Method and kit for detecting helicobacter pylori gene mutation in excrement

Abstract

The invention relates to the technical field of pathogenic bacterium detection, in particular to a method and a kit for detecting helicobacter pylori gene mutation in excrement. According to the technical scheme, the kit for detecting helicobacter pylori gene mutation in excrement is developed by combining multiple advanced technical means such as ARMS-PCR design, blocking primers, locked nucleic acid modification (peptide nucleic acid modification), MGB probes, nested PCR design and degenerate base design. The kit can detect nine gene mutation sites related to the drug resistance of helicobacter pylori at one time, and has a wide coverage range. The kit in the scheme can be used for detecting the drug resistance of quinolone antibiotics and / or clarithromycin antibiotics of helicobacter pylori, and the technical problem that a high-specificity and high-sensitivity excrement helicobacter pylori gene mutation detection method is lacked in the prior art is solved. The method is simple and convenient to operate and can be completed within 1-2 hours, the detection cost is reduced, and the method has ideal application and popularization prospects.

Description

Technical Field

[0001] The present invention relates to the technical field of pathogenic bacteria detection, and particularly relates to a method and a kit for detecting Helicobacter pylori gene mutations in feces. Background Art

[0002] Helicobacter pylori (HP) is a microaerophilic Gram-negative bacterium, mainly colonized in the stomach and duodenum, and is closely related to various gastrointestinal diseases such as gastritis, peptic ulcer and gastric cancer. Helicobacter pylori infection is an infectious disease. Worldwide, its infection rate is as high as over 50%. The main transmission routes of HP infection include oral-oral transmission, fecal-oral transmission, and through contaminated food and water. As early as 1994, the International Agency for Research on Cancer classified Helicobacter pylori as a Class I carcinogen. Therefore, eradicating HP treatment can reduce the transmission of the bacterium, prevent infected individuals from developing into chronic gastritis, can treat peptic ulcers and prevent recurrence, and reduce the risk and burden of gastric cancer and other related diseases. The international general choice for the radical treatment of HP is triple therapy (proton pump inhibitor (PPI) + clarithromycin + metronidazole or amoxicillin) or quadruple therapy (bismuth agent + PPI + 2 antibiotics). However, with the long-term use of antibiotics, the drug resistance rate of HP increases year by year, and the eradication rate decreases year by year. Therefore, in order to increase the eradication rate of HP and at the same time reduce the abuse of antibiotics, it is necessary to understand the drug resistance of Helicobacter pylori in an individual before formulating an individualized drug treatment plan for eradicating Helicobacter pylori, so as to select sensitive antibiotics for treatment and improve the eradication rate. Therefore, the drug resistance detection of Helicobacter pylori helps doctors correctly select drug therapies, improve treatment effects, avoid the abuse of antibiotics, and is of great significance for guiding clinical medication.

[0003] Currently, the main detection methods for Helicobacter pylori drug resistance include: drug sensitivity detection method, direct sequencing method (Sanger sequencing technology, pyrosequencing technology, high-throughput NGS sequencing technology), fluorescence PCR method, etc. However, these detection methods all use gastric mucosa tissue as a sample for high drug resistance detection. This patent uses feces as a sample for HP high drug resistance detection, which has the advantages of non-invasive, convenient sampling, easy operation and good patient compliance.

[0004] Currently, there are common problems in the detection methods of Helicobacter pylori (HP) gene mutations in feces, such as poor specificity and low sensitivity. Especially, the flora in feces is numerous and complex, which requires extremely high specificity for the primers and probes used in the detection. At the same time, feces contain various inhibitors such as humic acid, bilirubin, fecal polysaccharides, and hemoglobin. Chinese Patent CN117701746A discloses an isothermal multiplex Helicobacter pylori genotyping nucleic acid detection primer set, including a primer set for detecting VacA, a primer set for detecting CagA, and a primer set for detecting the internal standard β-actin. This patent mainly uses the method of isothermal amplification for Helicobacter pylori genotyping detection, and its detection sample is still mainly gastric mucosa samples. Although it can perform genotyping detection on HP, it cannot detect highly drug-resistant genes. Chinese Patent CN118667985A discloses a primer-probe composition, kit, and application for detecting Helicobacter pylori HtrA genotyping based on fluorescence quantitative PCR method. This patent mainly uses ARMS-PCR to amplify the sample, but the number of mutation sites detected each time by this method is limited, and it cannot detect all the above sites simultaneously at one time. The detection throughput is low, the time consumption is long, and the coverage range is small, which limits its application. Chinese Patent CN116970722A discloses a method, primer-probe composition, application, and kit for simultaneously identifying Helicobacter pylori infection and detecting drug-resistant gene mutation sites. This patent mainly uses ARMS-PCR combined with blocker primers to distinguish single-base mutated genes, but the discrimination ability of this method is limited, and it cannot detect and distinguish single-base mutations at lower concentrations. At the same time, for the detection of mutated genes in complex samples (such as fecal samples), its sensitivity and specificity are both low.

[0005] Based on this, there is an urgent need to develop a new type of fecal HP gene mutation detection method and kit with improved specificity and sensitivity to meet the needs of clinical applications. Summary of the Invention

[0006] The purpose of the present invention is to provide a kit for detecting Helicobacter pylori gene mutations in feces to solve the technical problem of the lack of a fecal HP gene mutation detection method with high specificity and sensitivity in the prior art.

[0007] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0008] A kit for detecting Helicobacter pylori gene mutations in feces, comprising a gyrA gene detection component and a 23S rRNA gene detection component; both the gyrA gene detection component and the 23S rRNA gene detection component include an upstream primer, a downstream primer, a probe, a blocker primer, an upstream nested primer, and a downstream nested primer;

[0009] The upstream primer is used to cover the base mutation sites of the gyrA gene or the 23S rRNA gene; the blocking primer is used to cover the base mutation sites of the gyrA gene or the 23S rRNA gene, the blocking primer contains locked nucleic acid modification or peptide nucleic acid modification, and the 3'-end of the blocking primer is modified with amino group or phosphorylated modification; a fluorescence modification group is connected to the 5'-end of the probe.

[0010] Further, the gyrA gene detection component is used to detect six types of mutations: A260T, C261G, T261A, G271A, G271T, and A272G; the 23S rRNA gene detection component is used to detect three types of mutations: A2142C, A2142G, A2143G;

[0011] The fluorescence modification group connected to the 5'-end of the probe includes any one of FAM, HEX, VIC, ROX, CY3, and CY5; the 3'-end of the probe is modified with MGB.

[0012] Further, for the gyrA gene detection component:

[0013] The upstream primer includes nucleotide fragments with sequences as shown in SEQ ID NO.25 - SEQ ID NO.30;

[0014] The downstream primer includes one of the nucleotide fragments with sequences as shown in SEQ ID NO.32 - SEQ ID NO.35;

[0015] The sequence of the probe is as shown in SEQ ID NO.31;

[0016] The sequence of the blocking primer is: CGCA L T L CATAAACCGC L G L TTAT, and the 3'-end is phosphorylated modified;

[0017] Or CGCA L T L CATAAACCGC L G L TTAT, and the 3'-end is amino modified;

[0018] Or GCGC P A P TCATAAACCGC P G P TT, and the 3'-end is phosphorylated modified;

[0019] Wherein, L represents that the deoxyribose corresponding to the right base is locked nucleic acid modified, and P represents that the right base is connected with peptide nucleic acid;

[0020] The upstream nested primer includes one of the nucleotide fragments shown in SEQ ID NO.39 - SEQ ID NO.41; wherein, the deoxyribose corresponding to the 3rd base T and the 25th base A of SEQ ID NO.39 is locked nucleic acid modified;

[0021] The downstream nested primer includes one of the nucleotide fragments shown in SEQ ID NO.42 - SEQ ID NO.44; wherein, the deoxyribose corresponding to the 3rd base G and the 24th base T of SEQ ID NO.43 is locked nucleic acid modified.

[0022] Furthermore, for the upstream primer of the 23S rRNA gene detection component:

[0023] The upstream primer includes nucleotide fragments with sequences as shown in SEQ ID NO.45 - SEQ ID NO.47;

[0024] The downstream primer includes one of the nucleotide fragments with sequences as shown in SEQ ID NO.51 - SEQ ID NO.54;

[0025] The probe includes one of the nucleotide fragments with sequences as shown in SEQ ID NO.48 - SEQ ID NO.50;

[0026] The sequence of the blocking primer is: AAGACGG L A L AAGACCCCGTGG, and the 3'-end is phosphorylated modified;

[0027] Or AAGACGG P A P AAGACCCCGT, and the 3'-end is amino modified;

[0028] Or AAGACGG L A L AAGACCCCGT, and the 3'-end is phosphorylated modified;

[0029] Wherein, L represents that the deoxyribose corresponding to the right base is locked nucleic acid modified, and P represents that the right base is linked to peptide nucleic acid;

[0030] The upstream nested primer includes one of the nucleotide fragments shown in SEQ ID NO.55, SEQ ID NO.56; wherein, the deoxyribose corresponding to the 1st base C and the 20th base T of SEQ ID NO.55 is locked nucleic acid modified; the deoxyribose corresponding to the 4th base C of SEQ ID NO.56 is locked nucleic acid modified;

[0031] The downstream nested primer includes one of the nucleotide fragments shown in SEQ ID NO.57 and SEQ ID NO.58; wherein, the deoxyribose corresponding to the 20th base C of SEQ ID NO.57 is locked nucleic acid modified; the deoxyribose corresponding to the 18th base A of SEQ ID NO.58 is locked nucleic acid modified.

[0032] Furthermore, a kit for detecting Helicobacter pylori gene mutations in feces further includes a human housekeeping gene detection component;

[0033] The human housekeeping gene detection component includes upstream primers, downstream primers and probes for detecting the GAPDH gene, β-actin gene or β-globin gene;

[0034] The upstream primer sequence for detecting the GAPDH gene is as shown in SEQ ID NO.1, the downstream primer sequence for detecting the GAPDH gene is as shown in SEQ ID NO.2, and the probe sequence for detecting the GAPDH gene is as shown in SEQ ID NO.3;

[0035] The upstream primer sequence for detecting the β-actin gene is as shown in SEQ ID NO.4, the downstream primer sequence for detecting the β-actin gene is as shown in SEQ ID NO.5, and the probe sequence for detecting the β-actin gene is as shown in SEQ ID NO.6;

[0036] The upstream primer sequence for detecting the β-globin gene is as shown in SEQ ID NO.7, the downstream primer sequence for detecting the β-globin gene is as shown in SEQ ID NO.8, and the probe sequence for detecting the β-globin gene is as shown in SEQ ID NO.9;

[0037] The 5' end of the probe for detecting the GAPDH gene, β-actin gene or β-globin gene is linked with a fluorescent modification group, and the 3' end is linked with a BHQ2 group; the fluorescent modification group linked to the 5' end of the probe includes any one of FAM, HEX, VIC, ROX, CY3, CY5.

[0038] Furthermore, a kit for detecting Helicobacter pylori gene mutations in feces further includes a Helicobacter pylori internal standard gene detection component;

[0039] The Helicobacter pylori internal standard gene detection component includes upstream primers, downstream primers and probes for detecting the UreA, UreB, cagA, VacA or cagW gene;

[0040] The upstream primer sequence for detecting the UreA gene is shown as SEQ ID NO.10, the downstream primer sequence for detecting the UreA gene is shown as SEQ ID NO.11, and the probe sequence for detecting the UreA gene is shown as SEQ ID NO.12;

[0041] The upstream primer sequence for detecting the UreB gene is shown as SEQ ID NO.13, the downstream primer sequence for detecting the UreB gene is shown as SEQ ID NO.14, and the probe sequence for detecting the UreB gene is shown as SEQ ID NO.15;

[0042] The upstream primer sequence for detecting the cagA gene is shown as SEQ ID NO.16, the downstream primer sequence for detecting the β-globin gene is shown as SEQ ID NO.17, and the probe sequence for detecting the β-globin gene is shown as SEQ ID NO.18;

[0043] The upstream primer sequence for detecting the VacA gene is shown as SEQ ID NO.19, the downstream primer sequence for detecting the VacA gene is shown as SEQ ID NO.20, and the probe sequence for detecting the VacA gene is shown as SEQ ID NO.21;

[0044] The upstream primer sequence for detecting the cagW gene is shown as SEQ ID NO.22, the downstream primer sequence for detecting the cagW gene is shown as SEQ ID NO.21, and the probe sequence for detecting the cagW gene is shown as SEQ ID NO.23;

[0045] The 5'-end of the probe for detecting the UreA, UreB, cagA, VacA or cagW gene is linked with a fluorescent modification group, and the 3'-end is linked with an MGB group; the fluorescent modification group linked to the 5'-end of the probe includes any one of FAM, HEX, VIC, ROX, CY3, CY5.

[0046] Furthermore, a kit for detecting Helicobacter pylori gene mutations in feces further includes PCR reagent components; the PCR reagent components include dNTP, DNA polymerase, UNG enzyme and buffer.

[0047] Furthermore, a kit for detecting Helicobacter pylori gene mutations in feces contains the components shown in the following table:

[0048]

[0049]

[0050] Among them, the concentrations of the upstream primer, downstream primer, probe, blocking primer, upstream nested primer, and downstream nested primer are all 50 μM.

[0051] Furthermore, a kit for detecting Helicobacter pylori gene mutations in feces has its working procedures shown in the following table:

[0052]

[0053] Preferably, the temperatures of the pre-denaturation, first-round denaturation, first-round annealing, first-round extension, second-round denaturation, second-round annealing, second-round extension, and cooling steps are respectively: 95°C, 95°C, 68°C, 72°C, 95°C, 58°C, 72°C, 25°C;

[0054] Preferably, the times of the pre-denaturation, first-round denaturation, first-round annealing, first-round extension, second-round denaturation, second-round annealing, second-round extension, and cooling steps are respectively: 5 min, 10 s, 30 s, 10 s, 30 s, 30 s, 10 s, 5 min; Preferably, the number of cycles of the first-round denaturation, first-round annealing, and first-round extension is 5 times; the number of cycles of the second-round denaturation, second-round annealing, and second-round extension is 40 times.

[0055] This technical solution also provides an application of a kit for detecting Helicobacter pylori gene mutations in feces in the preparation of a system for detecting the resistance of Helicobacter pylori to quinolone antibiotics and / or clarithromycin antibiotics:

[0056] If neither the gyrA gene nor the 23S rRNA gene of Helicobacter pylori in the sample has mutated, then Helicobacter pylori does not have resistance to quinolone antibiotics and clarithromycin antibiotics;

[0057] If the gyrA gene of Helicobacter pylori in the sample has mutated and the 23S rRNA gene has not mutated, then Helicobacter pylori is resistant to quinolone antibiotics;

[0058] If the gyrA gene of Helicobacter pylori in the sample has not mutated and the 23S rRNA gene has mutated, then Helicobacter pylori is resistant to clarithromycin antibiotics;

[0059] If both the gyrA gene and the 23S rRNA gene of Helicobacter pylori in the sample have mutated, then Helicobacter pylori is resistant to both quinolone antibiotics and clarithromycin antibiotics.

[0060] In summary, the technical principle of this technical solution lies in:

[0061] The present invention provides a method and corresponding kit for detecting Helicobacter pylori (HP) gene mutations in feces with high efficiency, strong specificity and high sensitivity, which is particularly suitable for detecting gyrA gene and 23S rRNA gene mutations related to quinolone antibiotics and clarithromycin resistance. The core technical principle is based on single-tube nested PCR design, and combines a variety of advanced technical means such as amplification refractory mutation system polymerase chain reaction (ARMS-PCR), blocker primer, locked nucleic acid modification (peptide nucleic acid modification), MGB probe, nested PCR design and degenerate base design after sequence alignment.

[0062] The technical difficulties of this technical solution are mainly reflected in:

[0063] (1) Difficulty in gene detection in fecal samples:

[0064] There are indeed many challenges in gene detection in fecal samples, especially when the content of the target gene is extremely low. Feces contain a large amount of bacteria, food residues and DNA of other biological materials, which brings great complexity to the extraction and analysis of DNA of specific pathogens (such as Helicobacter pylori). Fecal samples also contain various substances that may inhibit the PCR reaction, such as humic acid, bilirubin, fecal polysaccharides and hemoglobin, etc. These substances will interfere with the function of DNA polymerase and reduce the amplification efficiency. In many cases, especially when the infection is in the early stage or the number of pathogens is small, the proportion of the target gene (such as the drug resistance-related gene of Helicobacter pylori) in the total DNA is very small, which puts high requirements on the sensitivity of the detection method. Due to individual differences and randomness in the sampling process, there may be significant differences between different samples, which also increases the difficulty of result repeatability and accuracy.

[0065] This technical solution significantly improves the detection sensitivity and specificity of HP gene mutations through a series of designs, including single-tube nested PCR, ARMS-PCR, fluorescence probe method, blocker primer, locked nucleic acid modification and MGB probe, etc. Especially in the application of complex samples such as feces, it provides strong support for clinical diagnosis, helps to formulate more accurate treatment plans, reduces the abuse of antibiotics and improves the treatment effect.

[0066] (2) Design of optimized detection primers, probes, etc. for the gyrA gene:

[0067] ARMS PCR primers were designed at their mutation sites, degenerate bases were introduced, and the mutated bases were placed at the 3'-ends of the primers to enhance the specificity and sensitivity for detecting gyrA gene mutation sites; MGB probes were used in the design of the probes to increase the detection specificity; the introduction of Blocker primers and locked nucleic acid modifications prevented the amplification of the wild-type gyrA gene of HP, further enhancing the detection specificity; finally, the introduction of single-tube nested primers greatly enhanced the sensitivity for detecting gyrA gene mutation sites, enabling it to maintain amplification specificity even in the complex DNA of feces.

[0068] (3) Design of optimized detection primers, probes, etc. for the 23S rRNA gene:

[0069] ARMS PCR primers were designed at their mutation sites to enhance the specificity for detecting 23S rRNA gene mutation sites; MGB probes were used in the design of the probes to increase the detection specificity; the introduction of Blocker primers and locked nucleic acid modifications prevented the amplification of the wild-type 23S rRNA gene of HP, further enhancing the detection specificity; finally, the introduction of single-tube nested primers greatly enhanced the sensitivity for detecting 23S rRNA gene mutation sites, enabling it to maintain amplification specificity even in the complex DNA of feces.

[0070] (4) Design for the internal reference gene:

[0071] By comparing various genes through NCBI, the cagW gene with relatively high specificity for HP was finally selected, and the designed cagW probe used MGB probe to increase the amplification specificity.

[0072] Through the above design, multi-gene and multi-locus detection can be achieved. This technical solution can simultaneously detect 6 mutation sites of the gyrA gene and 3 mutation sites of the 23S rRNA gene, a total of 9 key mutation sites, in one reaction tube. This design not only has a wide coverage range, but also greatly saves reagent consumables, reduces the detection cost, and at the same time ensures rapid detection within a short time (about 1 to 2 hours) with simple and fast operation.

[0073] The beneficial effects of this technical solution are as follows:

[0074] (1) High-efficiency detection: It can detect 9 gene mutation sites related to HP drug resistance (6 of the gyrA gene and 3 of the 23S rRNA gene) at one time, with a wide coverage range.

[0075] (2) High specificity and sensitivity: Through the combination of various technical means, the detection ability for target gene mutations is significantly improved, and low-concentration mutant genes can be accurately identified even in the background of complex fecal samples.

[0076] (3) Convenient operation and low cost: This method is easy to operate and can be completed within 1 to 2 hours, reducing the use of reagent consumables and lowering the detection cost.

[0077] (4) Non-invasive sampling: Using feces as the sample for detection is more convenient and safe than collecting gastric mucosa samples, improving patient compliance. Description of the Drawings

[0078] Figure 1 Results of screening for housekeeping gene primers and probes in Example 2.

[0079] Figure 2 Results of screening for specific internal standard gene primer and probe sets in Example 3 (using fecal DNA infected with HP as the template).

[0080] Figure 3 Results of screening for specific internal standard gene primer and probe sets in Example 3 (using fecal DNA without HP infection as the template, UreA gene).

[0081] Figure 4 Results of screening for specific internal standard gene primer and probe sets in Example 3 (using fecal DNA without HP infection as the template, cagA gene).

[0082] Figure 5 Results of screening for specific internal standard gene primer and probe sets in Example 3 (using fecal DNA without HP infection as the template, UreB gene).

[0083] Figure 6 Results of screening for specific internal standard gene primer and probe sets in Example 3 (using fecal DNA without HP infection as the template, VacA gene).

[0084] Figure 7 Results of screening for specific internal standard gene primer and probe sets in Example 3 (using fecal DNA without HP infection as the template, cagW gene).

[0085] Figure 8 Results of screening for downstream primers for gyrA gene mutation detection in Example 4.

[0086] Figure 9 Results of screening for blocking primers for gyrA gene mutation detection in Example 4 (1, 2, and 3 represent the amplification curves of adding gyrA-Blocker1, gyrA-Blocker2, and gyrA-Blocker3 blocking primers respectively).

[0087] Figure 10 Results of screening for nested primers for gyrA gene mutation detection in Example 4 (without adding nested primers).

[0088] Figure 11 Results of nested primer screening for gyrA gene mutation detection in Example 4 (nested primers added).

[0089] Figure 12 Distribution of the optimal primer-probe combination for the gyrA gene on the gyrA gene template in Example 4.

[0090] Figure 13 Amplification effect image of the optimal primer-probe set selected for the 23S rRNA gene in Example 5.

[0091] Figure 14 Distribution of the optimal primer-probe combination for the 23S rRNA gene on the 23S rRNA gene template in Example 5.

[0092] Figure 15 Typical PCR amplification map of Example 6 where the 23S rRNA gene of HP has a mutation and the gyrA gene has no mutation.

[0093] Figure 16 Typical PCR amplification map of Example 6 where the gyrA gene of HP has a mutation and the 23S rRNA gene has no mutation.

[0094] Figure 17 Typical PCR amplification map of Example 6 where both the gyrA gene and the 23S rRNA gene of HP have mutations. Detailed implementation manners

[0095] The present invention will be further described in detail below in conjunction with examples, but the implementation manners of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples and experimental examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used can all be obtained from commercial channels.

[0096] Example 1

[0097] A kit for detecting Helicobacter pylori gene mutations in feces, more specifically, for detecting Helicobacter pylori gyrA gene and 23S rRNA gene mutations. The kit consists of the following components:

[0098] (1) Human housekeeping gene detection component

[0099] In order to ensure the correctness of template extraction in the experiment and preliminarily estimate the concentration of the template, and monitor the normal operation of the entire reaction system, a human housekeeping gene is set as an internal control for the PCR detection system.

[0100] One of the genes such as GAPDH (glyceraldehyde-3-phosphate-dehydrogenase), ACTB (β-actin), and β-globin can be selected. In this method, the β-globin gene is preferably used as an internal reference control. The primer information for human housekeeping genes is shown in Table 1.

[0101] Table 1: Primer and probe design for housekeeping genes GAPDH, ACTB (β-actin), and β-globin genes (CY5: fluorophore; BHQ2: fluorescence quenching group)

[0102] Sequence Name Gene Sequence Description Serial Number Sequence (5'-3') 5' Modification 3' Modification Intermediate Modification GAPDH-F GAPDH Forward Primer SEQ ID NO.1 ATGCTGGCGCTGAGTACG / / / GAPDH-R GAPDH Reverse Primer SEQ ID NO.2 TCACCCCAGCCTTCTCCAT / / / GAPDH-P GAPDH Probe SEQ ID NO.3 TGGAGTCCACTGGCGTCTTCACCA CY5 BHQ2 / ACTB-F ACTB Forward Primer SEQ ID NO.4 TACGTTGCTATCCAGGCTGT / / / ACTB-R ACTB Reverse Primer SEQ ID NO.5 CACCGGAGTCCATCACGAT / / / ACTB-P ACTB Probe SEQ ID NO.6 CTATCCCTGTACGCCTCTGG CY5 BHQ2 / Globin-F Globin Forward Primer SEQ ID NO.7 TTAGGCTGCTGGTGGTCTAC / / / Globin-R Globin Reverse Primer SEQ ID NO.8 TGAGCCAGGCCATCACTAAA / / / Globin-P Globin Probe SEQ ID NO.9 TCCTGATGCTGTTATGGGCA CY5 BHQ2 /

[0103] (2) Helicobacter pylori internal standard gene detection components

[0104] To identify whether the fecal sample contains Helicobacter pylori and determine whether the host is infected with HP, a specific gene of HP is set as the internal standard gene. One of the genes such as UreA, UreB, cagA, VacA, and cagW can be selected. In this method, the cagW gene is preferably used as the internal standard gene of HP. The primer and probe design for UreA, UreB, cagA, VacA, and cagW genes is shown in Table 2.

[0105] Table 2: Primer and probe design for UreA, UreB, cagA, VacA, and cagW genes (ROX: fluorophore; MGB: fluorescence quenching group)

[0106] Sequence Name Gene Sequence Description Serial Number Sequence (5'-3') 5' Modification 3' Modification Intermediate Modification UreA-F UreA Forward Primer SEQ ID NO.10 CGACAGACCGGTTCAAATCG / / / UreA-R UreA Reverse Primer SEQ ID NO.11 CAAACCTTACTGCTGTCCCG / / / UreA-P UreA Probe SEQ ID NO.12 TTTCGGCAAACGCTTGGATA ROX MGB / UreB-F UreB Forward Primer SEQ ID NO.13 TGATCGTAACTGCTGGTGGT / / / UreB-R UreB Reverse Primer SEQ ID NO.14 TGGAGTGATAGTGGTTGCGT / / / UreB-P UreB Probe SEQ ID NO.15 GCTTTTGCAAGCGGTGTAAC ROX MGB / cagA-F cagA Forward Primer SEQ ID NO.16 CCTGAAGAGCCCATTTACGC / / / cagA-R cagA Reverse Primer SEQ ID NO.17 AAATGGGTTCAGGGCTAGCT / / / cagA-P cagA Probe SEQ ID NO.18 CTCAACGAAGCTACATCGGC ROX MGB / VacA-F VacA Forward Primer SEQ ID NO.19 CGTTAGTCAGCATCACACCG / / / VacA-R VacA Downstream primer SEQ ID NO.20 GGCTTCTTCGGCTTGTTTGA / / / VacA-P VacA Probe SEQ ID NO.21 TGCTGTAGGAACGGTCTCAG ROX MGB / cagW-F cagW Upstream primer SEQ ID NO.22 GGTGTGATCGAAGCGCTTAG / / / cagW-R cagW Downstream primer SEQ ID NO.23 CCATGCCGATCCCCATAAAG / / / cagW-P cagW Probe SEQ ID NO.24 CCACAAGTTTAGCCGCTAGC ROX MGB /

[0107] (3) gyrA gene detection components

[0108] To identify whether gene mutations occur at specific high drug-resistant sites of the gyrA gene, six mutation types (A260T, C261G, T261A, G271A, G271T, A272G) of the gyrA gene are designed in this application (for the gyrA gene, Gene ID: 93237031, where the wild-type of the 261st base has two forms, G and T, which are mutated to G and A respectively, making the strain have specific high drug resistance). According to the mutation sites, a primer-probe group is developed (using the antisense strand of the gyrA gene as the template for primer-probe design) to detect the gene status of the gyrA gene.

[0109] Primer design, probe design, and blocker primer (Blocker) design are carried out at the gyrA gene mutation site. In this method, the 3'-end of the upstream primer covers the mutation base position of the gene, and the terminal base at the 3'-end of the upstream primer is designed as the mutation base site. The sequence of the blocker primer (Blocker) covers the mutation base site, and locked nucleic acid (LNA) modification or peptide nucleic acids (PNA) modification is performed at the mutation base. LNA modification is preferably used in this method. The 3'-end of the blocker primer (Blocker) is modified with an amino group or phosphorylated to hinder the amplification of the wild-type template. Phosphorylation modification is preferably used in this method. The fluorescence modification group used at the 5'-end of the probe can be one or several of FAM (6-carboxyfluorescein), HEX (hexachloro-6-methylfluorescein), VIC, ROX, CY3 (TYETM563), and CY5 (TYETM665), and each modification can be interchanged. The 3'-end of the probe is modified with MGB. After MGB modification, the Tm value can be increased and the detection specificity can be improved, making the Tm of the probe > the Tm of the primer, so that the fluorescence signal value can be detected more accurately during the primer amplification process. The introduction of the single-tube nested primer greatly enhances the sensitivity of detecting the gene mutation site, enabling it to maintain the amplification specificity in the complex DNA of feces. The design of the primer, probe, blocker primer (Blocker), and nested primer for the gyrA gene is shown in Table 3 for details.

[0110] Table 3: Primer, Probe, and Blocker Primer (Blocker) Design for the gyrA Gene

[0111]

[0112]

[0113] Among them, locked nucleic acid (LNA) modification is a special chemical modification method. It "locks" the ribose ring in a specific conformation by forming a methylene bridge between the 2'-oxygen atom and 4'-carbon atom of ribose. Peptide nucleic acid (PNA) is an artificially synthesized molecule similar to DNA and RNA, but its backbone is composed of repeating N-(2-aminoethyl)glycine units linked together, rather than the sugar-phosphate backbone in natural nucleic acids. For example, for gyrA-Blocker1, a methylene bridge is formed between the 2'-oxygen atom and 4'-carbon atom of the deoxyribose corresponding to T at the fifth position, C at the sixth position, G at the sixteenth position, and T at the seventeenth position. Another example, for gyrA-Blocker3, A at the fifth position, T at the sixth position, G at the seventeenth position, and T at the eighteenth position are linked to the peptide nucleic acid backbone instead of the conventional deoxyribonucleic acid backbone. Both locked nucleic acid (LNA) and peptide nucleic acid (PNA) are DNA analog molecules and can bind to DNA molecules through base complementary pairing. After replacing the sites in the synthesized DNA sequence from conventional deoxyribonucleic acid with locked nucleic acid / peptide nucleic acid, due to the more stable backbone of locked nucleic acid / peptide nucleic acid, the binding force with the DNA strand is stronger and it is less likely to unwind, which can significantly increase the TM value of the primer / probe sequence and improve the mismatch recognition ability.

[0114] In addition, Y represents cytosine (C) or thymine (T).

[0115] (4) 23S rRNA gene detection component

[0116] In order to identify whether gene mutations occur at specific high drug-resistant sites of the 23S rRNA gene (GenBank: LC420463.1), this application designs three mutation types (A2142C, A2142G, A2143G) of the 23S rRNA gene, and develops a primer-probe set according to the mutation sites (using the antisense strand of the 23S rRNA gene as the template for primer-probe design) to detect the gene status of the 23S rRNA gene.

[0117] Primer design, probe design, and blocker primer Blocker design are performed at the 23S rRNA gene mutation sites. For the general situation of the design of primers, probes, and blocker primers Blocker, refer to the description of the gyrA gene in (3). The design of primers, probes, blocker primers Blocker, and nested primers for the 23S rRNA gene is shown in Table 4 in detail.

[0118] Table 4: Design situation of primers, probes, and blocker primers Blocker for the 23S rRNA gene

[0119]

[0120] (5) PCR reagent components

[0121] The above-mentioned PCR reagent components include dNTP, DNA polymerase, UNG enzyme and PCR buffer. The above components are conventional PCR components, and reagents containing the above components can all be selected, or the above-mentioned substances such as dNTP and DNA polymerase can be purchased separately and compounded into a PCR reagent group. The above are all conventional means in the prior art and will not be elaborated here. In subsequent specific experimental studies, the multiplex PCR reagent (SuperPlex TM Premix) of TAKARA containing the above components was selected.

[0122] Through the combination of the above components, the kit can simultaneously detect the gene status of human endogenous housekeeping genes (human housekeeping genes), Helicobacter pylori internal standard genes, gyrA genes and 23S rRNA genes in one tube. Calculated according to a reaction system of 25 μL (20 μL of reaction solution and 5 μL of template added), see Table 5 for details. Nucleic acid sequences such as primers and probes are in dry powder form, synthesized by a relevant biotechnology company, and diluted to 50 μM with 1×TE added.

[0123] Table 5: PCR reaction system

[0124]

[0125] In the kit for detecting gyrA gene and 23S rRNA gene mutations of the present invention, the fluorescence quantitative PCR reaction program and the preferred reaction program are shown in Table 6.

[0126] Table 6: PCR reaction conditions

[0127]

[0128] Example 2: Screening of housekeeping gene primers and probes

[0129] For the primer-probe groups of different housekeeping genes (Table 1), then using human fecal DNA as a template, PCR amplification was carried out with TAKARA's 2×MIX enzyme, and the amplification system was 20 μL. The amounts of nucleic acid components such as probes and primers in each experimental group were the same and the template amounts were the same, and parallel experiments were carried out to compare the amplification effects on different housekeeping genes. The amplification program was pre-denaturation at 95 °C for 2 min; denaturation at 95 °C for 30 s; annealing at 60 °C for 30 s; extension at 72 °C for 30 s; 45 cycles of amplification. The screening results are shown in Figure 1, The PCR amplification results of 3 pairs of primer-probe sets on fecal sample DNA showed that: the primer-probe set of the β-globin gene had the highest amplification efficiency in fecal samples, with a Ct value of 28.12 Ct; the primer-probe set of the GAPDH gene had a relatively high amplification efficiency, with a Ct value of 31.89 Ct; the primer-probe set of the β-actin gene had the lowest amplification efficiency, with a Ct value of 36.23 Ct. Therefore, the primer-probe set of the β-globin gene (SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9) was preferably selected.

[0130] Example 3: Screening of specific internal standard gene primer-probe sets

[0131] For the primer-probe sets for internal standard genes (Table 2), then using human fecal DNA as a template (divided into fecal DNA infected with HP and fecal DNA without HP infection), PCR amplification was carried out with TAKARA's 2×MIX enzyme, and the amplification system was 20 μL. The amounts of nucleic acid components such as probes and primers in each experimental group were the same and the template amounts were the same, and parallel experiments were carried out to compare the amplification effects on different internal standard genes. The amplification program was pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 30 s; 45 cycles of amplification. The PCR amplification results using fecal DNA infected with HP as a template were as Figure 2 shown; the PCR amplification results using fecal DNA without HP infection as a template were as Figures 3 - 7As shown in the figure. The 5 sets of primer-probes for UreA, UreB, cagA, VacA, and cagW genes can all amplify an "S"-shaped curve by PCR amplification using HP-infected fecal DNA as a template, and the difference in Ct values is within 3 Ct, indicating that the amplification efficiencies of these primer-probes are close and can all be used as alternatives for internal standards. When the 5 sets of primer-probes for UreA, UreB, cagA, VacA, and cagW genes are used for PCR amplification with fecal DNA without HP infection as a template, the primer-probe sets for UreA and UreB can both amplify an "S"-shaped curve, indicating that their specificity in fecal samples is relatively low; the primer-probe sets for cagA and VacA also have non-specific amplification, with Ct values around 35 Ct, and neither can be used as an alternative for internal standards; only the primer-probe set for the cagW gene has no non-specific amplification in fecal samples. Therefore, the cagW gene is selected as the internal standard gene (corresponding sequences: SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24). It can be seen from the experimental results that due to the complexity of the components in feces, serious false positive phenomena occur in the detection of HP-specific genes. Only the detection targeting the cagW gene can ensure that HP-specific genes are not detected in samples without HP infection, thus ensuring the accuracy of the detection. Therefore, the cagW gene, as an internal reference gene, has achieved unexpected technical effects in the detection of Helicobacter pylori in feces.

[0132] Example 4: Screening of primer-probe sets for gyrA gene

[0133] Screen the primer-probe for the gyrA gene (Table 3). Respectively use the synthesized plasmid of the gyrA gene (6 mutant plasmids + 1 wild-type plasmid) as a template, and perform PCR amplification with TAKARA's 2×MIX enzyme. The amplification system is 20 μL. The amplification program is pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 30 s; 45 cycles of amplification.

[0134] (1) For the plasmids of 6 mutant types (A260T, C261G, T261A, G271A, G271T, A272G) of the gyrA gene, perform PCR amplification with the corresponding upstream primers gyrA-F6, gyrA-F4, gyrA-F5, gyrA-F3, gyrA-F2, gyrA-F1 and downstream primers gyrA-R1, gyrA-R2, gyrA-R3, gyrA-R4 and probe gyrA-P1.

[0135] More specifically, the amplification experiment of mutant plasmid A260T is described below. The template is the gyrA gene mutant plasmid A260T. The primer pairs are gyrA-F6 + gyrA-R1, gyrA-F6 + gyrA-R2, gyrA-F6 + gyrA-R3, gyrA-F6 + gyrA-R4; the probe: gyrA-P1. In the reaction systems of different experimental groups, the concentrations of plasmid template, 2×MIX, upstream primer, downstream primer, and probe are kept consistent (different types of downstream primers are added to each experimental group for comparison), and PCR amplification is performed on them, and parallel experiments are carried out to compare the amplification effects of different downstream primers. The detection results are as Figure 8 shown: All 4 primer pairs can amplify an "S"-shaped curve, and the Ct values are similar, indicating that all 4 primer pairs meet the PCR amplification conditions. At the same time, PCR amplification is performed on plasmids of other 5 mutation types, and combined with the amplification curves, the primer gyrA-R2 (SEQ ID NO.33) is finally selected as the common downstream primer for detecting 6 mutant plasmids.

[0136] (2) Using the wild-type plasmid of the gyrA gene as the template, PCR amplification is carried out with upstream primers gyrA-F6, gyrA-F4, gyrA-F5, gyrA-F3, gyrA-F2, gyrA-F1, downstream primer gyrA-R2, and probe gyrA-P1. In this system, gyrA-Blocker1, gyrA-Blocker2, and gyrA-Blocker3 blocking primers are added respectively, and the system without the blocking primer is used as a control. In the reaction systems of different experimental groups, the concentrations of plasmid template, 2×MIX, upstream primer, downstream primer, probe, and blocking primer are kept consistent (the control group does not add the blocking primer, and different types of blocking primers are added to each experimental group for comparison), and PCR amplification is performed on them, and parallel experiments are carried out to compare the effects of different Blocker blocking primers. The results of PCR amplification show that ( Figure 9): Without adding Blocker blocking primers, there is an "S"-shaped amplification curve, indicating that the template with a single base difference cannot be identified, and the gyrA gene mutation site cannot be identified; in the system with Blocker blocking primers (especially gyrA-Blocker1), the blocking primers and the wild-type templates are competitively bound, greatly reducing the probability of primers binding to the wild-type template. The amplification curve is a tail at the end, and the Ct value is after 37Ct, indicating that the system after adding Blocker blocking primers can distinguish templates with single base mutations. By comparing the amplification curves of gyrA-Blocker1, gyrA-Blocker2 and gyrA-Blocker3 blocking primers, gyrA-Blocker1 is finally preferred as the blocking primer (SEQ ID NO.36). The main difference between gyrA-Blocker1 and gyrA-Blocker2 is the difference in 3' modification (phosphorylation modification and amino modification, respectively). Although both of them have undergone the same locked nucleic acid modification, the phosphorylation modification method greatly reduces the probability of primer binding to the wild-type template, distinguishes the template with single-base mutation, and improves the detection accuracy. The main difference between gyrA-Blocker1 and gyrA-Blocker3 is that they use locked nucleic acid modification or peptide nucleic acid modification. There are slight differences in the primer sequences, but the detection accuracy of gyrA-Blocker1 is more ideal. It can be seen that in this scheme, the blocking primers are phosphorylated and locked nucleic acid modified, which is the key point to ensure the detection accuracy and obtain unexpected technical effects. The Ct values ​​of gyrA-Blocker3 and gyrA-Blocker2 are relatively low (about 33), which is quite different from gyrA-Blocker1. There are certain deficiencies in the effect of excluding interference from wild-type templates in gyrA-Blocker3 and gyrA-Blocker2. If the blocker primer is not modified with locked nucleic acid or peptide nucleic acid, or the 3' end is not phosphorylated or amino-modified, the Ct value for the wild-type template may be too low (less than about 33), resulting in unsatisfactory detection results.

[0137] The Blocker is used to cover the wild-type template. During the design, the situation of competitive binding to the template needs to be fully considered. The optimal Blocker in this solution can more accurately identify mutant bases while covering and binding to the template. More specifically, the Blocker preferentially binds to the wild-type template and its Tm value needs to be increased (blocker Tm value > primer Tm value). During high-temperature denaturation at 95°C, the DNA double strand unwinds into single strands. During the annealing process, the blocker primer binds to the template prior to other primers, enhancing the binding competitiveness. The locked nucleic acid modification on the Blocker (and the site of the locked nucleic acid is the base mutation site) and phosphorylation modification not only effectively increase the Tm value of the blocker primer, but also increase its specificity for binding to the wild-type template, reducing the probability of the Blocker binding to the mutant template. Although, in theory, locked nucleic acid modification and peptide nucleic acid modification, phosphorylation modification and amination modification all have the effect of adjusting the primer Tm value and the binding effect between the primer and the template, experimental studies have found that in the specific reaction environment of this solution, the locked nucleic acid modification has a better effect than peptide nucleic acid modification, and phosphorylation modification has a better effect than amination modification. The optimal blocker primer fully ensures that the Ct value of the PCR amplification for the wild-type template > 36, avoiding false positive situations.

[0138] (3) Using the fecal DNA (gyrA site mutation) infected with HP as the template, the system includes upstream primers gyrA-F6, gyrA-F4, gyrA-F5, gyrA-F3, gyrA-F2, gyrA-F1, downstream primer gyrA-R2, probe gyrA-P1, and gyrA-Blocker1. Nested primers of different primer pairs are added to this system respectively, and the system without nested primers is used as a control. Except for the control group, in the reaction systems of different experimental groups, the concentrations of fecal DNA template, 2×MIX, upstream primer, downstream primer, probe, blocking primer, and nested primer pairs are kept consistent (each experimental group adds different types of nested primer pairs for comparison), and PCR amplification is performed on them, and parallel experiments are carried out to compare the effects of different nested primer pairs. After adding the nested primers, the PCR amplification program is: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 30 s; annealing at 68°C for 30 s; extension at 72°C for 30 s; amplification for 5 cycles; denaturation at 95°C for 30 s; annealing at 60°C for 30 s; extension at 72°C for 30 s; amplification for 45 cycles.

[0139] PCR amplification results ( Figure 10 and Figure 11)The system without nested primers shows that the Ct values of the amplified curves are all relatively high, and most of them do not show an "S"-shaped curve. After adding nested primers, the Ct values are significantly better than those without nested primers, and the amplification curves are also better than those without nested primers. After adding nested primers, the Ct values are significantly advanced by 2 - 3 Ct values. C-gyrA-F1 (SEQ ID NO.39) + C-gyrA-R2 (SEQ ID NO.43) is selected as the best nested primer from the nested primers. In this scheme, the nested primers are introduced with locked nucleic acid modification, which further increases the Tm value, making the Tm of the nested primers > the Tm of the target primers, so that the inner primers do not amplify in the first-round nested PCR amplification; at the same time, the introduction of locked nucleic acid makes the double-strand more stable, reduces non-specific binding, and can also improve the specificity of amplification.

[0140] In summary, for the distribution of the best primer-probe combination targeting the gyrA gene on the gyrA gene template, see Figure 12 . In the sequence template of the gyrA gene, the site A272G is itself a mutant, so there will be a mismatch situation when Blocker et al. perform base sequence alignment here (shown as protruding bases in the figure).

[0141] Example 5: Screening of primer-probe sets for the 23S rRNA gene

[0142] Screening research was carried out on the primer-probes for the 23S rRNA gene (Table 4). Plasmids of the 23S rRNA gene (3 mutant plasmids + 1 wild-type plasmid) were synthesized as templates, and PCR amplification was performed with TAKARA's 2×MIX enzyme. The amplification system was 20 μL, and the amplification program was pre-denaturation at 95 °C for 2 min; denaturation at 95 °C for 30 s; annealing at 60 °C for 30 s; extension at 72 °C for 30 s; 45 cycles of amplification. The screening of specific primer-probes, Blocker primers, and nested primers was the same as the screening scheme for the gyrA gene. After the optimization of the primer-probes, the best primer-probe set for the 23S rRNA gene (SEQ ID NO.45, SEQ ID NO.46, SEQ ID NO.47, SEQ ID NO.50, SEQ ID NO.52, SEQ ID NO.55, SEQ ID NO.57, SEQ ID NO.61) was finally determined. See the best amplification image in Figure 13 .

[0143] In summary, for the distribution of the best primer-probe combination targeting the 23S rRNA gene on the 23S rRNA gene template, see Figure 14 .

[0144] Example 6: Detection effect of the kit

[0145] Using the optimal reaction system shown in Table 5 and the optimal reaction procedure shown in Table 6, the detection effect of the kit was studied. The primers, probes of the housekeeping gene primer-probe group bind to the region where the target is located on the template DNA, and the Ct value is obtained during detection to determine whether the entire reaction system is working properly; the primers, probes of the HP internal standard gene cagW gene primer-probe group bind to the region where the target is located on the template DNA, and the Ct value is obtained during detection to determine whether HP exists in the feces; the primers and probes of the gyrA gene primer-probe group bind to the region where the template DNA is located, and the Ct value is obtained during detection to determine whether there are mutations at 6 sites of the gyrA gene; the primers and probes of the 23S rRNA gene primer-probe group bind to the region where the template DNA is located, and the Ct value is obtained during detection to determine whether there are mutations at 3 sites of the 23S rRNA gene. Among them, the Ct value, that is, the Cycle threshold, is the number of cycles when the fluorescence signal first exceeds the threshold during the PCR amplification process.

[0146] The usage method of the kit specifically includes the following steps:

[0147] S1 Nucleic acid extraction of the sample to be detected, using TransGen Stool Genomic DNA Kit for DNA extraction.

[0148] S2 Reagent preparation and PCR reaction: Prepare the PCR reaction system in the optimal manner according to Table 5. And the positive control and negative control are amplified simultaneously. After brief centrifugation, transfer to the amplification area. The amplification program is shown in the optimal implementation method of Table 6, and fluorescence collection is only carried out in the second annealing stage, and no fluorescence collection is carried out in other stages.

[0149] S3 Result interpretation:

[0150] The determination method for the gene mutation of the sample to be detected by the Ct value difference is:

[0151] If there are obvious amplification signals in the internal control CY5 signal (β-globin gene) of the sample to be detected and the Ct of CY5 ≤ 38, subsequent interpretation can be carried out: If there is no obvious amplification signal in the CY5 channel or the Ct of CY5 > 38, it means that there is no human genome in the sample and the nucleic acid extraction has failed.

[0152] If there is no obvious amplification signal in the ROX channel (cagW gene) or the Ct of ROX > 36, it means that the sample does not contain the HP genome.

[0153] When the Ct of CY5 ≤ 38 and the Ct of ROX ≤ 36, the mutation status of gyrA and 23S rRNA genes can be identified, and the identification method is shown in Table 7.

[0154] Table 7: Identification of the mutation status results of gyrA and 23S rRNA genes

[0155]

[0156] More specifically, the interpretation of the experimental results is as follows:

[0157] When the Ct of the β-globin gene ≤ 38 and the Ct of the cagW gene ≤ 36, if the Ct of the gyrA gene > 36 and the Ct of the 23S rRNA gene > 36, it indicates that neither the gyrA gene nor the 23S rRNA gene of Helicobacter pylori in the sample has mutated.

[0158] When the Ct of the β-globin gene ≤ 38 and the Ct of the cagW gene ≤ 36, if the Ct of the gyrA gene ≤ 36 and the Ct of the 23S rRNA gene > 36, it indicates that the gyrA gene of Helicobacter pylori in the sample has mutated and the 23S rRNA gene has not mutated. At this time, it is resistant to HP quinolone antibiotics.

[0159] When the Ct of the β-globin gene ≤ 38 and the Ct of the cagW gene ≤ 36, if the Ct of the gyrA gene > 36 and the Ct of the 23S rRNA gene ≤ 36, it indicates that the gyrA gene of Helicobacter pylori in the sample has not mutated and the 23S rRNA gene has mutated. At this time, it is resistant to HP clarithromycin antibiotics.

[0160] When the Ct of the β-globin gene ≤ 38 and the Ct of the cagW gene ≤ 36, if the Ct of the gyrA gene ≤ 36 and the Ct of the 23S rRNA gene ≤ 36, it indicates that both the gyrA gene and the 23S rRNA gene of Helicobacter pylori in the sample have mutated. At this time, it is resistant to both HP quinolone antibiotics and clarithromycin antibiotics.

[0161] Among them, for the typical PCR amplification diagram of the 23S rRNA gene of HP mutated and the gyrA gene not mutated, see Figure 15 . For the typical PCR amplification diagram of the gyrA gene of HP mutated and the 23S rRNA gene not mutated, see Figure 16 . For the typical PCR amplification diagram of both the gyrA gene and the 23S rRNA gene of HP mutated, see Figure 17 .

[0162] Example 7: Sensitivity and specificity of the kit

[0163] (1) Verification of the detection sensitivity of the kit

[0164] Method: There are 9 detection sites for the 23S rRNA gene and gyrA gene of HP in this kit. Since the detection methods for the 9 mutation sites are the same, selecting one of the mutation sites can determine the detection limit of the mutant gene plasmid sample. In this experiment, the 23S rRNA-A2142C mutation site was selected to determine the detection limit, and the aforementioned optimal reaction system and reaction procedure were used. The 23S rRNA-A2142C mutant plasmid with a concentration of 10000 copies / mL was serially diluted, and the serial concentration samples were repeatedly detected. The concentration at which the positive detection rate was ≥95% was used as the detection limit of the kit. The experimental results are shown in Table 8 in detail. When the sample concentration was above 2500 copies / mL, the positive detection rate of the kit was 100%; when the sample concentration was 1000 copies / mL, the positive detection rate of the kit was 95%. Therefore, the kit can still detect samples with a concentration of 1000 copies / mL, that is, the kit can detect samples with a lower concentration and has high sensitivity.

[0165] Table 8: Detection results of serial concentrations of 23S rRNA-A2142C mutant plasmid samples of HP (negative is "-", positive is "+")

[0166]

[0167] (2) Verification of the sensitivity of the kit for mutation detection

[0168] Since Helicobacter pylori contained in actual fecal samples will have some mutations. For example, the 23S rRNA-A2142C mutant gene accounts for 50% in the sample DNA, and the wild type of the 23S rRNA gene accounts for 50%. Whether the kit can detect the mutant gene in the mixed template. In this experiment, the 23S rRNA-A2142C mutation site was selected for detection. The 23S rRNA-A2142C mutant plasmid and the 23S rRNA wild-type plasmid were mixed in different proportions, and the aforementioned optimal ratio and reaction procedure were used. The final concentration of the template was 2500 copies / mL, and the mixing ratio is shown in Table 9 in detail. The experimental results are shown in Table 10 in detail. In Ratio 5, when the proportion of the 23S rRNA-A2142C mutant plasmid was 20% and the proportion of the 23S rRNA wild-type plasmid was 80%, the kit could detect the mutant result 100%; in Ratio 6, when the proportion of the 23S rRNA-A2142C mutant plasmid was 10% and the proportion of the 23S rRNA wild-type plasmid was 90%, the kit could still detect a positive rate of 90%, indicating that the kit has a good effect in detecting low-concentration mutant samples.

[0169] Table 9: Mixing ratio of 23S rRNA-A2142C mutant plasmid and 23S rRNA wild-type plasmid of HP

[0170] Name Ratio 1 Ratio 2 Ratio 3 Ratio 4 Ratio 5 Ratio 6 Ratio 7 Ratio 8 Mutant plasmid 100％ 80％ 60％ 40％ 20％ 10％ 5％ 0 Wild-type plasmid 0 20％ 40％ 60％ 80％ 90％ 95％ 100

[0171] Table 10: Detection results of the proportion of the 23S rRNA - A2142C mutant gene series

[0172]

[0173] (3) Verify the specificity of the kit

[0174] Verification of interfering substances: Since fecal samples are from the intestine, it is necessary to perform PCR amplification verification on common strains in the intestine to ensure that the amplification results are correct and not other interfering strains. DNA was extracted from Campylobacter jejuni bacterial solution, Bacillus subtilis bacterial solution, Enterobacter aerogenes bacterial solution, Proteus vulgaris bacterial solution, Enterococcus faecalis bacterial solution, Klebsiella pneumoniae bacterial solution, Escherichia coli bacterial solution, Candida albicans bacterial solution, and Staphylococcus aureus bacterial solution respectively. Through dilution adjustment, their respective concentrations were made to be 10 8 copies / mL.

[0175] Using the aforementioned optimal reaction system ratio and reaction program to detect the above-mentioned strains, the test results showed that all these strains had negative amplification results. This indicates that the kit does not cross-react with common interfering strains that may be present in the sample, indicating that the kit has strong specificity.

[0176] The above are only examples of the present invention. Specific structures and common knowledge such as characteristics well known in the art are not described in detail herein. It should be noted that for those skilled in the art, without departing from the structure of the present invention, several modifications and improvements can be made, which should also be regarded as the protection scope of the present invention, and these will not affect the implementation effect of the present invention and the practicality of the patent. The protection scope required by this application should be based on the content of its claims, and the specific implementation manners described in the specification can be used to interpret the content of the claims.

Claims

1. A kit for detecting Helicobacter pylori gene mutations in feces, characterized in that: It includes a gyrA gene detection component and a 23S rRNA gene detection component; the gyrA gene detection component and the 23S rRNA gene detection component both include an upstream primer, a downstream primer, a probe, a blocking primer, an upstream nested primer and a downstream nested primer; The upstream primer is used to cover the base mutation site of the gyrA gene or the 23S rRNA gene; the blocking primer is used to cover the base mutation site of the gyrA gene or the 23S rRNA gene, the blocking primer contains locked nucleic acid modification or peptide nucleic acid modification, and the 3' end of the blocking primer is amino-modified or phosphorylated; the 5' end of the probe is connected with a fluorescent modification group.

2. A kit for detecting Helicobacter pylori gene mutations in feces according to claim 1, characterized in that: The gyrA gene detection component is used to detect six types of mutations: A260T, C261G, T261A, G271A, G271T, and A272G; the 23SrRNA gene detection component is used to detect three types of mutations: A2142C, A2142G, and A2143G; The fluorescent modification group connected to the 5' end of the probe includes any one of FAM, HEX, VIC, ROX, CY3, and CY5; and the 3' end of the probe is modified with MGB.

3. A kit for detecting Helicobacter pylori gene mutation in feces according to claim 2, characterized in that: Components for gyrA gene detection: The upstream primer includes a nucleotide fragment with a sequence as shown in SEQ ID NO.25-SEQ ID NO.30; The downstream primer includes a nucleotide fragment having a sequence as shown in SEQ ID NO.32 to SEQ ID NO.35; The sequence of the probe is shown in SEQ ID NO.31; The sequence of the blocking primer is: CGCA L T L CATAAACCGC L G L TTAT, and the 3' end is phosphorylated; or CGCA L T L CATAAACCGC L G L TTAT, and the 3' end is amino-modified; or GCGC P A P TCATAAACCGC P G P TT, and the 3' end is phosphorylated; Among them, L represents that the deoxyribose corresponding to the right base is modified with a locked nucleic acid, and P represents that the right base is connected to a peptide nucleic acid; The upstream nested primer includes one of the nucleotide fragments shown in SEQ ID NO.39-SEQ ID NO.41; wherein the deoxyribose corresponding to the 3rd base T and the 25th base A of SEQ ID NO.39 is a locked nucleic acid modification; The downstream nested primer includes one of the nucleotide fragments shown in SEQ ID NO.42-SEQ ID NO.44; wherein the deoxyribose corresponding to the 3rd base G and the 24th base T of SEQ ID NO.43 is a locked nucleic acid modification.

4. A kit for detecting Helicobacter pylori gene mutation in feces according to claim 2, characterized in that: Upstream primers for 23S rRNA gene detection components: The upstream primer includes a nucleotide fragment with a sequence as shown in SEQ ID NO.45 to SEQ ID NO.47; The downstream primer includes a nucleotide fragment having a sequence as shown in SEQ ID NO.51 to SEQ ID NO.54; The probe includes a nucleotide fragment whose sequence is shown as SEQ ID NO.48-SEQ ID NO.50; The sequence of the blocking primer is: AAGACGG L A L AAGACCCCGTGG, and the 3' end is phosphorylated; or AAGACGG P A P AAGACCCCGT, and the 3' end is amino-modified; or AAGACGG L A L AAGACCCCGT, and the 3' end is phosphorylated; Among them, L represents that the deoxyribose corresponding to the right base is modified with a locked nucleic acid, and P represents that the right base is connected to a peptide nucleic acid; The upstream nested primer includes one of the nucleotide fragments shown in SEQ ID NO.55 and SEQ ID NO.56; wherein the deoxyribose corresponding to the 1st base C and the 20th base T of SEQ ID NO.55 is modified with a locked nucleic acid; and the deoxyribose corresponding to the 4th base C of SEQ ID NO.56 is modified with a locked nucleic acid; The downstream nested primer includes one of the nucleotide fragments shown in SEQ ID NO.57 and SEQ ID NO.58; wherein the deoxyribose corresponding to the 20th base C of SEQ ID NO.57 is modified with a locked nucleic acid; and the deoxyribose corresponding to the 18th base A of SEQ ID NO.58 is modified with a locked nucleic acid.

5. A kit for detecting Helicobacter pylori gene mutation in feces according to any one of claims 1 to 4, characterized in that: It also includes a human housekeeper gene testing component; The human housekeeping gene detection components include upstream primers, downstream primers and probes for detecting GAPDH gene, β-actin gene or β-globin gene; The upstream primer sequence for detecting the GAPDH gene is shown in SEQ ID NO.1, the downstream primer sequence for detecting the GAPDH gene is shown in SEQ ID NO.2, and the probe sequence for detecting the GAPDH gene is shown in SEQ ID NO.3; The upstream primer sequence for detecting the β-actin gene is shown in SEQ ID NO.4, the downstream primer sequence for detecting the β-actin gene is shown in SEQ ID NO.5, and the probe sequence for detecting the β-actin gene is shown in SEQ ID NO.6; The upstream primer sequence for detecting the β-globin gene is shown in SEQ ID NO.7, the downstream primer sequence for detecting the β-globin gene is shown in SEQ ID NO.8, and the probe sequence for detecting the β-globin gene is shown in SEQ ID NO.9; The probe for detecting GAPDH gene, β-actin gene or β-globin gene has a fluorescent modification group connected to the 5' end and a BHQ2 group connected to the 3' end; the fluorescent modification group connected to the 5' end of the probe includes any one of FAM, HEX, VIC, ROX, CY3 and CY5.

6. A kit for detecting Helicobacter pylori gene mutation in feces according to claim 5, characterized in that: It also includes a Helicobacter pylori internal standard gene detection component; The Helicobacter pylori internal standard gene detection component includes an upstream primer, a downstream primer and a probe for detecting UreA, UreB, cagA, VacA or cagW gene; The upstream primer sequence for detecting the UreA gene is shown in SEQ ID NO.10, the downstream primer sequence for detecting the UreA gene is shown in SEQ ID NO.11, and the probe sequence for detecting the UreA gene is shown in SEQ ID NO.12; The upstream primer sequence for detecting the UreB gene is shown in SEQ ID NO.13, the downstream primer sequence for detecting the UreB gene is shown in SEQ ID NO.14, and the probe sequence for detecting the UreB gene is shown in SEQ ID NO.15; The upstream primer sequence for detecting the cagA gene is shown in SEQ ID NO.16, the downstream primer sequence for detecting the β-globin gene is shown in SEQ ID NO.17, and the probe sequence for detecting the β-globin gene is shown in SEQ ID NO.18; The upstream primer sequence for detecting the VacA gene is shown in SEQ ID NO.19, the downstream primer sequence for detecting the VacA gene is shown in SEQ ID NO.20, and the probe sequence for detecting the VacA gene is shown in SEQ ID NO.21; The upstream primer sequence for detecting the cagW gene is shown in SEQ ID NO.22, the downstream primer sequence for detecting the cagW gene is shown in SEQ ID NO.21, and the probe sequence for detecting the cagW gene is shown in SEQ ID NO.23; The probe for detecting UreA, UreB, cagA, VacA or cagW gene has a fluorescent modification group connected to the 5' end and a MGB group connected to the 3' end; the fluorescent modification group connected to the 5' end of the probe includes any one of FAM, HEX, VIC, ROX, CY3 and CY5.

7. A kit for detecting Helicobacter pylori gene mutation in feces according to claim 6, characterized in that: Also included are PCR reagent components; the PCR reagent components include dNTPs, DNA polymerase, UNG enzyme and buffer.

8. A kit for detecting Helicobacter pylori gene mutation in feces according to claim 7, characterized in that: It contains the components shown in the following table: The concentrations of the upstream primer, the downstream primer, the probe, the blocking primer, the upstream nested primer and the downstream nested primer were all 50 μM.

9. A kit for detecting Helicobacter pylori gene mutation in feces according to claim 8, characterized in that: Its working procedures are shown in the following table: Preferably, the temperatures of the preliminary denaturation, the first round of denaturation, the first round of annealing, the first round of extension, the second round of denaturation, the second round of annealing, the second round of extension, and the cooling step are: 95°C, 95°C, 68°C, 72°C, 95°C, 58°C, 72°C, 25°C, respectively; Preferably, the times for the preliminary denaturation, the first round of denaturation, the first round of annealing, the first round of extension, the second round of denaturation, the second round of annealing, the second round of extension, and the cooling steps are 5 min, 10 s, 30 s, 10 s, 30 s, 30 s, 10 s, and 5 min, respectively; preferably, the first round of denaturation, the first round of annealing, and the first round of extension are cycled 5 times; the second round of denaturation, the second round of annealing, and the second round of extension are cycled 40 times.

10. Use of a kit for detecting gene mutations of Helicobacter pylori in feces according to claim 9 in preparing a system for detecting quinolone antibiotics and / or clarithromycin antibiotic resistance of Helicobacter pylori, characterized in that: If neither the gyrA gene nor the 23S rRNA gene of Helicobacter pylori in the sample has mutations, then Helicobacter pylori does not have resistance to quinolone antibiotics or clarithromycin antibiotics; If the gyrA gene of H. pylori in the sample is mutated but the 23S rRNA gene is not mutated, then H. pylori is resistant to quinolone antibiotics; If the gyrA gene of Helicobacter pylori in the sample has not mutated but the 23S rRNA gene has mutated, then Helicobacter pylori is resistant to the antibiotic clarithromycin; If both the gyrA gene and the 23S rRNA gene of Helicobacter pylori in the sample are mutated, then Helicobacter pylori is resistant to both quinolone antibiotics and clarithromycin antibiotics.

Images