A gene expression enhancement technology based on 3'UTR functional element reprogramming

By reconstructing the translation regulatory elements Omega, 6MΔT and N50-high in the 3'UTR region, the problem of limited expression efficiency of exogenous genes in the prior art was solved, and the expression of exogenous gene proteins in plants was achieved. The innovative path of functional reprogramming of 3'UTR elements was demonstrated, and it is suitable for a variety of plant species.

CN120192970BActive Publication Date: 2025-08-15WUHAN BIORUN BIO TECH
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510675802.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2025-08-15
Estimated Expiration
2045-05-23

AI Technical Summary

Technical Problem

In the prior art, the regulatory potential of 3'UTR has not been fully tapped, resulting in limited expression efficiency of exogenous genes in plants, especially at the translation level. The existing patented technology mainly focuses on the optimization design of 5'UTR.

Method used

Translation regulatory elements Omega, 6MΔT and N50-high were reconstructed in the 3'UTR region of the target gene, a dual luciferase reporter vector was constructed, and plant protoplasts were transformed by PEG method to extract the target protein.

Benefits of technology

It significantly improves the protein expression level of exogenous genes in plants, and this effect is independent of transcriptional level regulation, simplifies the operation process without the need for complex promoters and 5'UTR modification, and demonstrates an innovative path for functional reprogramming of 3'UTR elements, suitable for a variety of plant species.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192970B_ABST
    Figure CN120192970B_ABST
Patent Text Reader

Abstract

This invention relates to the fields of molecular biology and plant genetic engineering, and proposes a gene expression enhancement technology based on reprogramming 3'UTR functional elements. The technology comprises the following steps: S1, reconstructing translational regulatory elements within the 3'UTR region of a target gene to construct a dual-luciferase reporter vector; S2, using the dual-luciferase reporter vector plasmid as plasmid DNA, transforming plant protoplasts using the PEG method, and subsequently extracting the target protein. This invention repositions translational regulatory elements (Omega, 6MΔT, and N50‑high) within the 3'UTR region of a target gene, significantly enhancing protein expression levels of exogenous genes in plants. This effect is independent of transcriptional regulation, revealing an innovative approach to functional reprogramming of 3'UTR elements and providing a novel solution to addressing the bottleneck of translation efficiency in existing technologies.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology and plant genetic engineering, and in particular to a gene expression enhancement technology based on 3'UTR functional element reprogramming. Background Art

[0002] In plant genetic engineering, the efficient expression of exogenous genes is a key factor in determining the success of crop trait improvement and recombinant protein production. Current technological development focuses primarily on promoter optimization (e.g., strong constitutive or inducible promoters) and the optimal design of 5' UTRs (e.g., ribosome binding sites), while the regulatory potential of 3' UTRs has remained largely unexplored. Research has shown that 3' UTRs exert crucial influences on gene expression at the post-transcriptional level by regulating mRNA stability (e.g., polyA signal sequences mediate nuclease resistance), ribosome dissociation and recycling efficiency (e.g., structural motifs influencing ribosome release after translation termination), and interaction networks with RNA-binding proteins (RBPs) (e.g., microRNA target sites mediate translational repression). For example, polyA signal sequences enhance persistent expression by extending mRNA half-life, while AU-rich elements may accelerate mRNA metabolic clearance by recruiting degradation complexes.

[0003] Although existing patents (such as CN117230062A) have disclosed the translation-enhancing functions of various 5'UTR sequences, engineering regulatory strategies for 3'UTRs remains a significant technological gap. Omega sequences, as classic translation-enhancing elements, have previously been limited to applications in the 5'UTR region, where their sequence characteristics are believed to function by optimizing translation initiation efficiency. However, the functional mechanisms of omega sequences in 3'UTRs and their potential to regulate gene expression have never been systematically investigated. Summary of the Invention

[0004] In view of this, the present invention proposes a gene expression enhancement technology based on 3'UTR functional element reprogramming. By reconstructing translation regulatory elements (Omega, 6MΔT and N50-high) in the 3'UTR region of the target gene, the expression level of exogenous genes in plants can be efficiently improved.

[0005] The technical solution of the present invention is achieved as follows: The present invention provides a gene expression enhancement technology based on 3'UTR functional element reprogramming, comprising the following steps:

[0006] S1, reconstruct the translational regulatory element into the 3'UTR region of the target gene and construct a dual-luciferase reporter vector;

[0007] S2, using the dual-luciferase reporter vector plasmid as plasmid DNA, the plant protoplasts were transformed by the PEG method, and then the target protein was extracted.

[0008] Based on the above technical solution, preferably, in step S1, the translation regulatory element is one of Omega, 6MΔT and N50-high.

[0009] On the basis of the above technical solution, preferably, the nucleotide sequence of Omega is as shown in SEQ ID NO.1.

[0010] Based on the above technical solution, preferably, the nucleotide sequence of 6MΔT is shown as SEQ ID NO.2.

[0011] Based on the above technical solution, preferably, the nucleotide sequence of N50-high is shown as SEQ ID NO.3.

[0012] On the basis of the above technical solution, preferably, in step S1, the target gene is an exogenously introduced transgene or an endogenous gene, and its expression product is a protein, a non-coding RNA or a virus resistance element.

[0013] Based on the above technical solution, preferably, in step S2, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0014] The gene expression enhancement technology based on 3'UTR functional element reprogramming of the present invention has the following beneficial effects compared with the prior art:

[0015] (1) This invention has demonstrated through groundbreaking experiments that repositioning translation regulatory elements (Omega, 6MΔT, and N50-high) to the 3'UTR region of the target gene significantly improves the protein expression level of the exogenous gene in plants. This effect is independent of transcriptional regulation, revealing an innovative path for functional reprogramming of 3'UTR elements and providing a new solution to the bottleneck of translation efficiency in existing technologies.

[0016] (2) The target gene of the present invention containing the 3'UTR of the Omega sequence has a higher expression level than that of the general 3'UTR sequence.

[0017] (3) The present invention is easy to operate and does not require complex promoter and 5'UTR sequence modification. It only requires inserting Omega and other sequences into the 3'UTR region of the target gene.

[0018] (4) The mechanism of action of the present invention is that Omega and other sequences form specific secondary structures, reduce the degradation effect of nucleases, prolong the half-life of mRNA, and thus enhance the stability of mRNA to achieve the purpose of encoding more proteins. Since Omega and other translation regulatory elements located in the 5'UTR have the ability to enhance the expression of target genes in different plant species, the present invention also tested the regulatory effects of Omega and other sequences located in the 3'UTR in different plants (such as Arabidopsis, tobacco, and rice). The results showed that Omega and other sequences located in the 3'UTR showed stable regulatory effects in Arabidopsis, tobacco, and rice species, indicating that they have wide applicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 The structure of the dual-luciferase vector containing the regulatory elements omega, 6MΔT, and N50-high inserted into the 3'UTR;

[0021] Figure 2 The 3'UTR containing each regulatory element improves the expression of the target gene in Arabidopsis protoplasts;

[0022] Figure 3 Figure 3 shows how the 3'UTR containing various regulatory elements improves the expression of target genes in tobacco protoplasts;

[0023] Figure 4 Diagram showing how 3'UTR containing various regulatory elements improves target gene expression in rice protoplasts. DETAILED DESCRIPTION

[0024] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0025] The following is a specific embodiment of the present invention, including experimental design, materials and methods.

[0026] Example 1 Vector construction and function verification

[0027] 1. Carrier Design

[0028] like Figure 1 As shown in Figure 2, a dual-luciferase reporter vector was constructed, named pSYB-Dual-LUC01-TBF1, which contains Ubiquitin promoter-driven FLUC (Firefly luciferase) and 35S promoter-driven RLUC (Renilla luciferase).

[0029] Construction of experimental group vectors: Omega, 6MΔT and N50-high sequences were inserted into the 3'UTR region of the FLUC gene of the pSYB-Dual-LUC01-TBF1 vector, and the constructed vectors were named pSYB23-omega (3'UTR), pSYB24-6MΔT (3'UTR) and pSYB25-N50-high (3'UTR), respectively (as shown in Figure 2). Figure 1 shown).

[0030] The nucleotide sequences of Omega, 6MΔT and N50-high are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0031] SEQ ID NO. 1: GCCGGTCTAGAGTATTTTTACAACAATTACCAACAACAA CAAACAACAAACAACATTACAATTACTATTTACAATT.

[0032] SEQ ID NO. 2: ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAA CTTTCGATCTCTTGTAGATCTGTCTCAAACGAACTAAATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCC.

[0033] SEQ ID NO. 3: CGGGCAGCCTAACTACGGGTACACCCGAAGCTCAAAC AATAGGCACACAT.

[0034] The nucleotide sequences of pSYB-Dual-LUC01-TBF1, pSYB23-omega (3'UTR), pSYB24-6MΔT (3'UTR), and pSYB25-N50-high (3'UTR) are SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, and SEQ ID NO. 7, respectively.

[0035] The specific steps for constructing the pSYB23-omega (3'UTR) vector are as follows:

[0036] (1) PCR amplification of Omega sequence

[0037] PCR reaction system: Nuclease-free water 20μL, Biorun Pfu PCR Mix 25μL, E22557_0S1(+)(10 μM) 2μL, E22557_0S1(-)(10 μM) 2μL, template 1μL, total volume 50μL.

[0038] Primers for amplifying Omega sequences:

[0039] E22557_0S1(+): TAATTCTAGAGCGGCCGCGGATCCGCCGGTCTAGAGT ATTTTTACAAC;

[0040] E22557_0S1(-): GTGATTTCAGCGAATTCACTAGTAATTGTAAATAGTAATTGTAATGTTGTTTGTTG.

[0041] PCR reaction conditions: 94°C for 3 min; 94°C for 30 sec, 50°C for 30 sec, 72°C for 10 sec, 30 cycles; 72°C for 5 min, 16°C for 30 min.

[0042] Separation was performed on a 1.5% agarose gel at 5 V / cm for 20 minutes. After confirmation by UV imaging, the target band, Omega (76 bp), was excised and purified by gel extraction. DNA was purified using a column-based gel extraction kit and eluted with 40 μL of sterile deionized water to obtain the recovered product (labeled rDNA01). After verification of fragment integrity by 1% agarose gel electrophoresis and a qualified Nanodrop nucleic acid concentration test, the purified DNA fragment was then subjected to in vitro recombination and ligation with a restriction endonuclease-treated linearized vector.

[0043] (2) Enzyme digestion of vector

[0044] Enzyme digestion system: Nuclease-free Water 12μL, 10*Buffer 2μL, BamH I 1 μL, Spe I 1μL, pSYB-Dual-LUC01-TBF1 4μL, Total 20μL.

[0045] Enzyme digestion conditions: 37°C for 1 h.

[0046] The vector enzyme digest was purified using a PCR purification kit (the purified product was labeled Vector(D)1) and used for the next recombination reaction.

[0047] Recombination reaction

[0048] Recombination reaction system: Nuclease-free Water 10μL, Biorun 2*EasyClone Mix 10μL, rDNA01 5μL, Vector(D)1 5μL, Total 20μL.

[0049] Reconstitution conditions: 37°C for 30 min.

[0050] Transform the ligation product into competent cells. The specific steps are as follows:

[0051] In an ice bath, add 50 μL DH5α Add 5 μL of the ligation product to the pre-chilled competent cell suspension, mix gently, and incubate on ice for 30 minutes. Heat shock the cell in a 42°C water bath for 90 seconds, then immediately incubate on ice for 2 minutes to terminate the reaction. Add 500 μL of sterile LB medium (without antibiotics) and incubate at 37°C with shaking for 1 hour. Spread 100 μL of the bacterial suspension evenly onto a Kan-resistant plate (50 μg / mL) and incubate inverted at 37°C for 12-16 hours. Identify positive single colonies for subsequent experiments.

[0052] The specific steps for constructing the pSYB24-6MΔT (3'UTR) vector are as follows:

[0053] (1) PCR amplification of 6MΔT sequence

[0054] The amounts of each component in the PCR reaction system were the same as those in the pSYB23-omega (3'UTR) vector.

[0055] Primers for amplifying 6MΔT sequences:

[0056] E22558_0S1(+):TAATTCTAGAGCGGCCGCGGATCCATTAAAGGTTTATACCTTCCCAGGT;

[0057] E22558_0S1(-):GTGATTTCAGCGAATTCACTAGTGGCTAAAATTAAAGTTCCAAACAGA.

[0058] The reaction conditions were the same as those for the pSYB23-omega (3'UTR) vector.

[0059] Separation was performed on a 1.5% agarose gel at 5 V / cm for 20 minutes. After confirmation by UV imaging, the target band, 6MΔT (117 bp), was excised and purified by gel extraction. DNA was purified using a column-based gel extraction kit and eluted with 40 μL of sterile deionized water to obtain the recovered product (labeled rDNA02). After verification of fragment integrity by 1% agarose gel electrophoresis and a qualified Nanodrop nucleic acid concentration test, the purified DNA fragment was then subjected to in vitro recombination and ligation with a restriction endonuclease-treated linearized vector.

[0060] (2) Enzyme digestion of vector

[0061] The enzyme digestion system was the same as that of the pSYB23-omega (3'UTR) vector.

[0062] Enzyme digestion conditions: 37°C for 1 h.

[0063] The vector enzyme digest was purified using a PCR purification kit (the purified product was labeled Vector(D)2) and used for the next recombination reaction.

[0064] Recombination reaction

[0065] The specific steps of the recombination reaction are the same as those for constructing the pSYB23-omega (3'UTR) vector.

[0066] The specific steps for constructing the pSYB25-N50-high (3'UTR) vector are as follows:

[0067] (1) PCR amplification of N50-high sequences

[0068] The volumes of each component in the PCR reaction system were the same as those of the pSYB23-omega (3'UTR) vector.

[0069] Primers for amplifying N50-high sequences:

[0070] E22559_0S1(+):TTCTAGAGCGGCCGCGGATCCGGGCAGCCTAACTACGGG;

[0071] E22559_0S1(-):GTGATTTCAGCGAATTCACTAGTATGTGGTGCCTATTGTTTGAGCTTC.

[0072] The PCR reaction conditions were the same as those for the pSYB23-omega (3'UTR) vector.

[0073] Separation was performed on a 1.5% agarose gel at 5 V / cm for 20 minutes. After confirmation by UV imaging, the target band N50-high (50 bp) was excised and purified by gel extraction. DNA was purified using a column-based gel extraction kit and eluted with 40 μL of sterile deionized water to obtain the recovered product (labeled rDNA03). After verification of fragment integrity by 1% agarose gel electrophoresis and a qualified Nanodrop nucleic acid concentration test, the purified DNA fragment was then subjected to in vitro recombination and ligation with a restriction endonuclease-treated linearized vector.

[0074] (2) Enzyme digestion of vector

[0075] The enzyme digestion system was the same as that of the pSYB23-omega (3'UTR) vector.

[0076] Enzyme digestion conditions: 37°C for 1 h.

[0077] The vector enzyme digest was purified using a PCR purification kit (the purified product was labeled Vector(D)3) and used for the next recombination reaction.

[0078] Recombination reaction

[0079] The specific steps of the recombination reaction are the same as those for constructing the pSYB23-omega (3'UTR) vector.

[0080] 2. Preparation of Arabidopsis Protoplasts

[0081] 1. Preparation: Select 3-4 week-old Arabidopsis plants and cut the leaves longitudinally along the main vein into 0.5-1 mm wide strips using a sterile scalpel. Rapidly immerse the strips in pre-chilled combined enzymatic hydrolysis solution (containing 1.5% Cellulase R10 and 0.4% Mechanase R10) at a ratio of 1.5 g fresh leaf weight per 10 mL of enzymatic hydrolysis solution.

[0082] Enzyme hydrolysate components: Cellulase R10 1.5%, Macerozyme R10 0.4%, Mannitol 0.4 M, KCL 20 mM, MES (pH 5.7) 10 mM.

[0083] Adjust the pH of the enzymatic hydrolysate to 5.8, heat at 55°C for 10 minutes, invert three times to mix, and cool to room temperature before adding the following solutions: CaCl2 (final concentration 10 mM) and BSA (Sigma A-6793) (final concentration 0.1%). Add ddH2O to 10 mL, filter sterilize through a 0.22 μm filter, and use immediately.

[0084] Enzymatic treatment

[0085] Vacuum infiltration: Place the sample in a vacuum desiccator and apply a pressure of -0.08 MPa for 30 min to promote enzyme penetration.

[0086] Constant temperature digestion: transfer to a 26°C constant temperature shaker, 60 rpm and digest in the dark for 3-4 h. Monitor the protoplast release rate by inverted microscope to ensure it reaches more than 80%.

[0087] 3. Protoplast Purification

[0088] 1. Termination of the reaction: Add an equal volume of W5 stop buffer to the enzymatic system and manually shake horizontally (amplitude 5 cm, frequency 2 Hz) for 10 s to terminate enzyme activity.

[0089] W5 solution components: NaCl 154 mM, CaCl2 125 mM, KCl 2 mM, MES 2 mM.

[0090] Adjust the pH of the W5 solution to 5.7-5.8, and finally add ddH2O to 100 mL. Sterilize the solution by suction filtering with a 0.22 μm filter membrane and store at 4°C.

[0091] Filtration collection: Filter through a 75 μm nylon mesh into a 50 mL conical centrifuge tube and add 10 mL of W5 buffer to rinse the remaining tissue.

[0092] Gradient purification

[0093] Primary centrifugation: 100 × g horizontal centrifugation for 3 min to collect protoplasts;

[0094] Cold shock treatment: resuspend the pellet in 5 mL of W5 buffer and place on ice for 30 min;

[0095] Second centrifugation: Centrifuge under the same conditions and replace with MMG suspension (final volume ≈ 2×10 5 cells / mL).

[0096] MMG solution components: Mannitol 0.4 M, MgCl2·6H2O 15 mM, MES 4 mM.

[0097] Adjust the pH of the MMG solution to 5.7-5.8, and finally add ddH2O to 10 mL. Sterilize the solution by suction filtering with a 0.22 μm filter membrane and store at 4°C.

[0098] IV. Transient Transformation of Arabidopsis Protoplasts

[0099] 1. Protoplast Cell Processing

[0100] After standing on ice for 30 min, discard the W5 solution (the cells have settled naturally, so centrifugation is not necessary).

[0101] Add 100 μL of MMG solution to each sample and adjust the cell density under a microscope (add MMG if it is too high) to ensure that the cells are round.

[0102] PEG transfection

[0103] Mix the pre-cooled (4°C) protoplast suspension with PEG 4000 solution in the following ratio: 100 μL cells + 110 μL PEG 4000. Slowly add PEG to the inner wall of the tube cap, invert to mix, and incubate in a 23°C water bath for 15 min.

[0104] PEG4000 (40% v / v): PEG4000 (40%) 2 g, Mannitol (0.2 M) 1.25 mL, CaCl2 (100 mM) 500 μL, and make up to 5 mL with H2O.

[0105] Termination and washing

[0106] Add 1 mL of W5 solution and mix gently. Centrifuge at 300 rpm at 4°C for 2 min and discard the supernatant. Repeat the washing process 2-3 times.

[0107] Protoplast culture and detection

[0108] Place the culture system in a 23°C constant temperature and illumination incubator (light intensity 80 μmol·m⁻²·s⁻¹, humidity 60%) for 16–18 hours. Disrupt the cells and extract total protein. Analyze the enzyme activities of FLUC and RLUC using a microplate reader.

[0109] 5. Results Analysis

[0110] like Figure 2 As shown, the FLUC / RLUC enzyme activities of the three experimental groups expressing pSYB23-omega (3'UTR), pSYB24-6MΔT (3'UTR) and pSYB25-N50-high (3'UTR) in Arabidopsis protoplasts were significantly improved compared with the control group pSYB-Dual-LUC01-TBF1.

[0111] The results showed that the three regulatory elements located in the 3'UTR, Omega, 6MΔT and N50-high, could significantly increase the expression level of the target protein.

[0112] Example 2 Verification of multi-plant system

[0113] Referring to Example 1, the above experiment was repeated in tobacco protoplasts and rice protoplasts. The results showed that the three regulatory elements located in the 3'UTR, Omega, 6MΔT and N50-high, could all increase the expression level of the target protein ( Figure 3 and Figure 4 ).

[0114] The results confirmed that the three regulatory elements located in the 3'UTR, Omega, 6MΔT and N50-high, were species-universal in increasing the expression of target genes.

[0115] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for enhancing gene expression based on reprogramming of 3'UTR functional elements, characterized by: The following steps are involved: S1, reconstruct the translational regulatory element into the 3'UTR region of the target gene and construct a dual-luciferase reporter vector; The translation regulatory element is 6MΔT; S2, using the dual-luciferase reporter vector plasmid as plasmid DNA, the plant protoplasts were transformed by the PEG method, and the target protein was subsequently extracted; The nucleotide sequence of 6MΔT is shown in SEQ ID NO.

2.

2. A method for enhancing gene expression based on 3'UTR functional element reprogramming according to claim 1, characterized in that: In step S1, the target gene is an exogenously introduced transgene or an endogenous gene, and its expression product is a protein or a non-coding RNA.

3. The method for enhancing gene expression based on 3'UTR functional element reprogramming according to claim 1, characterized in that: In step S2, the plant is a monocotyledonous plant or a dicotyledonous plant.

Citation Information

Patent Citations

  • Artificial optimization design 5UTR sequence for improving translation expression of exogenous gene

    CN117230062A

  • 5 '-UTR sequence derivative based on SARS-CoV-2 and application of 5'-UTR sequence derivative in enhancement of plant gene translation expression

    CN119286861A

  • The invention relates to 5apos; uTR (Untranslated Region) element and application thereof in improving expression quantity of target gene of plant

    CN119709749A