium is a genus of Escherichia, Erwinia, Serratia, Providencia, Enterobacteria, Salmonella, Streptomyces, Pseudomonas, Brevibacterium, Bacillus or Corynebacterium; Preferably, the starting strain of the recombinant genetically engineered bacterium is Escherichia coli, Corynebacterium glutamicum or Bacillus subtilis.
7. A cell culture comprising the recombinant genetically engineered bacterium according to claim 6.
8. A method for preparing the mutant, characterized in that, The method comprises the steps of culturing the recombinant genetically engineered bacterium according to claim 6, and then recovering the imine reductase mutant from the recombinant genetically engineered bacterium or its culture.
9. Use of the imine reductase mutant according to any one of claims 1 to 2, the isolated polynucleotide according to claim 3, the nucleic acid expression cassette according to claim 4, the recombinant expression vector according to claim 5, the recombinant genetically engineered bacterium according to claim 6, or the cell culture in the synthesis of brivaracetam; Optionally, ethyl 3-formylhexanoate and ( S )-2-aminobutanamide are used as substrates.
10. A method for synthesizing brivaracetam, the method comprising the step of synthesizing brivaracetam using the imine reductase mutant according to any one of claims 1 to 2, the isolated polynucleotide according to claim 3, the nucleic acid expression cassette according to claim 4, the recombinant expression vector according to claim 5, the recombinant genetically engineered bacterium according to claim 6, or the cell culture; The method uses the catalytic action of an imine reductase mutant to catalytically synthesize ([[]] S [[]])-2-(([[]] R [[]])-2-oxo-4-propylpyrrolidin-1-yl)butanamide, i.e., bucillamine (Formula IV) from ethyl 3-formylhexanoate (Formula I) and ([[]] S [[]])-2-aminobutanamide (Formula II); S )-2-aminobutanamide (Formula II) catalytically synthesize ([[]] S [[]])-2-(([[]] R [[]])-2-oxo-4-propylpyrrolidin-1-yl)butanamide, i.e., bucillamine (Formula IV); S )-2-(([[]] R [[]])-2-oxo-4-propylpyrrolidin-1-yl)butanamide, i.e., bucillamine (Formula IV); R )-2-oxo-4-propylpyrrolidin-1-yl)butanamide, i.e., bucillamine (Formula IV); Optionally, the method further comprises the step of purifying or isolating brivaracetam; Preferably, the concentration of the substrate is 10-200 mM, preferably 50-100 mM;( S ) The concentration of the ( )-2-aminobutyramide substrate is 1.5-2 times the molar equivalent of the former Optionally, in the step of synthesizing brivaracetam, a coenzyme regeneration system is further included, and the coenzyme regeneration system is a system composed of glucose dehydrogenase and glucose, or a system composed of formate dehydrogenase and formate; optionally, the coenzyme regeneration system further includes the coenzyme of glucose dehydrogenase or formate dehydrogenase to promote the stability of the coenzyme regeneration system reaction; Specifically, the pH of the reaction system is 5.0 to 10.0, preferably 7.0 to 8.5, more preferably 7.5; the reaction temperature is 20°C to 40°C, preferably 25°C; the reaction time can be selected to be more than 2 h, preferably 4 to 30 h, further preferably 24 h; Optionally, the imine reductase mutant can participate in the reaction in the form of pure enzyme, crude enzyme solution, host cell expressing it, cell lysate of the host cell expressing it, or fermentation broth containing the host cell expressing it; specifically, the host cell can be collected by centrifugation or filtration for host cell-catalyzed conversion, or participate in the reaction in the form of whole cell or crude enzyme solution; Specifically, ethyl 3-formylhexanoate and ([[]] S [[]])-2-aminobutanamide are used as substrates: the concentration of ethyl 3-formylhexanoate is 10 - 200 mM, preferably 50 - 100 mM. S )-2-aminobutanamide are used as substrates: the concentration of ethyl 3-formylhexanoate is 10 - 200 mM, preferably 50 - 100 mM.
Citation Information
Patent Citations
Process for preparing brivaracetam
WO2017076738A1
Cited By
Imine reductase mutant as well as preparation method and application thereof
CN121555444A
An imine reductase mutant, its preparation method and uses
CN121555444B
Application of imine reductase or mutant thereof in synthesis of chiral piperidylamine intermediate compound
CN122256282A