Immunosuppressive compounds
By developing new compounds that can inhibit the activity of the promoter of corona protein 1, the problem of major side effects of existing immunosuppressants has been solved, effective inhibition of corona protein 1 has been achieved, and the risks of transplant rejection and autoimmune diseases have been reduced.
Patent Information
- Application Number
- CN202380069623.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-09-30
- Filing Date
- 2023-09-30
- Publication Date
- 2025-06-24
AI Technical Summary
Existing immunosuppressants usually target widely expressed proteins, resulting in a variety of side effects and toxicities, making it difficult to effectively inhibit the expression of corona protein 1 to prevent transplant rejection and autoimmune diseases.
A new compound that consumes coronary protein 1 in cells by inhibiting coronary protein 1 promoter activity was developed and the absolute configuration of the eunomer was identified to separate the toxicity and inhibitory activity of the compound. These compounds were prepared by asymmetric synthesis routes and chiral separation methods.
These compounds can effectively inhibit the expression of coronal protein 1, reduce the risk of transplant rejection and autoimmune diseases, while reducing the occurrence of side effects and toxicity.
Smart Images

Figure CN120202189A_ABST
Abstract
Description
[0001] The present invention relates to immunosuppressive compounds that deplete coronin 1 levels, in particular inhibitors of the coronin 1 promoter.
[0002] In particular, the present invention relates to compounds of formula (I) and methods for the asymmetric (i.e., stereoselective) synthesis of compounds of formula (I). Compounds of formula (I) are provided for use as medicaments and are particularly suitable for inhibiting coronin 1 expression by coronin 1 promoter inhibition in the induction of immunosuppression or in the treatment and / or prevention of diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. The present invention also provides a vector comprising a coronin 1 promoter element, wherein in a vertebrate genome, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene and spans a sequence segment of 1500 bp or at least about 700 bp in said genome; a method for identifying compounds that modulate the activity of the coronin 1 promoter.
[0003] The present invention also relates to the epigenetic reader bromodomain-containing protein 3 (BRD3) as an upstream target that modulates the activity of the coronin-1 promoter and coronin 1 expression in immune cells, and compounds that act by inhibiting BRD3.
[0004] Related Art
[0005] T cell homeostasis is crucial for the ability of a vertebrate organism to mount an effective immune response. Lymphocyte precursors derived from the bone marrow home to the thymus, where negative and positive selection lead to the generation of CD4 or CD8 single-positive T lymphocytes. Single-positive T lymphocytes from the thymus seed peripheral organs, where they circulate for an extended period between the secondary lymphoid organs and the blood in a naive state. After infection, T cells are activated by dendritic cells within the peripheral lymph nodes, which induces the massive proliferation of so-called effector T cells. After clearance of the infection, effector cells must be cleared in order to maintain peripheral T cell homeostasis.
[0006] The signals responsible for T cell selection, proliferation, and survival rely on the stimulation of the T cell receptor by major histocompatibility complex (MHC) molecules present on antigen-presenting molecules. In the thymus, positive selection selects those thymocytes that recognize self-MHC molecules, while negative selection ensures the elimination of those T cells that strongly recognize self-peptides in the context of self-MHC. Collectively, these selection processes within the thymus ensure the generation of naive, non-self-reactive T cells for the peripheral organ population.
[0007] Coronin 1 (also known as coronin 1A (coro1a, CORO1A), IMD8, coronin-1, Clipin A, P57, or TACO (tryptophan-aspartic acid-containing coat protein)) is a protein transcribed in all cells of the hematopoietic system and neurons (Ferrari, G. et al., Cell, 1999. 97(4): pp. 435-47; Pieters, J. et al., Nat Rev Immunol, 2013. 13(7): p. 510). Coronin 1 is a member of the WD-repeat family of coronins that are widely expressed in the eukaryotic kingdom (Gatfield et al., Mol Biol Cell 2005, 16, 2786-2798; Pieters, J. et al., Nat Rev Immunol, 2013. 13(7): p. 510).
[0008] Suggests the role of coronin in the survival of mycobacteria within macrophage phagosomes. Coronin 1 has been shown to inhibit endosome / lysosome fusion and confer non-fusogenic properties particularly to mycobacteria-containing phagosomes (Ferrari, G. et al., Cell, 1999. 97(4): pp. 435-47; Jayachandran, R. et al., Cell, 2007. 130(1): pp. 37-50.).
[0009] Studies analyzing fully knockout coronin 1 mice revealed that this molecule is an important regulator of naive T cell homeostasis and that it is associated with immunodeficiency and autoimmune disorders (Mueller, P. et al., Nat Immunol, 2008. 9(4): pp. 424 - 31; Foger, N. et al., Science, 2006. 313(5788): pp. 839 - 42; Shiow, L.R. et al., Nat Immunol, 2008. 9(11): pp. 1307 - 15; Haraldsson, M.K. et al., Immunity, 2008. 28(1): pp. 40 - 51; Siegmund, K. et al., J Immunol, 2011. 186(6): pp. 3452 - 61). T cell - specific coronin 1 knockout mice are largely resistant to the induction of autoimmunity (Siegmund et al., J. Biol. Chem 2016, 291(42), 22086 - 22092). Thus, coronin 1 appears to have a major T cell - intrinsic role. In addition, allografts from MHC - mismatched donors are tolerated in coronin 1 - deficient mice, resulting in long - term survival of the transplanted organ without a graft - versus - host response. Although the absence of coronin 1 leads to a state of immunosuppression, which results in attenuation of autoimmune responses and allograft rejection, immunity to infectious and foreign antigens is largely maintained in these mice (Pieters et al., Nat Rev Immunol. 2013, 13(7), 510 - 518; Jayachandran, R. et al., Immunity, 2019. 50(1): pp. 152 - 165; Siegmund, K. et al., J Immunol, 2011. 186(6): pp. 3452 - 61).
[0010] Currently used immunosuppressants typically target proteins that are widely expressed in our bodies, resulting in various side effects and toxicities (Rodriguez-Peralvarez et al., Curr Opin Organ Transplant, 2014.19(3): pp. 253-60). For example, drugs such as calcineurin inhibitors (cyclosporine / FK506), corticosteroids, or sirolimus cause various side effects and drug-induced toxicities, including cancer, opportunistic infections, hypertension, altered metabolic profiles, and reduced patient compliance (Dantal, J. and M. Campone, Transplantation, 2016.100(12): pp. 2569-2583; Ross, K., J Natl Cancer Inst, 2007.99(6): pp. 421-2.).
[0011] The dihydropyridine scaffold is used in medicine as a heterocyclic structure for the treatment of several diseases with several functions, including but not limited to antihypertensive, antitumor, and anticonvulsant activities (Selected review: V.K. Sharmaa and S.K. Singh, RSC Adv., 2017, 7, 2682-2732). Most commercially used dihydropyridine-containing drugs are achiral or used as racemates, and rarely as single enantiomers. Asymmetric syntheses of dihydropyridines have been developed, but no route towards the related diaryl-substituted 4,6,7,8-tetrahydroquinolin-5(1H)-one has been reported.
[0012] The bromodomain extra-terminal (BET) family of proteins is an epigenetic reader composed of four paralogous members (BRD2, BRD3, BRD4, and BRDT) that recognize the acetylated N-terminal tails of histones and act as readers of the lysine acetylation status and interact with components of the transcriptional and chromatin remodeling machinery. These proteins play key roles in malignant transformation and immune function (Gilan, O. et al., Science, 2020. 368(6489): pp. 387-394. Faivre, E.J. et al., Nature, 2020. 578(7794): pp. 306-310.), and are characterized by the presence of two tandem bromodomains: bromodomain 1 (BD1) and bromodomain 2 (BD2), which contribute to docking with acetylated lysines on histones and thus to chromatin binding. The BD1 and BD2 domains are highly conserved in evolution and also retain a significant level of homology across paralogs. Structurally, they are characterized by an evolutionarily conserved sequence of approximately 110 amino acids that folds itself into four α-helices (αZ, αA, αB, αC) interconnected by two intermediate loops (BC loop and ZA loop), which together form a hydrophobic binding cavity for interaction with the acetylated lysine of histones. Due to the high similarity among paralogs, selective targeting of a specific BET protein has so far been elusive, with early reported compounds binding to both the BD1 and BD2 domains of all four members (pan-BET inhibitors) or binding to one of the BD domains of all four BET proteins (BD1 (pan-BD1 selective inhibitor) or BD2 (pan-BD2 selective inhibitor)) (Wang, N. et al., Signal Transduct Target Ther, 2021. 6(1): p. 23. Qi, J. and Y. Shi, Cancer Cell, 2020. 37(6): pp. 764-766.). BRD4 is the most well-studied member of the family after BRD2, and they have been reported to play important roles in cancer development, embryogenesis, sepsis, immune function, and fibrosis. BRD4 and BRD2 gene knockout has led to embryonic lethality (Houzelstein, D. et al., Mol Cell Biol, 2002. 22(11): pp. 3794-802. Shang, E., et al., Dev Dyn, 2009. 238(4): pp. 908-17).However, the role of BRD3 is the least characterized and its main functions remain largely unknown due to functional redundancy with BRD2 leading to minimal functional changes (Daneshvar, K. et al., Nat Cell Biol, 2020. 22(10): pp. 1211-1222. Stonestrom, A. J. et al., Drug DiscovToday Technol, 2016. 19: pp. 23-28.).
[0013] WO 2011 / 127164 discloses certain compositions for treating fibrosis.
[0014] WO 2006 / 122156 discloses certain compounds for modulating TRPV3 function.
[0015] WO 2008 / 070875 discloses certain polyhydroxyquinoline compounds and dihydropyridine compounds for inhibiting amyloid-β production.
[0016] WO 2013 / 009799 discloses certain vitamin D-receptor agonists and their uses.
[0017] The catalogue "Aurora Building Blocks 7", published on April 4, 2022 by Aurora Fine Chemicals Ltd., Graz, Austria, discloses certain compounds containing a 2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate substructure. SUMMARY OF THE INVENTION
[0018] The present inventors have developed and identified new compounds that deplete coronin 1 in cells (preferably immune cells) by inhibiting the coronin 1 promoter. In addition, the absolute configuration of the enantiomers has been identified, thus separating the toxicity of certain compounds from the coronin 1 promoter inhibitory activity. Chiral separation methods and asymmetric synthetic routes for these compounds have been developed. These compounds provide a new method for: inducing immunosuppression, allograft tolerance or preventing and / or treating transplant rejection, preferably allograft rejection, autoimmune diseases (selected from the group consisting of (but not limited to) the following: psoriasis, vitiligo, multiple sclerosis, systemic lupus erythematosus, primary sclerosing cholangitis, Hashimoto's thyroiditis, rheumatoid arthritis, myasthenia gravis, type I or type II diabetes, conditions secondary to type I or type II diabetes, vasculitis, pernicious anemia, Sjogren syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis, allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis and allergic contact dermatitis), inflammatory diseases (selected from the group consisting of (but not limited to) the following: inflammatory bowel disease, Crohn's disease, ulcerative colitis, endogenous asthma, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, cardiovascular disease, prurigo nodularis, hidradenitis suppurativa, fibrotic conditions, allergic conditions, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, eosinophilic esophagitis, cutaneous manifestations of immune-mediated conditions, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock and adult respiratory distress syndrome), infectious diseases (selected from the group consisting of (but not limited to) the following: tuberculosis, preferably tuberculosis caused by mycobacteria, Salmonella sp. infection, Helicobacter sp. infection, retroviral infection, preferably HIV or HTLV, cytomegalovirus infection, Candida infection, Staphylococcus infection, lymphocytic choriomeningitis virus infection and viral hepatitis) and lymphoproliferative disorders (selected from the group consisting of (but not limited to) the following: T cell lymphoma and T cell leukemia via coronin 1 depletion).
[0019] The identified coronin 1 promoter inhibitors verified coronin 1 depletion at the mRNA and protein levels and showed coronin 1 depletion. For example, compound 11 (methyl-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate) caused approximately 40% coronin 1 depletion with minimal in vitro and in vivo toxicity. Hematological parameters and general health status, as evaluated, for example, by body weight changes, did not show any potential toxicity. Additionally, in vitro studies on human peripheral blood mononuclear cells (PBMCs) revealed that coronin 1 promoter inhibitors depleted coronin 1 levels in human CD4 and CD8 T cells and inhibited the production of pro-inflammatory cytokines (interleukin-2, tumor necrosis factor, and interferon-γ) upon T cell receptor stimulation, which revealed the immunosuppressive effects of coronin 1 promoter inhibitors. Thus, administration of coronin 1 promoter inhibitors is expected to result in extended long-term graft acceptance and suppression of autoimmune diseases (Jayachandran, R. et al., Cell, 2007. 130(1): pp. 37-50.; Jayachandran, R. et al., Immunity, 2019. 50: pp. 1-15. Siegmund, K. et al., J Immunol, 2011. 186(6): pp. 3452-61.; Haraldsson, M.K. et al., Immunity, 2008. 28(1): pp. 40-51).
[0020] Cortactin 1 is particularly required for the survival of peripheral T cells, although it is expressed in multiple immune cell subtypes (Pieters, J. et al., Nat Rev Immunol, 2013.13(7): p. 510). In cortactin 1-deficient mice and humans, T cells in the peripheral lymphoid organs and blood are depleted. Despite this T cell deficiency, cortactin 1-deficient mice have a normal lifespan and do not show an increased incidence of opportunistic infections or spontaneous cancers. However, the absence of cortactin 1 induces prolonged survival of MHC-mismatched organ grafts and resistance to the development of autoimmune disorders (Jayachandran, R. et al., Immunity, 2019.50: pp. 1-15.; Siegmund, K. et al., J Immunol, 2011.186(6): pp. 3452-61). These data further support that depletion of cortactin 1 levels in vivo will induce an immunosuppressive state, which will lead to prolonged survival of organ grafts, suppression of autoimmune diseases, and absence of any major complications of infections or malignancies. The expected side effects and toxicity are only minimal because cortactin 1 modulators mainly affect T cell-specific functionality and survival. In addition, immunity to microbial pathogens and cancer (including T cell-dependence) is maintained after cortactin 1 ablation (Jayachandran, R. et al., Immunity, 2019.50: pp. 1-15.).
[0021] The present inventors further identified bromodomain 3 (BRD3) as an upstream regulator of coronin 1 expression and identified new compounds that selectively target the bromodomain of BRD3 to inhibit coronin 1 expression. In other words, the compounds of the present invention deplete coronin 1 in cells (preferably immune cells) by inhibiting BRD3 to inhibit coronin 1 promoter activity. Thus, these compounds provide a novel method for inducing immunosuppression, allograft tolerance or preventing and / or treating transplant rejection, preferably allograft rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders via targeting BRD3 that results in coronin 1 depletion. In addition, since BRD3 has been shown to play a role in certain malignancies and their metastases (BRD3-driven nucleoproteins in NUT midline carcinoma (NMC), BRD3-driven ovarian clear cell carcinoma (OCCC), colorectal cancer, and rhabdomyosarcoma), these compounds may have potential applications in treating these tumor conditions (Ballenberger, M. et al., Chest, 2022. 161(1): pp. e43-e49. French, C. A. et al., Oncogene, 2008. 27(15): pp. 2237-42. Roberts, T. C. et al., Sci Rep, 2017. 7(1): p. 6153. Hsu, P. L. et al., Sci Adv, 2023. 9, eade3422.).
[0022] Because coronin 1 is also required for bacterial survival within macrophages (e.g., for Mycobacterium, Helicobacter, and Salmonella) (Jayachandran, R. et al., Cell, 2007. 130(1): pp. 37-50.; Jayachandran, R. et al., Immunity, 2019. 50: pp. 1-15.; Zheng, P. Y. and N. L. Jones, Cell Microbiol, 2003. 5(1): pp. 25-40.), reducing coronin 1 is a method of killing bacteria and treating and / or preventing infections and diseases caused by bacteria such as tuberculosis, gastric ulcers, gastric cancer, etc.
[0023] In addition, the present inventors designed a reporter-based screening assay to identify compounds that selectively inhibit coronin 1 promoter activity measured by a decrease in reporter gene expression (e.g., green fluorescent protein (GFP) signal). Assessment of inhibition of an unrelated promoter (e.g., the early cytomegalovirus promoter driving a different reporter gene (e.g., red fluorescent protein (RFP))) evaluated the specificity of the test compound for selectively inhibiting the coronin 1 promoter.
[0024] In one aspect, the present invention relates to a vector comprising a coronin 1 (coro1a) promoter element, wherein in the vertebrate genome, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene and spans a sequence segment of at least about 700 bp in the genome. Preferably, the coronin 1 promoter element spans a sequence segment of at least 1500 bp in the genome.
[0025] In another aspect, the present invention relates to a method for identifying a compound that modulates the activity of the coronin 1 promoter, the method comprising the steps of:
[0026] a. providing a host cell comprising the vector of the present invention, wherein the host cell is capable of expressing the promoter reporter gene of the vector;
[0027] b. exposing the host cell to a compound to be tested; and
[0028] c. measuring the expression of the coronin 1 promoter reporter gene in the host cell exposed to the compound to be tested.
[0029] In another aspect, the present invention relates to a cell comprising the vector of the present invention.
[0030] In one aspect, the present invention relates to a compound of formula (I):
[0031]
[0032] or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, wherein
[0033] R1 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl;
[0034] R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl;
[0035] R3 is selected from -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m-(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups.
[0036] Preferably, R1 is selected from phenyl and thienyl, where the phenyl is optionally substituted by one or more -O-C1-C6-alkyl groups. Preferably, R2 is selected from phenyl and thienyl, where the phenyl is optionally substituted by one or more optional substituents independently selected from -OH, -NO2 and -halogen. Preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups.
[0037] In another aspect, the present invention relates to a compound of formula (I):
[0038]
[0039] or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, where
[0040] R1 is selected from phenyl and thienyl, where the phenyl is optionally substituted by one or more -O-C1-C6-alkyl groups;
[0041] R2 is 3-hydroxyphenyl;
[0042] R3 is selected from -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m-(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups.
[0043] Preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups.
[0044] Preferably, the compounds of formula (I) are selected from:
[0045] Tetrahydro-2-furanylmethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1);
[0046] Methyl 4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2);
[0047] 2-(Ethylthio)ethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3);
[0048] Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (4);
[0049] Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5);
[0050] Tetrahydro-2-furanylmethyl 2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6);
[0051] Tetrahydro-2-furanylmethyl 2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7);
[0052] Methyl 4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8);
[0053] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9);
[0054] Tetrahydro-2-furanylmethyl 4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10);
[0055] Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11);
[0056] Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12);
[0057] Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13);
[0058] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14);
[0059] Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15);
[0060] Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16);
[0061] 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17);
[0062] Methyl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate)(tetrahydro-2H-pyran-4-yl) (18);
[0063] Methyl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate)(2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl) (19);
[0064] Oxetan-3-yl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (20);
[0065] tert-Butyl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (21);
[0066] Methyl 7-(4-chlorophenyl)-4-(3-hydroxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (22);
[0067] Tetrahydrofuran-3-yl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (50);
[0068] (4-Methyltetrahydro-2H-pyran-4-yl) (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (51);
[0069] (2,2,6,6-Tetramethyltetrahydro-2H-pyran-4-yl) (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (52);
[0070] (8-Oxabicyclo[3.2.1]octan-3-yl) (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (53)
[0071] Oxepan-4-yl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (54);
[0072] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid hexahydrofuro[2,3-b]furan-3-yl ester (55);
[0073] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid cyclopentyl ester (56);
[0074] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid cyclohexyl ester (57);
[0075] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid ethyl ester (58);
[0076] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid butyl ester (59);
[0077] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid neopentyl ester (60);
[0078] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 2-ethylbutyl ester (61);
[0079] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 2,2-dimethylbutyl ester (62);
[0080] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 4,4-dimethylpentyl ester (63);
[0081] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 2-(2-ethoxyethoxy)ethyl ester (64);
[0082] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 2-(2-(2-(hexyloxy)ethoxy)ethoxy)ethyl ester (65);
[0083] 4-(4-Fluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydro-2H-pyran-4-yl ester (66); and
[0084] 4-(2,4-Difluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydro-2H-pyran-4-yl ester (67).
[0085] Particularly preferred compounds of formula (I) are
[0086] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylic acid tetrahydro-2-furanyl methyl ester (12e-S and 12g-R);
[0087] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylic acid tetrahydro-2H-pyran-4-yl ester (13a);
[0088] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydrofuran-3-yl ester (50a-S and 50b-R).
[0089] Even more particularly preferred compounds of formula (I) are:
[0090] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydro-2H-pyran-4-yl ester (13a).
[0091] On the other hand, the present invention relates to a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, and a pharmaceutically acceptable carrier.
[0092] The present invention also relates to a method for preparing a compound of formula (I), which method comprises a step (b) of asymmetric reduction of a pyridine motif via enantioselective partial transfer hydrogenation.
[0093] In another aspect, the present invention relates to a compound of formula (I) or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, for use as a medicament.
[0094] In another aspect, the present invention relates to a compound of formula (I) or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, for use in inhibiting coronin 1 expression in inducing immunosuppression or in the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders.
[0095] In another aspect, the present invention relates to a BRD3-selective bromodomain inhibitor for use in the treatment or prevention of a disease that would benefit from BRD3 inhibition directly or indirectly via reducing the expression of coronin 1.
[0096] In another aspect, the present invention relates to a compound of formula (I) or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, for use in the treatment or prevention of a disease that would benefit from BRD3 inhibition directly or indirectly via reducing the expression of coronin 1:
[0097]
[0098] wherein
[0099] R1 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl;
[0100] R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl,
[0101] Preferably, R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen;
[0102] R3 is selected from -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl), wherein m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, wherein the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups
[0103] Preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, wherein the cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups. Other aspects and embodiments of the present invention will become apparent as the specification continues. In the following sections, we describe figures outlining coronin 1 promoter characterization, development of a screening assay based on the coronin 1 promoter, identification of coronin 1 promoter inhibitory compounds and their validation, optimization, safety and therapeutic efficacy in an autoimmune-inflammatory model of psoriasis. BRIEF DESCRIPTION OF THE DRAWINGS
[0104] Figure 1 : Cartoon representation of the various coronin 1 promoter constructs generated and their characterization of luciferase activity in the J774 macrophage cell line. TSS: Transcription start site. Luciferase activity of J774 macrophages transfected with the indicated plasmid constructs of the coronin 1 promoter was evaluated. Control: Cells transfected with empty pGL plasmid (row 1) and pGL-SV40 positive control (row 2).
[0105] Figure 2: Principle of the screening assay for the coronin 1 promoter of the present invention: The promoter of the vertebrate (in this case, mouse) coronin 1 gene (coro1a) was cloned upstream of the coding region of destabilized green fluorescent protein (GFP). The red fluorescent protein (RFP) driven by the CMV promoter serves as an internal control for non-specific promoter inhibition. These constructs were stably transfected into rat basophilic leukemia (RBL) cells and treated with small molecule compounds from a chemical library.
[0106] Figure 3: (A) Selective reduction of the coronin 1 promoter drives GFP as imaged by confocal microscopy after incubation with compound 11 (10 μg / ml) for 48 hours. DMSO serves as a negative control. (B) Quantitative PCR analysis of coronin 1 mRNA after incubation of RBL cells with compound 11 (3.5 μg / ml) for 7 days shows a reduction in coronin 1 transcripts. DMSO serves as a vehicle control. (C) Analysis of native coronin 1 promoter inhibition by western blotting of the RBL cell line treated with compound 11 using a chemiluminescent imager. Compound 11 shows up to approximately 80% depletion of coronin 1 levels and is verified as a true modulator of coronin 1 expression.
[0107] Figure 4 : Overlap of the GFP FACS profiles of GFP-RBL cells treated with calcium channel inhibitors. Flow cytometry-based assessment of GFP fluorescence from RBL-GFP cells that have been incubated with the calcium channel blockers amlodipine (3.125 μM, right panel) and verapamil (8 μM, left panel) for 48 hours. Neither of the two calcium channel blockers inhibits coronin 1 promoter activity as assessed by GFP reduction.
[0108] Figure 5: In vitro and in vivo toxicological evaluations of coronin 1 promoter inhibitors reveal that they are safe. In vitro toxicity analysis using the coronin 1 expression inhibitor 11 in RBL cells by the Alamar blue assay (A) and the MTT assay (B) reveals minimal toxicity. Positive control: cycloheximide (1 μg / ml), vehicle control: DMSO.
[0109] Figure 6: Assessment of in vivo toxicity by analyzing hematological parameters in mouse blood using the ADVIA platform six days after administration of Compound 11 showed good safety and tolerability (150 mg / kg / body weight, BD, IP). The various parameters monitored included red blood cell (RBC) count (A), white blood cell (WBC) count (B), platelet count (C), and hemoglobin level (D) relative to the vehicle (DMSO) treatment group. (E) Compound 11 was administered in vivo to mice daily for 14 days, and the change in body weight was monitored relative to Day 0 as a measure of overall health status and tolerability to Compound 11 (150 mg / kg / body weight, BD, IP). DMSO was used as the vehicle control.
[0110] Figure 7 : Coronin 1 was depleted in mice in vivo with Compound 11. In vivo administration of 11 depleted the coronin 1 level by 40%. Compound 11 was administered in vivo via the subcutaneous route in a Miglyol- and Kolliphor-based vehicle for 6 days (150 mg / kg / body weight, BD, SC), the mice were sacrificed at the end, and the coronin 1 level in spleen lysates was detected using an infrared dye-labeled secondary antibody and imaged using the Licor system. Left panel: Western blot using an infrared-based Licor imaging system. Actin served as the loading control. Right panel: Quantification of the reduction in coronin 1 by ratio analysis relative to the actin band intensity.
[0111] Figure 8: Coronin 1 was depleted in human PBMCs by Compound 11 and production of pro-inflammatory cytokines was inhibited. (A) Incubation of human peripheral blood mononuclear cells (PBMCs) with a coronin 1 expression inhibitor (Compound 11, 10 μg / ml) for a duration of 5 days resulted in coronin 1 depletion, as assessed by Western blot. (B) Flow cytometry analysis of PBMC cell viability after incubation for a duration of 5 days with a coronin 1 expression inhibitor (Compound 11, 10 - 20 μg / ml). (C) Incubation of PBMCs with the coronin 1 expression inhibitor Compound 11 (10 μg / ml) for a duration of 4.5 days attenuated the immune response in CD4 and CD8 T cells, as assessed by the production of interleukin-2 (IL-2) after T cell receptor stimulation with CD3 and CD28 antibodies in human PBMCs, as assessed by flow cytometry. DMSO and medium served as internal controls.
[0112] Figure 9: (A - C) Composition of isomers of individual mixtures and fractions of parent compounds 11, 12, and 13.
[0113] Figure 10: One of the (4S,7R)-configurational isomers of compound 12 (named compound 12e) showed inhibition of the mixed lymphocyte response (MLR) of human peripheral blood mononuclear cells, as shown by a decrease in tritiated thymidine uptake, indicating its immunosuppressive activity in the context of human allogeneic immune responses.
[0114] Figure 11 : Western blot of cell lysates and Western blot analysis using the RBL cell line of coronin 1 levels after incubation with the indicated compounds. In the RBL cell line, by Western blot, compounds 12, 12e, and 13a (2 μg / ml) showed coronin 1 depletion.
[0115] Figure 12: (A) As seen from the disease scores on day 4 in the imiquimod-induced psoriasis mouse model (evaluated according to erythema, affected surface area, and psoriasis plaque formation), compound 13a (50 mg / kg body weight, twice daily, topical route) inhibited the severity of the autoimmune-inflammatory disease. DMSO was used as a vehicle control. n = 7 mice / group. (B) GvHD study using compound 13a (50 mg / kg body weight, twice daily, subcutaneous route). On day 7, inhibition of allogeneic antigen-driven CD4 (left) and CD8 T cell (middle) expansion was analyzed by cell trace violet dye dilution and splenomegaly (right panel). Each point represents an individual animal (n = 5 mice / group). Representative of 2 independent studies.
[0116] Figure 13 : Thermal proteome profiling (TPP) identified BRD3 as a molecular target: The target of action of the compound has been identified using a procedure called thermal proteome profiling. This procedure identified that the compound interacts with and significantly stabilizes BRD3, with a q-value of 0.0007. In the presence of compound 12e at a concentration of 6 μM, the thermal denaturation of the target increased by more than four degrees Celsius. No significant thermal stabilization of BRD2 (q-value NS) and BRD4 (q-value NS) was noted, although a higher number of unique peptides of BRD2 and BRD4 relative to BRD3 were detected.
[0117] Figure 14: (A) Validation of the TPP-identified target using an siRNA-based method: Brd3 siRNA (target-specific siRNA) was transfected into RBL GFP (rat basophilic leukemia cell line expressing green fluorescent protein under the coronin 1 promoter), and after 72 hours, the GFP fluorescence level was evaluated by flow cytometry as a measure of the decrease in coronin 1 promoter activity. A significant decrease in GFP fluorescence driven by the coronin 1 promoter was observed after transfection with the target-specific siRNA.
[0118] (B) Validation of TPP-identified targets using CRISPR / Cas9-based methods: The expression levels of coronin 1 and BRD3 proteins were analyzed by flow cytometry-based analysis of a series of RBL cell line clones, with median fluorescence intensity (MFI), which were either gene-edited (using CRISPR / Cas9) or not on the brd3 gene.
[0119] Figure 15 : Validation of BRD3 as a target directly engaging with compounds using bromoscan: The direct and competitive binding of compounds 12e and 13a to BRD3 was evaluated using the bromoscan platform at Eurofins. This analysis revealed that compounds 12e and 13a bind to bromodomains BD1 and BD2 in BRD3 with a higher affinity for the BD2 domain, as shown by the lower Kd value for the BRD3 BD2 domain.
[0120] Figure 16 : Co-crystallization study of compound 13a with the bromodomain of BRD3: The crystal structures of compound 13a bound to BD1 (left, 1.4) and BD2 (right, 2) of human BRD3 revealed that the compound protrudes deeply into the histone-binding pocket and thus competes spatially with the acetylated lysine of the histone recognized by this pocket. In BD2, the ligand strongly interacts with the phenolic ring with residues His395 and Glu396, neither of which is present in BD1. The protein is represented as a cartoon, and the residues involved in ligand binding are represented as sticks. Double bonds are not shown. Water: 'w'.
[0121] Figure 17 : Psoriasis disease scores of wild-type K5.Stat3 mice that were tape-stripped and either untreated (only tape-stripped) or treated with vehicle or compound 11 (75 mg / kg / body weight, twice daily). N = 6 mice / group.
[0122] Figure 18 : DSS-induced colitis model: Wild-type mice were either untreated (UT) or administered drinking water containing 2.5% dextran sulfate sodium (DSS) and treated with vehicle or compound 12 (100 mg / kg / body weight, twice daily, subcutaneous route), and the disease activity was scored on day 5 after disease induction. N = 4 mice / group.
[0123] Figure 19:(A) Methicillin-resistant Staphylococcus aureus (MRSA) infection model study. Wild-type mice were infected with MRSA and treated subcutaneously with compound 13a (50 mg / kg / body weight, BD), FK506 (5 mg / kg / body weight, BD), or tofacitinib (50 mg / kg / body weight, BD), and the bacterial load was evaluated. (B) Candida albicans infection model study. Wild-type mice were infected with Candida albicans and treated subcutaneously with compound 13a (50 mg / kg / body weight, BD), FK506 (5 mg / kg / body weight, BD), or dexamethasone (100 mg / kg / body weight, BD), and the fungal load was evaluated. (C) Mycobacterial survival in macrophage studies. Lysosomal localization of Mycobacterium bovis-BCG-GFP in compound 11-treated J774 macrophages. Lysosomal delivery of mycobacteria in macrophages was quantified at the indicated concentrations of compound 11. Rapid lysosomal delivery indicates lysosomal degradation and death of mycobacteria. Three independent experiments, n = 50 - 70 per condition.
[0124] In summary, the in vitro and in vivo data shown in Figures 8 to Figure 19 reveal that the coronin 1 promoter screening assay identified inhibitory compounds that bind to the hydrophobic cavity within the two bromodomains of BRD3 (preferably its BD2 bromodomain), thereby regulating coronin 1 promoter activity and coronin 1 expression to induce heterologous-selective and autoimmunity-selective immunosuppressive and anti-inflammatory activities. Detailed Description
[0125] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0126] Throughout the specification and the following claims, unless the context requires otherwise, the word "comprise" and its variations (such as "comprises" and "comprising") will be understood to imply the inclusion of the stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.
[0127] Unless the context clearly dictates otherwise, as used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural references.
[0128] When used in connection with a numerical value, the term "about" means to cover a numerical value within a range having a lower limit that is 0% - 10% less than the indicated numerical value and an upper limit that is 0% - 10% greater than the indicated numerical value.
[0129] As used herein, the term "alkyl" refers to a monovalent saturated acyclic (i.e., non-cyclic) hydrocarbon group that may be straight-chain or branched-chain. Thus, an "alkyl" group does not contain any carbon-carbon double bonds or any carbon-carbon triple bonds. "C 1-8 alkyl" denotes an alkyl group having from 1 to 8 carbon atoms. Preferred C 1-8 alkyl is C 1-6 alkyl. As used herein, "C1-C6-alkyl" preferably refers to a straight-chain or branched-chain C1-C6-alkyl, which may be, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, straight-chain or branched-chain pentyl, straight-chain or branched-chain hexyl. Preferred C1-C6-alkyl is C1-C4-alkyl, and more preferably C1-C3-alkyl. Unless otherwise defined, the term "alkyl" preferably refers to C 1-4 alkyl, more preferably methyl or ethyl, and even more preferably methyl.
[0130] As used herein, "O-C1-C6-alkyl" preferably refers to a "substituted hydroxy" of the formula (-OR'), where R' is C1-C 6- alkyl as defined herein, and the oxygen moiety is directly attached to the parent molecule, and thus as used herein, the term "O-C1-C6-alkyl" refers to a straight-chain or branched-chain C1-C6-alkoxy, which may be, for example, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy, tert-butoxy, straight-chain or branched-chain pentyloxy, straight-chain or branched-chain hexyloxy. Preferred O-C1-C6-alkyl is O-C1-C 4- alkyl.
[0131] The term "alkylene" preferably refers to an alkanediyl, i.e., a divalent saturated acyclic hydrocarbon group, which may be straight-chain or branched-chain. "C 1-6 alkylene" denotes an alkylene group having from 1 to 6 carbon atoms. Preferred exemplary alkylene groups are methylene (-CH2-), ethylene (e.g., -CH2-CH2- or -CH(-CH3)-), propylene (e.g., -CH2-CH2-CH2-, -CH(-CH2-CH3)-, -CH2-CH(-CH3)- or -CH(-CH3)-CH2-) or butylene (e.g., -CH2-CH2-CH2-CH2-). Unless otherwise defined, the term "alkylene" preferably refers to C 2-4 alkylene (specifically including straight-chain C 2-4 alkylene), more preferably methylene or ethylene, and even more preferably methylene.
[0132] As used herein, "halogen" preferably refers to fluorine (fluoro group, -F), chlorine (chloro group, -Cl), bromine (bromo group, -Br), and iodine (iodo group, -I). Preferably, it refers to fluorine, chlorine, or bromine. Correspondingly, this also applies to halogen in combination with other meanings, such as haloalkyl.
[0133] As used herein, the term "cycloalkyl" preferably refers to a saturated hydrocarbon ring group, including monocyclic as well as bridged, spiro, and / or fused ring systems (which can consist of, for example, two or three rings; for example, a fused ring system consisting of two or three fused rings). "Cycloalkyl" can refer to, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, decahydronaphthyl (i.e., decahydro-naphthyl), or adamantyl. Unless otherwise defined, "cycloalkyl" preferably refers to C 3-11 cycloalkyl, and more preferably refers to C 3-6 cycloalkyl. Particularly preferred "cycloalkyl" is a monocyclic saturated hydrocarbon ring having 3 to 6 ring members (for example, cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl).
[0134] As used herein, the term "oxygen-containing saturated heterocyclic group" preferably refers to a fully saturated 5- to 14-membered ring system group containing 1 to 2 oxygen atoms and not containing any other atoms other than C, H, and O. The heterocyclic group can be monocyclic or two or more fused rings, where at least one ring contains an oxygen atom. Preferably, as used herein, the term "oxygen-containing saturated heterocyclic group" refers to a fully saturated 4- to 7-membered monocyclic system group containing 1 to 2 oxygen atoms and not containing any other atoms other than C, H, and O. Examples of monocyclic oxygen-containing saturated heterocyclic moieties are given below: oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 8-oxabicyclo[3.2.1]octan-3-yl, hexahydrofuro[2,3-b]furan-3-yl, and oxepanyl.
[0135] When a group is said to be optionally substituted, it can bear one or more substituents, for example one, two, three, or four substituents. It should be understood that the maximum number of substituents is limited by the number of available attachment sites on the substituted moiety. Preferably, there are 1 to 4 substituents optionally present, more preferably 1 to 3 substituents optionally present, still more preferably 1 or 2 substituents optionally present, and most preferably 1 substituent optionally present. When a group is considered to be optionally substituted and there are more than one substituent for the optional substitution of the group, the more than one substituent can be the same or different. As those skilled in the art will understand, the expression "substituted by" in, for example, "A is substituted by B" does not mean that B replaces A, but rather at least one hydrogen atom of A is replaced by at least one group B. Thus, the expression "substituted by" is equivalent to the expression "substituted with".
[0136] The compounds of the present invention may have one or more optically active carbon atoms and may thus exist as racemic mixtures, stereoisomers, diastereoisomers or enantiomers. All isomeric forms are included in the present invention. Compounds having one or more optically active carbon atoms may exist as individual stereoisomers, diastereoisomers or enantiomers. Alternatively, mixtures thereof may be provided, such as racemic mixtures or mixtures containing an excess of one of the stereoisomers, diastereoisomers or enantiomers compared to stereoisomers, diastereoisomers or enantiomers having different orientations at one or more optically active carbon atoms. Preferably, mixtures of the compounds of the present invention are characterized by an enantiomeric excess of at least 90%, more preferably at least 95%, even more preferably at least 96% of a particular isomer relative to its enantiomer.
[0137] The term "polymorph" refers to compounds of the present invention that can exist in two or more crystal structures. Salts can also be crystalline and can exist in more than one polymorph.
[0138] The present invention also includes solvates (including hydrates) and anhydrous forms of salts. The solvent contained in the solvate is not particularly limited and can be any pharmaceutically acceptable solvent. Examples include water and C 1-4 alcohols (such as methanol or ethanol).
[0139] "Pharmaceutically acceptable salts" are defined as derivatives of the compounds of the present invention in which the parent compound is modified by preparing its acid or base salts. A list of suitable salts can be found in Remington’s Pharmaceutical Sciences, 18th Edition, Mack Publishing Company, Easton, PA, 1990, page 1445, the disclosure of which is hereby incorporated by reference.
[0140] The terms "treating" and / or "treatment" refer to the management and care of a patient having a medical condition such as a viral infection or other disorder, with the purpose of combating or alleviating the symptoms and complications of those conditions, and indicating the administration of one or more therapeutic compounds. Treatment includes the administration of one or more formulations of the present invention to prevent the onset of symptoms or complications, alleviate symptoms or complications, or eliminate a disease, disorder or condition. As used herein, "treatment" or "therapy" refers to both therapeutic treatment and prophylactic or preventive measures. The effect can be therapeutic in terms of partially or completely curing a disease or condition and / or the symptoms attributable to the disease or condition. The term refers to inhibiting a disease or condition, i.e., preventing its progression; or ameliorating a disease or condition, i.e., causing regression of the disease or condition or alleviating symptoms.
[0141] As used herein, the term "prevention" refers to means for preventing or delaying the onset of a disease or condition and / or symptoms attributable to a disease or condition.
[0142] The terms "disease" and "disorder" are used interchangeably herein and refer to an abnormal condition, particularly an abnormal medical condition such as an ailment or injury in which a tissue, organ or individual is no longer able to effectively perform its function. Usually, but not necessarily, a disease is associated with specific symptoms or signs indicating the presence of such disease. Thus, the presence of such symptoms or signs may indicate a tissue, organ or individual suffering from a disease. Alterations in such symptoms or signs may indicate the progression of such disease. The progression of a disease is typically characterized by an increase or decrease in such symptoms or signs, which may indicate "deterioration" or "improvement" of the disease. "Deterioration" of a disease is characterized by a decrease in the ability of a tissue, organ or organism to effectively perform its function, while "improvement" of a disease is typically characterized by an increase in the ability of a tissue, organ or individual to effectively perform its function. A tissue, organ or individual at "risk" of "developing" a disease is in a healthy state but shows a likelihood of the disease occurring. Usually, the risk of developing a disease is associated with early or weak signs or symptoms of such disease. In such cases, the onset of the disease can still be prevented by treatment. Examples of diseases include, but are not limited to, transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders.
[0143] As used herein, the term "subject" or "animal" or "patient" or "mammal" refers to any subject in need of diagnosis, prognosis, prevention or treatment, particularly a mammalian subject such as a human or a domesticated mammal such as a dog, cat or horse, or a food animal such as a cow, sheep or pig, preferably a human.
[0144] As used herein, the term "for" as used in "a composition for treating a disease" will also disclose the corresponding method of treatment and the corresponding use of the formulation in the manufacture of a medicament for treating a disease.
[0145] A "therapeutically effective amount" or "effective amount" is an amount of a compound or pharmaceutical composition according to the invention which will elicit the biological or medical response sought by a researcher, veterinarian, physician or other clinician in a subject (preferably a human subject). As used herein, the term "therapeutic administration" shall refer to the administration of a therapeutically effective amount.
[0146] As used herein, the term "promoter" or "promoter sequence" or "promoter element" refers to a nucleic acid sequence capable of directing the transcription of a gene. The term coronin 1 (coro1a, e.g., NCBI mouse gene ID: 12721; human gene ID: 11151, rat gene ID: 155151 and other vertebrates) promoter, promoter sequence or promoter element is capable of directing the transcription of the coro1a gene. The coronin 1 promoter is preferably a vertebrate coronin 1 promoter, more preferably a mammalian coronin 1 promoter, still more preferably a human, rat, mouse, bovine, dog, bovine, hamster coronin 1 promoter, still more preferably a human, rat, mouse coronin 1 promoter.
[0147] As preferably understood herein, whenever reference is made to a compound or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, it is preferred to refer to the compound or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer or isomer and mixture thereof, more preferably to refer to the compound or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer or enantiomer thereof, and even more preferably to refer to the compound or a pharmaceutically acceptable salt thereof. It is understood that the term "mixture" encompasses, but is not limited to, a racemic mixture of a compound or a pharmaceutically acceptable salt thereof.
[0148] As further preferably understood herein, whenever reference is made to a compound of formula (I), it is preferred to refer to the compound of formula (I) or a pharmaceutically acceptable salt thereof.
[0149] In a first aspect, the present invention relates to a vector comprising a coronin 1 (coro1a) promoter element, wherein in a vertebrate genome, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene and spans a sequence segment of at least about 700 bp in the genome.
[0150] As used herein, the term "vector" refers to at least one nucleic acid molecule. It is used as a vehicle for the artificial transfer of nucleic acids and genetic material. The vector can be a single-stranded (ss) or double-stranded (ds) closed or open nucleic acid molecule. In the case where the vector is ss, the length specification should be understood as nucleotides (nt) or bases; in the case where the vector is ds, the length specification should be understood as base pairs (bp). The term vector includes expression cassettes, plasmids, viral vectors, phagemids, phages, cosmids and artificial chromosomes (such as YAC, BAC and PAC, etc.), expression vectors and cloning vectors. In a preferred embodiment, the vector is a plasmid.
[0151] In a preferred embodiment, the vector further comprises a coronin 1 promoter reporter gene, wherein the coronin 1 promoter element is operably linked to the coronin 1 promoter reporter gene.
[0152] The phrase "operably linked" means that sequences such as a gene and a promoter are in a functional combination, i.e., the promoter is positioned appropriately to regulate and preferably initiate transcription of the coding gene. A reporter gene is a readout gene that is operably linked to a promoter to indicate the activity of the promoter, preferably in a semi - quantitative or quantitative manner.
[0153] The coronin 1 promoter element has a length of at least about 700 bp, wherein the coronin 1 promoter element is located directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome. The coronin 1 promoter element having a length of at least about 700 bp spans a sequence segment in the vertebrate genome from the base pair located directly upstream (5') of the TSS to the base pair located at least about 700 bp upstream of the TSS.
[0154] The transcription start site is the sequence at which transcription begins and is located at the 5' end of the gene sequence.
[0155] In a more preferred embodiment, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence segment of at least about 700 bp to about 3000 bp. In yet a more preferred embodiment, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence segment of at least about 700 bp to about 1500 bp. In yet a more preferred embodiment, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence segment of about 700 bp.
[0156] In a more preferred embodiment, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence segment of at least 700 bp. In a more preferred embodiment, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence segment of at least 737 bp. In a more preferred embodiment, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence segment of at least 700 bp to 3000 bp. In yet a more preferred embodiment, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence segment of at least 700 bp to 1530 bp. In yet a more preferred embodiment, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence segment of at least 737 bp to 1530 bp. In yet a more preferred embodiment, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome and spans a sequence segment of approximately 737 bp.
[0157] In a preferred embodiment, the coronin 1 promoter element has a length of about at least about 700 bp to about 3000 bp, wherein the coronin 1 promoter element is directly located upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome. In a more preferred embodiment, the coronin 1 promoter element has a length of about at least about 700 bp to about 1500 bp, wherein the coronin 1 promoter element is directly located upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome. In yet a more preferred embodiment, the coronin 1 promoter element has a length of about 700 bp, wherein the coronin 1 promoter element is directly located upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome.
[0158] In yet a more preferred embodiment, the coronin 1 promoter element has a length of at least 700 bp. In a preferred embodiment, the coronin 1 promoter element has a length of at least 700 bp to 3000 bp. In a more preferred embodiment, the coronin 1 promoter element has a length of at least 700 bp to 1530 bp. In yet a more preferred embodiment, the coronin 1 promoter element has a length of 737 bp.
[0159] The coronin 1 promoter is preferably a vertebrate coronin 1 promoter; more preferably a mammalian coronin 1 promoter, and even more preferably a human, rat or mouse coronin 1 promoter.
[0160] In one embodiment, the vector contains a coronin 1 promoter, which contains the coronin 1 promoter element, that is, the coronin 1 promoter element is contained in the coronin 1 promoter.
[0161] In a preferred embodiment, the coronin 1 promoter element is a sequence having at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, even more preferably at least 99%, even more preferably at least 100% identity with a sequence selected from the group consisting of SEQ ID NO: 1-6.
[0162] In a preferred embodiment, the coronin 1 promoter element is a sequence having at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, even more preferably at least 99%, even more preferably at least 100% identity with a sequence selected from the group consisting of SEQ ID NO: 4-6.
[0163] Preferably, the coronin 1 promoter element having at least 40%, preferably at least 50%, more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, even more preferably at least 99%, even more preferably at least 100% identity with the sequence of SEQ ID NO: 1-6 or the sequence of SEQ ID NO: 4-6 retains coronin 1 promoter activity, that is, it can drive coronin 1 expression in any expression system. Preferably, the expression system is a eukaryotic expression system, more preferably a vertebrate expression system, and even more preferably a mammalian expression system.
[0164] In another preferred embodiment, the coronin 1 promoter element is a sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, and 6. In a further preferred embodiment, the coronin 1 promoter element is a sequence selected from SEQ ID NO: 1, 2, and 3. In an alternative preferred embodiment, the coronin 1 promoter element is a sequence selected from SEQ ID NO: 4, 5, and 6. In another alternative preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 1. In another alternative preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 2. In another alternative preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 3. In another alternative preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 4. In another alternative preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 5. In another alternative preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 6.
[0165] In another preferred embodiment, the vector further comprises a second promoter and a second promoter reporter gene. Preferably, the second promoter is different from the coronin 1 promoter.
[0166] The second promoter can be any promoter. Preferably, the second promoter is different from the coronin 1 promoter. Preferably, the promoter other than the coronin 1 promoter is a constitutively active or ubiquitously active promoter. In a further preferred embodiment, the second promoter is selected from the group consisting of: viral promoters, actin promoters, clathrin promoters, and early cytomegalovirus (CMV) promoters. In a further preferred embodiment, the second promoter is the early cytomegalovirus (CMV) promoter.
[0167] In a preferred embodiment, the vector further comprises a second promoter and a second promoter reporter gene, wherein the second promoter is different from the coronin 1 promoter, and the second promoter reporter gene is the same as or different from the coronin 1 promoter reporter gene. More preferably, the second promoter is different from the coronin 1 promoter, and the second promoter reporter gene is different from the coronin 1 promoter reporter gene. Then, independent readouts of the two reporter genes are possible.
[0168] In another embodiment, the second promoter reporter gene is the same as the coronin 1 promoter reporter gene, and the vector comprises a first plasmid and a second plasmid, wherein the coronin 1 promoter and the coronin promoter reporter gene are on the first plasmid, and the second promoter and the second promoter reporter gene are on the second plasmid.
[0169] In a preferred embodiment, the vector comprises a first plasmid and a second plasmid, wherein the coronin 1 promoter and the coronin promoter reporter gene are on the first plasmid, and the second promoter and the second promoter reporter gene are on the second plasmid. Preferably, the second promoter is different from the coronin 1 promoter. More preferably, the second promoter is different from the coronin 1 promoter, and the second promoter reporter gene is different from the coronin 1 promoter reporter gene.
[0170] In a preferred embodiment, the coronin 1 promoter, the coronin 1 promoter reporter gene, the second promoter and the second promoter reporter gene are on the same plasmid. Preferably, the second promoter is different from the coronin 1 promoter. More preferably, the second promoter is different from the coronin 1 promoter, and the second promoter reporter gene is different from the coronin 1 promoter reporter gene.
[0171] In a preferred embodiment, the coronin 1 promoter and the coronin 1 promoter reporter gene are contained in a first expression cassette, and the second promoter and the second promoter reporter gene are contained in a second expression cassette, wherein preferably the second promoter is different from the coronin 1 promoter, more preferably the second promoter is different from the coronin 1 promoter, and the second promoter reporter gene is different from the coronin 1 promoter reporter gene.
[0172] In a preferred embodiment, the coronin promoter reporter gene and the second promoter reporter gene are selected from the group consisting of: genes encoding fluorescent proteins such as green fluorescent protein (GFP), red fluorescent protein (RFP), destabilized GFP or destabilized RFP; β-galactosidase; chloramphenicol acetyltransferase; alkaline phosphatase, secreted embryonic alkaline phosphatase (SEAP), and luciferase. In a preferred embodiment, the coronin promoter reporter gene and the second promoter reporter gene are different and are selected from the group consisting of: genes encoding fluorescent proteins such as green fluorescent protein (GFP), red fluorescent protein (RFP), destabilized GFP or destabilized RFP; β-galactosidase; chloramphenicol acetyltransferase; alkaline phosphatase, secreted embryonic alkaline phosphatase (SEAP), and luciferase. In a preferred embodiment, the coronin 1 promoter reporter gene and the second promoter reporter gene are based on fluorescence, luminescence, or protein expression, more preferably based on fluorescence. In a preferred embodiment, the coronin 1 promoter reporter gene and the second promoter reporter gene are different and are based on fluorescence, luminescence, or protein expression, more preferably based on fluorescence.
[0173] In a preferred embodiment, one of the coronin promoter reporter gene and the second promoter reporter gene encodes a red fluorescent protein, and the other promoter reporter gene encodes a green fluorescent protein. In a particularly preferred embodiment, one of the coronin promoter reporter gene and the second promoter reporter gene encodes GFP, preferably destabilized GFP, and the other encodes RFP, preferably destabilized RFP.
[0174] In a preferred embodiment, one of the coronin promoter reporter gene and the second promoter reporter gene encodes a fluorescent or luminescent protein, and the second promoter is the early cytomegalovirus (CMV) promoter. In a preferred embodiment, one of the coronin promoter reporter gene and the second promoter reporter gene encodes a fluorescent protein, and the second promoter is the early cytomegalovirus (CMV) promoter. In a preferred embodiment, one of the coronin promoter reporter gene and the second promoter reporter gene encodes a red fluorescent protein, and the other promoter reporter gene encodes a green fluorescent protein, and the second promoter is the early cytomegalovirus (CMV) promoter. In a particularly preferred embodiment, the second promoter is the early cytomegalovirus (CMV) promoter, one of the coronin promoter reporter gene and the second promoter reporter gene encodes GFP, preferably destabilized GFP, and the other encodes RFP, preferably destabilized RFP.
[0175] In a preferred embodiment, the coronin 1 promoter element that starts directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome spans a segment of at least about 700 bp to about 1500 bp in the genome, preferably the coronin 1 promoter element spans a segment of at least about 700 bp in the genome, and the second promoter is the early cytomegalovirus (CMV) promoter. In a preferred embodiment, the coronin 1 promoter element that starts directly upstream of the transcription start site (TSS) of the coronin 1 gene in the vertebrate genome spans a segment of at least about 700 bp to about 1500 bp in the genome, preferably the coronin 1 promoter element spans a segment of at least about 700 bp in the genome, and the second promoter is the early cytomegalovirus (CMV) promoter, and the promoter reporter gene encodes a fluorescent or luminescent protein, preferably, one of the promoter reporter genes encodes a red fluorescent protein and the other promoter reporter gene encodes a green fluorescent protein.
[0176] In a preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 4, 5 or 6, and the second promoter is the early cytomegalovirus (CMV) promoter. In a preferred embodiment, the coronin 1 promoter element is the sequence of SEQ ID NO: 4, 5 or 6, and the second promoter is the early cytomegalovirus (CMV) promoter, and the promoter reporter gene encodes a fluorescent or luminescent protein, preferably one of the promoter reporter genes encodes a red fluorescent protein and the other promoter reporter gene encodes a green fluorescent protein.
[0177] In a particularly preferred embodiment, the vector of the present invention comprises a first expression cassette and a second expression cassette, the first expression cassette comprises a coronin 1 promoter and a coronin promoter reporter gene, the second expression cassette comprises a second promoter and a second promoter reporter gene, wherein one of the coronin promoter reporter gene and the second promoter reporter gene encodes GFP, preferably destabilized GFP, and the other encodes RFP, preferably destabilized RFP, and the second promoter is the early cytomegalovirus (CMV) promoter, wherein the first expression cassette and the second expression cassette are located on the same plasmid or different plasmids. Further preferably, the first expression cassette and the second expression cassette are located on different plasmids.
[0178] In a preferred embodiment, the vector of the present invention is contained in a cell, preferably a vertebrate cell, more preferably a mammalian cell, even more preferably a human or mouse cell. In another preferred embodiment, the vector of the present invention is contained in a mammalian immune cell, more preferably a rat basophilic leukemia (RBL) cell.
[0179] The present inventors have developed a cell-based screening assay using which compounds that deplete coronin 1 protein levels by inhibiting the promoter activity of the gene encoding coronin 1 (coro1a) can be identified. In one exemplary embodiment, the assay involves the use of a genetically engineered immune cell line, namely the rat basophilic leukemia (RBL) cell line, in which the expression of destabilized green fluorescent protein (GFP) is under the control of the coronin 1 gene promoter. The GFP gene is used as a promoter reporter gene to read out promoter activity. The coronin 1 promoter element spans approximately 700 bp to approximately 3000 bp (737 bp, 1530 bp, 3000 bp) upstream of the transcription start site of the coronin 1 gene. As an internal control for non-specific promoter inhibition and assessment of cytotoxicity, RBL cells are transfected with a plasmid that drives the expression of destabilized red fluorescent protein (RFP) via the early cytomegalovirus (CMV) promoter. Any compound that selectively reduces GFP fluorescence without altering RFP is considered an inhibitor of coronin 1 expression.
[0180] In a preferred embodiment, the coronin 1 promoter sequence of the present invention is an isolated nucleic acid.
[0181] In another aspect, the present invention relates to a cell, preferably a eukaryotic cell, more preferably a mammalian cell, that contains the vector of the present invention. In a preferred embodiment, the coronin 1 promoter of the vector of the present invention can be transcribed and translated. Preferably, the mammalian cell of the present invention is a mammalian immune cell. More preferably, the mammalian cell of the present invention is a rat basophilic leukemia (RBL) cell or any cell that expresses coronin 1.
[0182] In another aspect, the present invention relates to a method for identifying a compound that modulates the activity of the coronin 1 promoter, the method comprising the steps of:
[0183] (i) providing a host cell that contains the vector of the present invention, wherein the host cell is capable of expressing the promoter reporter gene;
[0184] (ii) subjecting the host cell to a compound to be tested; and
[0185] (ii) measuring the expression of the coronin 1 promoter reporter gene in the host cell that has been subjected to the compound to be tested.
[0186] In a preferred embodiment, the step of providing a host cell that contains the vector of the present invention comprises the steps of providing the vector of the present invention and transfecting the vector into the host cell that is capable of expressing the coronin promoter reporter gene and the optional second promoter reporter gene.
[0187] Subject the host cell to the test compound under conditions suitable for binding of the compound to the coronin 1 promoter.
[0188] In a preferred embodiment, the vector for use in the method of the invention comprises a second promoter and a second promoter reporter gene. The host cell is preferably capable of expressing the second promoter reporter gene; and preferably, the expression of the additional coronin 1 promoter reporter gene is measured in the host cell subjected to the test compound and compared to the expression of coronin 1.
[0189] In a preferred embodiment, the method of the invention for identifying a compound that inhibits coronin 1 promoter activity further comprises the step of comparing the expression of the coronin promoter reporter gene to a control value. The control value can be generated by using a control compound in place of the test compound in the method of the invention, i.e., subjecting the provided host cell to the test control compound; and measuring the expression of the coronin promoter reporter gene. Optionally, the expression of the second promoter reporter gene in the host cell subjected to the test control compound is measured. Thus, the specificity of the test compound in inhibiting the coronin 1 promoter can be evaluated.
[0190] Modulation of the expression of the optional second promoter reporter gene in the host cell subjected to the test compound indicates non-specific modulation because the optional second promoter reporter gene is operably linked to a promoter not related to the coronin 1 promoter.
[0191] A decrease in the expression of the coronin 1 promoter reporter gene compared to the control value indicates that the test compound inhibits the coronin 1 promoter, while no decrease in the expression of the coronin 1 promoter reporter gene indicates that the test compound does not modulate the coronin 1 promoter, and an increase in the expression of the coronin 1 promoter reporter gene indicates that the test compound activates the coronin 1 promoter. Any compound that decreases the expression of the coronin 1 promoter reporter gene without changing the expression of the second promoter reporter gene is considered an inhibitor of coronin 1 expression.
[0192] In a preferred embodiment, the host cell is a eukaryotic cell, preferably a mammalian cell, more preferably a mammalian immune cell. More preferably, the mammalian immune cell is human, mouse or rat, preferably rat basophilic leukemia (RBL) cells that express coronin 1.
[0193] In a preferred embodiment, the vector is a plasmid, wherein the coronin 1 promoter, the coronin promoter reporter gene, the second promoter, and the second promoter reporter gene are on the same plasmid. In a preferred embodiment, the vector comprises a first plasmid and a second plasmid, wherein the coronin 1 promoter and the coronin promoter reporter gene are on the first plasmid, and the optional second promoter and the optional second promoter reporter gene are on the second plasmid.
[0194] In one aspect, the present invention relates to a compound of formula (I)
[0195]
[0196] or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof.
[0197] In formula (I), R1 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more substituents independently selected from -OH, -NO2, halogen (preferably chlorine) and -O-C1-C6-alkyl (preferably methoxy), preferably -O-C1-C6-alkyl (preferably methoxy). In one embodiment, R1 is thienyl. In another embodiment, R1 is phenyl, wherein the phenyl is optionally substituted with one or more substituents independently selected from halogen (preferably chlorine) and -O-C1-C6-alkyl (preferably methoxy), preferably -O-C1-C6-alkyl (preferably methoxy). Even more preferably, R1 is phenyl, wherein the phenyl is optionally substituted with one or more -O-C1-C6-alkyl (preferably methoxy) groups. Even more preferably, R1 is selected from 2-methoxyphenyl and phenyl.
[0198] R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen (preferably fluorine) and -O-C1-C6-alkyl (such as -O-CH3). In one embodiment, R2 is thienyl. In another embodiment, R2 is phenyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl (such as -O-CH3). Preferably, R2 is phenyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -O-C1-C6-alkyl (such as -O-CH3), and even more preferably, R2 is phenyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH and -O-C1-C6-alkyl (such as -O-CH3). In a further preferred embodiment, R2 is phenyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH. In one embodiment, R2 is 3-hydroxyphenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl (such as -O-CH3). In another embodiment, R2 is 3-hydroxyphenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen. Even more preferably, R2 is 3-hydroxyphenyl.
[0199] In one embodiment, R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen. Preferably, R2 is phenyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen. More preferably, R2 is 3-hydroxyphenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen. Even more preferably, R2 is 3-hydroxyphenyl.
[0200] R3 is selected from -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m-(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups. It should be understood that the cycloalkyl is preferably C3-C 11 -cycloalkyl, more preferably a C3-C6 cycloalkyl.
[0201] Preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups.
[0202] More preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2), -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups.
[0203] Even more preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group), and oxygen-containing saturated heterocyclic group, wherein the cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group), and the oxygen-containing saturated heterocyclic group are each optionally substituted with one or more C1-C6-alkyl groups.
[0204] Even more preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group), and oxygen-containing saturated heterocyclic group, wherein the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted with one or more -C1-C6-alkyl groups.
[0205] In one embodiment, R3 is selected from -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, and -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2). Preferably, R3 is selected from -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, and -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2). More preferably, R3 is selected from -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2). Even more preferably, R3 is selected from -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2).
[0206] In another embodiment, R3 is selected from -C1-C6-alkylene-cycloalkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group), and oxygen-containing saturated heterocyclic group, wherein the cycloalkyl in the cycloalkyl, -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group), and the oxygen-containing saturated heterocyclic group are each optionally substituted with one or more C1-C6-alkyl groups. Even more preferably, R3 is selected from -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, wherein the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted with one or more -C1-C6-alkyl groups.
[0207] Thus, preferably R3 is selected from -C1-C6-alkylene-tetrahydro-2-furanyl -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl tetrahydrofuran-3-yl tetrahydro-2H-pyran-4-yl oxepan-4-yl and 8-oxabicyclo[3.2.1]octan-3-yl wherein the tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, the tetrahydrofuran-3-yl, the tetrahydro-2H-pyran-4-yl, the oxepan-4-yl, and the 8-oxabicyclo[3.2.1]octan-3-yl are each optionally substituted with one or more -C1-C6-alkyl groups, and more preferably, R3 is selected from -C1-C6-alkylene-tetrahydro-2-furanyl -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl and tetrahydro-2H-pyran-4-yl wherein the tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, and the tetrahydro-2H-pyran-4-yl are each optionally substituted with one or more -C1-C6-alkyl groups.
[0208] Even more preferably, R3 is selected from (tetrahydrofuran-2-yl)methyl tetrahydrofuran-3-yl and tetrahydro-2H-pyran-4-yl Most preferably, R3 is tetrahydro-2H-pyran-4-yl
[0209] In one aspect, the present invention relates to a compound of formula (I)
[0210]
[0211] or a pharmaceutically acceptable salt, stereoisomer, enantiomer or isomer and mixture thereof,
[0212] wherein
[0213] R1 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with -O-C1-C6-alkyl;
[0214] R2 is 3-hydroxyphenyl;
[0215] R3 is selected from -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably 1 to 5, more preferably 2 to 3, even more preferably 2), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, wherein the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted with one or more C1-C6-alkyl groups.
[0216] Preferably, R1 is phenyl optionally substituted with methoxy. Most preferably, R1 is selected from 2-methoxyphenyl and phenyl.
[0217] It should be understood that the cycloalkyl is preferably C3-C 11 -cycloalkyl, more preferably C3-C6 cycloalkyl.
[0218] Preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably 1 to 5, more preferably 2 to 3, even more preferably 2), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, wherein the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted with one or more C1-C6-alkyl groups.
[0219] More preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably 1 to 5, more preferably 2 to 3, even more preferably 2), -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups.
[0220] Even more preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups.
[0221] Even more preferably, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl and -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more -C1-C6-alkyl groups.
[0222] In one embodiment, R3 is selected from -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably 1 to 5, more preferably 2 to 3, even more preferably 2). Preferably, R3 is selected from -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably 1 to 5, more preferably 2 to 3, even more preferably 2). More preferably, R3 is selected from -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O)m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2). Even more preferably, R3 is selected from -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2).
[0223] In another embodiment, R3 is selected from -C1-C6-alkylene-cycloalkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group), and oxygen-containing saturated heterocyclic group, where the cycloalkyl in the cycloalkyl, -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclic group part of the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group), and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups. Even more preferably, R3 is selected from -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the oxygen-containing saturated heterocyclic group part in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more -C1-C6-alkyl groups.
[0224] Thus, preferably R3 is selected from -C1-C6-alkylene-tetrahydro-2-furanyl -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl tetrahydrofuran-3-yl tetrahydro-2H-pyran-4-yl oxepan-4-yl and 8-oxabicyclo[3.2.1]octan-3-yl where the tetrahydro-2-furanyl part in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl part in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, the tetrahydrofuran-3-yl, the tetrahydro-2H-pyran-4-yl, the oxepan-4-yl, and the 8-oxabicyclo[3.2.1]octan-3-yl are each optionally substituted by one or more -C1-C6-alkyl groups. More preferably, R3 is selected from -C1-C6-alkylene-tetrahydro-2-furanyl -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl and tetrahydro-2H-pyran-4-yl wherein the tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, and the tetrahydro-2H-pyran-4-yl are each optionally substituted with one or more -C1-C6-alkyl groups.
[0225] Even more preferably, R3 is selected from (tetrahydrofuran-2-yl)methyl tetrahydrofuran-3-yl and tetrahydro-2H-pyran-4-yl Most preferably, R3 is tetrahydro-2H-pyran-4-yl
[0226] Preferably, the compounds of formula (I) are selected from
[0227] tetrahydro-2-furanylmethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1);
[0228] methyl 4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2);
[0229] 2-(ethylthio)ethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3);
[0230] methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (4);
[0231] methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5);
[0232] tetrahydro-2-furanylmethyl 2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6);
[0233] tetrahydro-2-furanylmethyl 2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7);
[0234] Methyl 4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8);
[0235] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9);
[0236] Tetrahydro-2-furanylmethyl 4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10);
[0237] Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11);
[0238] Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12);
[0239] Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13);
[0240] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14);
[0241] Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15);
[0242] Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16);
[0243] 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17);
[0244] (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18);
[0245] (2,2,6,6 - tetramethyltetrahydro - 2H - pyran - 4 - yl) 4-(3 - hydroxyphenyl)-7-(2 - methoxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (19);
[0246] oxetan - 3 - yl 4-(3 - hydroxyphenyl)-7-(2 - methoxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (20);
[0247] tert - butyl 4-(3 - hydroxyphenyl)-7-(2 - methoxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (21);
[0248] methyl 7-(4 - chlorophenyl)-4-(3 - hydroxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (22);
[0249] tetrahydrofuran - 3 - yl 4-(3 - hydroxyphenyl)-7-(2 - methoxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (50);
[0250] (4 - methyltetrahydro - 2H - pyran - 4 - yl) 4-(3 - hydroxyphenyl)-7-(2 - methoxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (51);
[0251] (2,2,6,6 - tetramethyltetrahydro - 2H - pyran - 4 - yl) 4-(3 - hydroxyphenyl)-7-(2 - methoxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (52);
[0252] (8 - oxabicyclo[3.2.1]oct - 3 - yl) 4-(3 - hydroxyphenyl)-7-(2 - methoxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (53)
[0253] oxepan - 4 - yl 4-(3 - hydroxyphenyl)-7-(2 - methoxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (54);
[0254] (hexahydrofuro[2,3 - b]furan - 3 - yl) 4-(3 - hydroxyphenyl)-7-(2 - methoxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (55);
[0255] Cyclopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (56);
[0256] Cyclohexyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (57);
[0257] Ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (58);
[0258] Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (59);
[0259] Neopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (60);
[0260] 2-Ethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (61);
[0261] 2,2-Dimethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (62);
[0262] 4,4-Dimethylpentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (63);
[0263] 2-(2-Ethoxyethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (64);
[0264] 2-(2-(2-(Hexyloxy)ethoxy)ethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (65);
[0265] 4-(4-Fluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydro-2H-pyran-4-yl ester (66); and
[0266] 4-(2,4-Difluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydro-2H-pyran-4-yl ester (67).
[0267] More preferably, the compound of formula (I) is selected from
[0268] Tetrahydro-2-furanylmethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1);
[0269] Methyl 4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2);
[0270] 2-(Ethylthio)ethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3);
[0271] Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5);
[0272] Tetrahydro-2-furanylmethyl 2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6);
[0273] Tetrahydro-2-furanylmethyl 2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7);
[0274] Methyl 4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8);
[0275] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9);
[0276] Tetrahydro-2-furanylmethyl 4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10);
[0277] Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11);
[0278] Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12);
[0279] Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13);
[0280] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14);
[0281] Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15);
[0282] Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16);
[0283] 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17);
[0284] (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18);
[0285] (2,2,6,6-Tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19);
[0286] Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); and
[0287] tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21).
[0288] Even more preferably, the compound of formula (I) is selected from
[0289] Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11);
[0290] Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12);
[0291] Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13);
[0292] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14);
[0293] 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17);
[0294] (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18);
[0295] (2,2,6,6-Tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); and
[0296] tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21).
[0297] In one embodiment, the compounds of formula (I) are selected from:
[0298] Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12);
[0299] Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); and
[0300] Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50).
[0301] Particularly preferred compounds of formula (I) are selected from compounds 12, 13 and 50.
[0302] In one embodiment, the compounds of formula (I) are selected from
[0303] Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12);
[0304] Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13);
[0305] (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18);
[0306] (2,2,6,6-Tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19);
[0307] Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50);
[0308] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 4-methyltetrahydro-2H-pyran-4-yl ester (51);
[0309] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 8-oxabicyclo[3.2.1]oct-3-yl ester (53); and
[0310] 4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid oxepan-4-yl ester (54).
[0311] It is to be understood herein that preferably in the compounds of formula (I), the R1 and R2 substituents are present on opposite faces of the ring system. Thus, preferably, the compounds of formula (I) are compounds of the following formula:
[0312]
[0313] or compounds of the following formula:
[0314]
[0315] More preferably, the compounds of formula (I) have the absolute configuration of their stereocenters as shown in the following formula:
[0316]
[0317] Thus, in another embodiment, the compounds of formula (I) are selected from:
[0318] (4S,7R)-7-(2-Methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylic acid tetrahydro-2-furanylmethyl ester (1a-S and 1b-R);
[0319] (4S,7R)-4-(4-Fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylic acid methyl ester (2a);
[0320] (4S,7R)-7-(2-Methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylic acid 2-(ethylthio)ethyl ester (3a);
[0321] (4S,7R)-Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (4a);
[0322] (4S,7R)-Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5a);
[0323] (4S,7R)-Tetrahydro-2-furanyl methyl 2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6a-S and 6b-R);
[0324] (4S,7R)-Tetrahydro-2-furanyl methyl 2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7a-S and 7b-R);
[0325] (4S,7R)-Methyl 4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8a);
[0326] (4S,7R)-Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9a);
[0327] (4S,7R)-Tetrahydro-2-furanyl methyl 4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10a-S and 10b-R);
[0328] (4S,7R)-Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11c);
[0329] (4S,7R)-Tetrahydro-2-furanyl methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12e-S and 12g-R);
[0330] (4S,7R)-Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13a);
[0331] Methyl (4S,7R)-7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14a);
[0332] Methyl (4S,7R)-7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15a);
[0333] Methyl (4S,7R)-4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16a);
[0334] 4-Methoxybutyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17a);
[0335] (Tetrahydro-2H-pyran-4-yl) methyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18a);
[0336] (2,2,6,6-Tetramethyltetrahydro-2H-pyran-4-yl) methyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19a);
[0337] Oxetan-3-yl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20a);
[0338] tert-Butyl (4S,7R)-4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21a);
[0339] Methyl (4S,7R)-7-(4-chlorophenyl)-4-(3-hydroxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (22a);
[0340] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydrofuran-3-yl ester (50a-S and 50b-R);
[0341] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 4-methyltetrahydro-2H-pyran-4-yl ester (51a);
[0342] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl ester (52a);
[0343] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 8-oxabicyclo[3.2.1]oct-3-yl ester (53a);
[0344] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid oxepan-4-yl ester (54b-S and 54c-R);
[0345] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid (3R,3aS,6aR)-hexahydrofuro[2,3-b]furan-3-yl ester (55a);
[0346] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid cyclopentyl ester (56a);
[0347] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid cyclohexyl ester (57a);
[0348] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-ethyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid ethyl ester (58a);
[0349] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-ethyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid butyl ester (59a);
[0350] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-ethyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid neopentyl ester (60a);
[0351] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 2-ethylbutyl ester (61a);
[0352] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 2,2-dimethylbutyl ester (62a);
[0353] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 4,4-dimethylpentyl ester (63a);
[0354] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 2-(2-ethoxyethoxy)ethyl ester (64a);
[0355] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 2-(2-(2-(hexyloxy)ethoxy)ethoxy)ethyl ester (65a);
[0356] (4S,7R)-4-(4-Fluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydro-2H-pyran-4-yl ester (66a); and
[0357] (4S,7R)-4-(2,4-Difluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydro-2H-pyran-4-yl ester (67a).
[0358] In a preferred embodiment, the compound of formula (I) is
[0359] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylic acid tetrahydro-2-furanyl methyl ester (12e-S and 12g-R);
[0360] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylic acid tetrahydro-2H-pyran-4-yl ester (13a);
[0361] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid (tetrahydro-2H-pyran-4-yl) methyl ester (18a);
[0362] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl) methyl ester (19a);
[0363] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydrofuran-3-yl ester (50a-S and 50b-R);
[0364] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 4-methyltetrahydro-2H-pyran-4-yl ester (51a);
[0365] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 8-oxabicyclo[3.2.1]oct-3-yl ester (53a); and
[0366] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid oxepan-4-yl ester (54b-S and 54c-R).
[0367] In another preferred embodiment, the compound of formula (I) is
[0368] (4S,7R)-Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11c);
[0369] (4S,7R)-Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14a);
[0370] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 4-methoxybutyl ester (17a);
[0371] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tert-butyl ester (21a); and
[0372] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 2-(2-ethoxyethoxy)ethyl ester (64a).
[0373] Highly preferred compounds of formula (I) are
[0374] (4S,7R)-Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate tetrahydro-2-furanyl methyl ester (12e-S and 12g-R);
[0375] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylic acid tetrahydro-2H-pyran-4-yl ester (13a); and
[0376] (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydrofuran-3-yl ester (50a-S and 50b-R).
[0377] In a first specific embodiment of the compounds of formula (I), the compound has the absolute configuration of its stereocenters as shown in the following formula:
[0378]
[0379] In this first specific embodiment, R1, R2 and R3 are as defined in formula (I), including the preferred definitions of R1, R2 and R3 given above.
[0380] In this first specific embodiment, R1 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more substituents independently selected from -OH, -NO2, halogen (preferably chlorine) and -O-C1-C6-alkyl (preferably methoxy), preferably -O-C1-C6-alkyl (preferably methoxy). In one embodiment, R1 is thienyl. In another embodiment, R1 is phenyl, wherein the phenyl is optionally substituted with one or more substituents independently selected from halogen (preferably chlorine) and -O-C1-C6-alkyl (preferably methoxy), preferably -O-C1-C6-alkyl (preferably methoxy). Even more preferably, R1 is phenyl, wherein the phenyl is optionally substituted with one or more -O-C1-C6-alkyl (preferably methoxy) groups. Even more preferably, R1 is selected from 2-methoxyphenyl and phenyl.
[0381] In this first specific embodiment, R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl (such as -O-CH3). In one embodiment, R2 is thienyl. In another embodiment, R2 is phenyl, wherein the phenyl is optionally substituted with one or more substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl (such as -O-CH3). Preferably, R2 is phenyl, wherein the phenyl is optionally substituted with one or more substituents independently selected from -OH, -NO2 and -O-C1-C6-alkyl (such as -O-CH3), and even more preferably, R2 is phenyl, wherein the phenyl is optionally substituted with one or more substituents independently selected from -OH and -O-C1-C6-alkyl (such as -O-CH3). In a further preferred embodiment, R2 is phenyl, wherein the phenyl is optionally substituted with one or more substituents independently selected from -OH. In one embodiment, R2 is 3-hydroxyphenyl optionally substituted with one or more substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl (such as -O-CH3). In another embodiment, R2 is 3-hydroxyphenyl optionally substituted with one or more substituents independently selected from -OH, -NO2 and -halogen. Even more preferably, R2 is 3-hydroxyphenyl.
[0382] In one embodiment, R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -halogen. Preferably, R2 is phenyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -halogen. More preferably, R2 is 3-hydroxyphenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2, and -halogen. Even more preferably, R2 is 3-hydroxyphenyl.
[0383] In this first specific embodiment, R3 is -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, wherein the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted with one or more -C1-C6-alkyl groups. Suitable oxygen-containing saturated heterocyclic group moieties include tetrahydrofuran-3-yl, 8-oxabicyclo[3.2.1]octan-3-yl, oxepan-4-yl, hexahydrofuro[2,3-b]furan-3-yl (especially (3R,3aS,6aR)-(hexahydrofuro[2,3-b]furan-3-yl), tetrahydro-2-furanyl, tetrahydro-2H-pyran-4-yl, and oxetane-3-yl.
[0384] Preferably, in this first specific embodiment, R3 is selected from -C1-C6-alkylene-tetrahydro-2-furanyl, -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, tetrahydrofuran-3-yl, tetrahydro-2H-pyran-4-yl, oxepan-4-yl, and 8-oxabicyclo[3.2.1]octan-3-yl, wherein the tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, the tetrahydrofuran-3-yl, the tetrahydro-2H-pyran-4-yl, the oxepane-4-yl, and the 8-oxabicyclo[3.2.1]octan-3-yl are each optionally substituted with one or more -C1-C6-alkyl groups.
[0385] Most preferably, in this first specific embodiment, R3 is selected from (tetrahydrofuran-2-yl)methyl, tetrahydrofuran-3-yl, and tetrahydro-2H-pyran-4-yl.
[0386] In a second specific embodiment of the compound of formula (I), the compound has the absolute configuration of its stereocenters as shown in the following formula:
[0387]
[0388] In this second specific embodiment, R1 is selected from 2-methoxyphenyl and phenyl. Preferably, R1 is 2-methoxyphenyl.
[0389] In this second specific embodiment, R2 is 3-hydroxyphenyl.
[0390] In this second specific embodiment, R3 is selected from -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl and -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably 1 to 5, more preferably 2 to 3, even more preferably 2).
[0391] Preferably, in this second specific embodiment, R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl and -(C1-C6-alkylene)-O-C1-C6-alkyl.
[0392] Even more preferably, in this second specific embodiment, R3 is -C1-C6-alkyl. In this second specific embodiment, particularly suitable -(C2-C4-alkylene-O) m -(C1-C6-alkyl) includes 2-(2-ethoxyethoxy)ethyl and 2-(2-(2-(hexyloxy)ethoxy)ethoxy)ethyl.
[0393] The compounds of the present invention can be obtained according to the following Hantzsch cyclization scheme:
[0394]
[0395] where R1 to R3 are as defined in formula (I). Further details are given in Example 1.
[0396] The asymmetric synthesis of the compounds of the present invention can be carried out according to or similar to the synthesis methods described in Example 2, Example 3 and Example 5, or as described below.
[0397] Alternatively, enantiomerically pure compounds can also be obtained by late-stage transesterification via hydrolysis and esterification, the synthesis method is described in Example 4, or as described below. Accordingly, the present invention further relates to a method for preparing a compound of formula (I), preferably in its enantiomerically pure form.
[0398] For example, enantiomerically pure compounds according to the present invention can be obtained via: A) diastereoselective synthesis followed by chromatographic separation, or B) asymmetric synthesis as depicted in the following reaction, or C) late-stage transesterification via hydrolysis and esterification (Scheme 1):
[0399] Scheme 1:
[0400]
[0401]
[0402] wherein R1 to R3 are as defined in formula (I).
[0403] R4 is selected from the group consisting of: amine protecting groups, most preferably tert-butoxycarbonyl. Those skilled in the art can select the correct group to be used as R4.
[0404] R5 is an activated ester equivalent or a carboxylic acid, preferably a carboxylic acid. The ester equivalents include, but are not limited to, acid chlorides, acid bromides, and acid anhydrides. Those skilled in the art can select the correct group to be used as R5. Thus, R5 can be selected from carboxylic acids, acid chlorides, acid bromides, and acid anhydrides, preferably R5 is a carboxylic acid.
[0405] The reaction shown may include the following reaction steps:
[0406] Reaction:
[0407] a) Converting the 1,4-dihydropyridine motif to the corresponding pyridine motif by oxidation;
[0408] b) Asymmetric reduction of the pyridine motif via enantioselective partial transfer hydrogenation (chiral phosphoric acid, Hantzsch ester);
[0409] c) Separating the diastereoisomers via preparative HPLC or flash chromatography;
[0410] d) Introducing α,β-unsaturation via silyl enol ether formation, followed by oxidation (base, R3SiX, hypervalent iodine(V)) or selenoxide elimination (RSeX, oxidation) or direct dehydrogenation of cyclohexanone (Pd II , O2);
[0411] Then aziridine formation is carried out via aziridination (N-protected p-toluenesulfonamide, diamine, base);
[0412] e) Ring-opening of the aziridine via photochemical radiation (hv);
[0413] f) Optional nitrogen deprotection, unless R4 is hydrogen;
[0414] g) Condensation of intermediates VIII and IX;
[0415] h) Ester hydrolysis and optionally formation of an activated ester equivalent; and
[0416] i) Esterification.
[0417] Suitable reaction conditions for steps a, f-i are known to those skilled in the art.
[0418] Alternatively, steps h and i can be replaced by a direct transesterification step.
[0419] Accordingly, the present invention also relates to a method for preparing a compound of formula (I) as defined above, the method comprising the step (b) of asymmetric reduction of a pyridyl moiety by enantioselective partial transfer hydrogenation. Exemplary methods of the present invention are shown in Schemes 1A and B. In one embodiment, the method further comprises the step (e) of ring-opening of aziridine by photochemical radiation (hv). Preferably, the compound of formula (I) prepared according to the method of the present invention is a compound of the following formula:
[0420]
[0421] For the step (b) of asymmetric reduction of a pyridyl moiety by enantioselective partial transfer hydrogenation, the conditions have been modified according to: Org. Lett., 2014, 16, 2982 and ACIE, 2020, 59, 23107.
[0422] Further details are given in Examples 2, 3 and 5.
[0423] The present invention also relates to intermediates in a method for preparing a compound of the following formula:
[0424]
[0425] wherein R1, R2 and R3 are as defined in formula (I), and the method comprises the step (b) of asymmetric reduction of the pyridyl moiety in compound IX by enantioselective partial transfer hydrogenation:
[0426]
[0427] Preferably, the intermediate is selected from the group consisting of compounds III, VI, VII, X, XI and XII, preferably selected from the group consisting of compounds III, VI, X, XI and XII:
[0428]
[0429] R1, R2 and R3 are as defined in formula (I). R4 and R5 are as defined above.
[0430] The compound of formula (I) can be used to inhibit coronin 1 expression.
[0431] In addition, the compounds of the present invention can be used to inhibit coronin 1 promoter activity (without being limited to theory, preferably, the inhibition of coronin 1 activity occurs by binding to BRD3). Thus, the compounds of formula (I) can be used to treat, prevent and / or alleviate the symptoms of diseases associated with (or caused by) coronin 1 expression. In addition, the compounds of formula (I) can be used to treat, prevent and / or alleviate the symptoms of diseases associated with (or caused by) coronin 1 promoter activity. Diseases associated with (or caused by) coronin 1 expression and / or diseases associated with (or caused by) coronin 1 promoter activity can be selected from the group consisting of: transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. In addition, the compounds of formula (I) are used as drugs for inhibiting coronin 1 expression in inducing immunosuppression or in treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders.
[0432] In one aspect, the present invention relates to a compound of formula (I)
[0433]
[0434] or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, as described above, which is used as a drug.
[0435] In one aspect, the present invention relates to a compound of formula (I)
[0436]
[0437] or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, as described above, which is used as a drug for inhibiting coronin 1 expression in inducing immunosuppression or in treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders.
[0438] In a preferred embodiment, the compound of formula (I)
[0439]
[0440] is used as a drug for inhibiting coronin 1 expression in treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders.
[0441] In an even more preferred embodiment, the present invention provides a compound of formula (I) which is useful as a drug for inhibiting coronin 1 expression in inducing immunosuppression or in the treatment and / or prevention of diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders, wherein the compound is selected from
[0442] Tetrahydro-2-furanylmethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1);
[0443] Methyl 4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2);
[0444] 2-(Ethylthio)ethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3);
[0445] Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (4);
[0446] Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5);
[0447] Tetrahydro-2-furanylmethyl 2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6);
[0448] Tetrahydro-2-furanylmethyl 2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7);
[0449] Methyl 4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8);
[0450] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9);
[0451] Tetrahydro-2-furanylmethyl 4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10);
[0452] Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11);
[0453] Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12);
[0454] Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13);
[0455] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14);
[0456] Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15);
[0457] Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16);
[0458] 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17);
[0459] (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18);
[0460] (2,2,6,6-Tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19);
[0461] Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20);
[0462] tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21);
[0463] Methyl 7-(4-chlorophenyl)-4-(3-hydroxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (22);
[0464] Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50);
[0465] 4-Methyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (51);
[0466] 2,2,6,6-Tetramethyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (52);
[0467] 8-Oxabicyclo[3.2.1]octan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (53)
[0468] Oxepan-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (54);
[0469] Hexahydrofuro[2,3-b]furan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (55);
[0470] Cyclopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (56);
[0471] Cyclohexyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (57);
[0472] Ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (58);
[0473] Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (59);
[0474] Neopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (60);
[0475] 2-Ethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (61);
[0476] 2,2-Dimethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (62);
[0477] 4,4-Dimethylpentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (63);
[0478] 2-(2-Ethoxyethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (64);
[0479] 2-(2-(2-(Hexyloxy)ethoxy)ethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (65);
[0480] Tetrahydro-2H-pyran-4-yl 4-(4-fluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (66); and
[0481] 4-(2,4-Difluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tetrahydro-2H-pyran-4-yl ester (67)
[0482] Preferably selected from:
[0483] Tetrahydro-2-furanylmethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1);
[0484] Methyl 4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2);
[0485] 2-(Ethylthio)ethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3);
[0486] Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5);
[0487] Tetrahydro-2-furanylmethyl 2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6);
[0488] Tetrahydro-2-furanylmethyl 2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7);
[0489] Methyl 4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8);
[0490] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9);
[0491] Tetrahydro-2-furanylmethyl 4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10);
[0492] Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11);
[0493] Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12);
[0494] Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13);
[0495] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14);
[0496] Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15);
[0497] Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16);
[0498] 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17);
[0499] (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18);
[0500] (2,2,6,6-Tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19);
[0501] Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); and
[0502] tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21).
[0503] Thus, in said even more preferred embodiment, the present invention provides a compound of formula (I) which is used as a drug for inhibiting coronin 1 expression in inducing immunosuppression or in treating and / or preventing a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders, wherein said compound is selected from the compounds of any one of formulas 1 to 22 or 50 to 65, and wherein again even more preferably, said compound is selected from the compounds of formulas 11, 12, 13, 14, 17, 18, 19 and 21. Alternatively, said compound is selected from 12, 13, 18, 19, 50, 51, 53 and 54. In the present invention, the transplant rejection may be allograft rejection.
[0504] In a further preferred embodiment, the present invention relates to the use of the compounds of the present invention in the manufacture of a drug for inhibiting coronin 1 expression in inducing immunosuppression or in treating and / or preventing a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders.
[0505] In a further preferred embodiment, the present invention relates to a method for inhibiting coronin 1 expression in inducing immunosuppression or in treating and / or preventing and / or alleviating the symptoms of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders, the method comprising administering a compound of the present invention to a subject in need thereof. In this method, a therapeutically effective amount of the compound of the present invention is usually administered.
[0506] In a preferred embodiment, the compound of the present invention is used as a drug for inhibiting coronin 1 expression. In another preferred embodiment, the compound of the present invention is used as a drug for inhibiting coronin 1 promoter activity. In another preferred embodiment, the compound of the present invention is used as a drug for depleting coronin 1 in a subject.
[0507] In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in inducing immunosuppression or in treating and / or preventing diseases or disorders selected from transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in inducing immunosuppression or in treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in treating and / or preventing transplant rejection and / or lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in treating and / or preventing inflammatory diseases and / or infectious diseases. In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in inducing immunosuppression. In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in treating and / or preventing transplant rejection. In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in treating and / or preventing autoimmune diseases. In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in treating and / or preventing lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in treating and / or preventing inflammatory diseases. In another preferred embodiment, the compounds of the present invention are used as drugs for inhibiting coronin 1 expression in treating and / or preventing infectious diseases.
[0508] In another preferred embodiment, the compounds of the present invention are used as a medicament for treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as a medicament for treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as a medicament for treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as a medicament for treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, and lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as a medicament for treating and / or preventing transplant rejection and / or lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as a medicament for treating and / or preventing inflammatory diseases and / or infectious diseases. In another preferred embodiment, the compounds of the present invention are used as a medicament for inducing immunosuppression. In another preferred embodiment, the compounds of the present invention are used as a medicament for treating and / or preventing transplant rejection. In another preferred embodiment, the compounds of the present invention are used as a medicament for treating and / or preventing autoimmune diseases. In another preferred embodiment, the compounds of the present invention are used as a medicament for treating and / or preventing lymphoproliferative disorders. In another preferred embodiment, the compounds of the present invention are used as a medicament for treating and / or preventing inflammatory diseases. In another preferred embodiment, the compounds of the present invention are used as a medicament for treating and / or preventing infectious diseases.
[0509] In a preferred embodiment, the compounds of the present invention are used as a medicament for inducing immunosuppression or treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders, wherein the diseases or disorders to be treated and / or prevented are caused or promoted by coronin 1 expression.
[0510] In a preferred embodiment, the compounds of the present invention are used as a medicament for inducing immunosuppression or treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders, wherein the induction, treatment, and / or prevention are based on coronin 1 depletion. In a preferred embodiment, the compounds of the present invention are used as a medicament for inducing immunosuppression or treating and / or preventing diseases or disorders selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders, wherein the induction, treatment, and / or prevention are based on inhibition of coronin 1 expression.
[0511] Preferably, the autoimmune disease is selected from the group consisting of: psoriasis, vitiligo, multiple sclerosis, systemic lupus erythematosus, Hashimoto's thyroiditis, rheumatoid arthritis, primary sclerosing cholangitis, myasthenia gravis, type I or type II diabetes, conditions secondary to type I or type II diabetes, vasculitis, pernicious anemia, Sjogren's syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis, allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis, and allergic contact dermatitis. More preferably, the autoimmune disease is selected from the group consisting of: psoriasis, multiple sclerosis, systemic lupus erythematosus, Hashimoto's thyroiditis, rheumatoid arthritis, myasthenia gravis, type I or type II diabetes, conditions secondary to type I or type II diabetes, vasculitis, pernicious anemia, Sjogren's syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis, allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis, and allergic contact dermatitis.
[0512] Preferably, the transplant rejection is selected from the group consisting of: acute or chronic rejection of cells, tissues, organs, allografts, and xenografts, poor graft function status, and graft-versus-host disease. Preferably, the transplant rejection is selected from the group consisting of rejection reactions of: heart transplantation, skin transplantation, kidney transplantation, liver transplantation, islet transplantation, pancreas transplantation, lung transplantation, intestinal transplantation, corneal transplantation, vascular transplantation, adrenal transplantation, hair transplantation, bone transplantation, cartilage transplantation, and ligament transplantation.
[0513] Preferably, the inflammatory disease is selected from the group consisting of: inflammatory bowel disease, Crohn's disease, ulcerative colitis, endogenous asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, prurigo nodularis, hidradenitis suppurativa, eosinophilic esophagitis, fibrotic disorders, cardiovascular diseases, allergic disorders, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, cutaneous manifestations of immune-mediated disorders, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and adult respiratory distress syndrome, preferably selected from the group consisting of: inflammatory bowel disease, Crohn's disease, ulcerative colitis, endogenous asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, cutaneous manifestations of immune-mediated disorders, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and adult respiratory distress syndrome. More preferably, the inflammatory disease is selected from the group consisting of: inflammatory bowel disease, Crohn's disease, ulcerative colitis, endogenous asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, fibrotic disorders, allergic disorders, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, cutaneous manifestations of immune-mediated disorders, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and adult respiratory distress syndrome, preferably selected from the group consisting of: inflammatory bowel disease, Crohn's disease, ulcerative colitis, endogenous asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, cutaneous manifestations of immune-mediated disorders, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and adult respiratory distress syndrome.
[0514] Preferably, the lymphoproliferative disorder is T cell lymphoma or T cell leukemia.
[0515] Preferably, the infectious disease is selected from the group consisting of: tuberculosis, preferably tuberculosis caused by mycobacteria, Salmonella infection, Helicobacter infection, retroviral infection, preferably HIV or HTLV, cytomegalovirus infection, Candida infection, Staphylococcus infection, lymphocytic choriomeningitis virus infection, and viral hepatitis.
[0516] The mycobacteria include and are preferably Mycobacterium tuberculosis, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium bovis, Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium malmoense, Mycobacterium simiae, Mycobacterium szulgai, Mycobacterium xenopi, Mycobacterium scrofulaceum, Mycobacterium abscessus, Mycobacterium chelonae, Mycobacterium haemophilum, and / or Mycobacterium ulcerans.
[0517] In another embodiment, the present invention relates to a compound of formula (I) or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, as described above, for use in the treatment or prevention of a disease that can directly or indirectly benefit from BRD3 inhibition by reducing the expression of coronin 1.
[0518] Diseases that can benefit from BRD3 inhibition (directly or indirectly via reduced coronin 1 expression) can preferably be understood as diseases suitable for therapeutic intervention by directly inhibiting BRD3 or via regulation of coronin 1 expression by BRD3 inhibition. Preferably, the diseases are selected from transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders. The diseases are as disclosed above. In addition, BRD3-driven diseases are preferably malignant diseases and their metastases, such as NMC, OCCC, colorectal cancer or rhabdomyosarcoma, preferably NMC, OCCC or rhabdomyosarcoma.
[0519] Accordingly, the present invention provides compounds of formula (I) for the treatment or prevention of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders (as defined herein). The present invention further provides compounds of formula (I) for the treatment or prevention of NMC, colorectal cancer, OCCC, or rhabdomyosarcoma, and their metastases, preferably NMC, OCC, or rhabdomyosarcoma.
[0520] As understood herein, BRD3 inhibition involves blocking the binding site of BRD3, thereby preventing BRD3 from binding its natural ligands (acetylated N-terminal tails of histones and other acetylated transcription factors such as GATA_1, RelA, STAT3, etc.). Thus, compounds referred to as BRD3 inhibitors may also be referred to as BRD3 blockers, particularly BRD3 bromodomain blockers.
[0521] The inventors have surprisingly found that the compounds of the present invention inhibit the expression of coronin 1 by selectively targeting the bromodomain of BRD3. The target BRD3 is known to drive the development of highly invasive malignancies in 1 / 3 of patients diagnosed with NUT (nuclear protein in testis)-midline carcinoma (NMC) (Kervarrec, T. et al., Reply to: Expanding the Spectrum of Primary Cutaneous Carcinoma With BRD3-NUTM1 Am J Surg Pathol, 2021. 45(11): pp. 1584-1586). NMC is considered to be one of the most highly invasive malignancies, and it is known that more than 80% of diagnosed patients die within the first year. Currently, there is no specific cure except for surgical resection if detected early before significant metastasis or therapy with one of the non-selective BET inhibitors or chemotherapy for NMC with its tendency for side effects (Shapiro, G.I. et al., Br J Cancer, 2021. 124(4): pp. 744-753). The non-selective BET inhibitors also block BRD4 and BRD2, which not only results in toxicity but also induces global immunosuppression due to the inhibition of BRD4- and BRD2-dependent immune-inflammatory responses. Targeting BRD3 has been reported to play a key role in the control of a rare type of gynecological malignancy called ovarian clear cell carcinoma (OCCC) (Shigeta, S. et al., Mol Cancer Ther, 2021. 20(4): pp. 691-703). Like NMC, among the major gynecological malignancies, patients with ovarian cancer have the highest mortality rate. Patients with OCCC are usually treated with platinum-based chemotherapy, which causes many side effects and toxicities if the recently approved PARP inhibitors are not used. Many of these patients become refractory to these therapies, and thus there is an urgent need for safe and targeted therapies for these cancers. Accordingly, the present invention relates to the compounds of the present invention for the treatment or prevention of a disease that can benefit from BRD3 inhibition directly or indirectly via reducing the expression and activity of coronin 1. Preferably, the present invention relates to the compounds of the present invention for the treatment or prevention of NMC or OCCC, preferably for the treatment or prevention of BRD3-driven NMC or BRD3-driven OCCC. Similarly, targeting BRD3 has been shown to play a key role in the eradication of cancer metastasis in a colorectal cancer model by serving as a key phosphorylation substrate of TYRO3, thereby regulating anti-apoptotic gene expression and epithelial-mesenchymal transition (Hsu, P.L. et al., Sci Adv, 2023. 9, eade3422.).
[0522] According to the present inventors, exemplary compounds of formula (I) are selective BRD3 bromodomain inhibitors (blockers). As preferably understood herein, a BRD3 selective bromodomain blocker is defined as a compound that significantly stabilizes BRD3 and does not significantly stabilize other bromodomains and extra-terminal (BET) family of bromodomain-containing proteins, as determined by thermal proteome profiling. Preferably, a BRD3 selective bromodomain blocker significantly stabilizes BRD3 and does not significantly stabilize BRD2 and BRD4, as determined by thermal proteome profiling. Thermal proteome profiling is a technique well known to those skilled in the art. A suitable concentration range of the compound for thermal proteome profiling is from 1 μM to 6 μM. Exemplary results of thermal proteome profiling are shown in Figure 13 and exemplary experimental details of applying this method are disclosed in Example 7. Preferably, thermal proteome profiling is performed using RBL cells at a compound concentration of 6 μM.
[0523] Preferably, the compounds of formula (I) as defined herein are selective BRD3 bromodomain inhibitors (BRD3 bromodomain blockers) as defined herein. In other words, the compounds of formula (I) preferably bind only to BRD3 and not to other bromodomains and extra-terminal (BET) family of bromodomain-containing proteins, as determined by thermal proteome profiling.
[0524] Further according to the present inventors, it is assumed that the medical applications of the compounds of the present invention that involve the inhibition / blockade of BRD3 (i.e., the bromodomain of BRD3) are not limited to the compounds of formula (I) provided herein, but can be practiced with any BRD3 selective bromodomain inhibitor (blocker). Accordingly, the present invention also provides a BRD3 selective bromodomain inhibitor for treating or preventing transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders (as defined herein). The present invention also provides a BRD3 selective bromodomain inhibitor for treating or preventing NMC, colorectal cancer, OCCC, or rhabdomyosarcoma, preferably NMC, OCCC, or rhabdomyosarcoma. Exemplary and preferred BRD3 selective bromodomain inhibitors are the compounds of formula (I) as disclosed herein.
[0525] In another aspect of the present invention, the compounds of the present invention are used to inhibit coronin 1 expression in vitro, preferably in cell-based assays. In addition, the compounds of the present invention are used to inhibit coronin 1 promoter activity in vitro, preferably in cell-based assays. In addition, the compounds of the present invention are used to deplete coronin 1 in vitro, preferably in cell-based assays. The cells are preferably vertebrate cells, more preferably mammalian cells, even more preferably mammalian immune cells, and even more preferably human, mouse or rat immune cells. The cells are preferably selected from the group consisting of: CD4, CD8 T cells, B cells, neutrophils, macrophages, dendritic cells, Langerhans cells, eosinophils, NK cells, follicular antigen-presenting cells, monocytes, neuronal cells, glial cells or basophilic leukemia (RBL) cells, preferably of human, rat and mouse origin.
[0526] Further examples and embodiments are disclosed in the numbered items below.
[0527] 1. A compound of formula (I)
[0528]
[0529] or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer or isomer and mixture thereof, wherein
[0530] R1 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more -O-C1-C6-alkyl;
[0531] R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen;
[0532] R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, wherein the cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted with one or more C1-C6-alkyl.
[0533] 2. The compound according to item 1, wherein R1 is phenyl optionally substituted with methoxy.
[0534] 3. The compound according to item 1 or 2, wherein R1 is selected from 2-methoxyphenyl and phenyl.
[0535] 4. The compound according to any one of Items 1 to 3, wherein R2 is 3-hydroxyphenyl.
[0536] 5. The compound according to any one of Items 1 to 4, wherein R3 is -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) or oxygen-containing saturated heterocyclic group, and the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more -C1-C6-alkyl groups.
[0537] 6. The compound according to any one of Items 1 to 4, wherein R3 is selected from -C1-C6-alkylene-tetrahydro-2-furanyl, C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, and tetrahydro-2H-pyran-4-yl, and the tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, and the tetrahydro-2H-pyran-4-yl are each optionally substituted by one or more -C1-C6-alkyl groups.
[0538] 7. The compound according to any one of Items 1 to 6, wherein R3 is tetrahydro-2H-pyran-4-yl.
[0539] 8. The compound according to Item 1, selected from the group consisting of:
[0540] Tetrahydro-2-furanylmethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1);
[0541] Methyl 4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2);
[0542] 2-(Ethylthio)ethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3);
[0543] Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5);
[0544] Tetrahydro-2-furanylmethyl 2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6);
[0545] Tetrahydro-2-furanylmethyl 2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7);
[0546] Methyl 4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8);
[0547] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9);
[0548] Tetrahydro-2-furanylmethyl 4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10);
[0549] Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11);
[0550] Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12);
[0551] Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13);
[0552] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14);
[0553] Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15);
[0554] Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16);
[0555] 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17);
[0556] Methyl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (tetrahydro-2H-pyran-4-yl) (18);
[0557] Methyl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl) (19);
[0558] Oxetan-3-yl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (20); and
[0559] tert-Butyl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (21).
[0560] 9. The compound according to item 1, selected from the group consisting of: Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11);
[0561] Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12);
[0562] Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13);
[0563] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14);
[0564] 4-Methoxybutyl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (17);
[0565] Methyl (4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate) (tetrahydro-2H-pyran-4-yl) (18);
[0566] (2,2,6,6 - tetramethyltetrahydro - 2H - pyran - 4 - yl) methyl 4-(3 - hydroxyphenyl)-7-(2 - methoxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (19); and
[0567] tert - butyl 4-(3 - hydroxyphenyl)-7-(2 - methoxyphenyl)-2 - methyl - 5 - oxo - 1,4,5,6,7,8 - hexahydroquinoline - 3 - carboxylate (21).
[0568] 10. A compound according to any one of items 1 to 9, wherein the compound of formula (I) has the absolute configuration of its stereocenters as shown in the following formula:
[0569]
[0570] 11. A pharmaceutical composition comprising a compound according to any one of items 1 to 10 and a pharmaceutically acceptable carrier.
[0571] 12. A compound according to any one of items 1 to 10 or a pharmaceutical composition according to item 11, for use as a medicament.
[0572] 13. A compound according to any one of items 1 to 10 or a pharmaceutical composition according to item 11, for inducing immunosuppression or for the treatment and / or prevention of a disease or disorder selected from the group consisting of transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders.
[0573] 14. A compound for use according to item 13 or a pharmaceutical composition for use according to item 13,
[0574] wherein the autoimmune diseases are selected from the group consisting of: psoriasis, multiple sclerosis, systemic lupus erythematosus, Hashimoto's thyroiditis, rheumatoid arthritis, myasthenia gravis, type I or type II diabetes, conditions secondary to type I or type II diabetes, vasculitis, pernicious anemia, Sjogren's syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis, allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis, and allergic contact dermatitis;
[0575] wherein the transplant rejection is selected from the group consisting of: acute or chronic rejection of cells, tissues, organs, allografts, and xenografts, poor graft function, graft - versus - host disease; rejection of heart transplantation, skin transplantation, kidney transplantation, liver transplantation, islet transplantation, pancreas transplantation, lung transplantation, intestine transplantation, corneal transplantation, vascular transplantation, adrenal transplantation, hair transplantation, bone transplantation, cartilage transplantation, and ligament transplantation;
[0576] wherein the inflammatory disease is selected from the group consisting of: inflammatory bowel disease, Crohn's disease, ulcerative colitis, endogenous asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, fibrotic disorders, allergic disorders, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, skin manifestations of immune-mediated disorders, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and adult respiratory distress syndrome;
[0577] wherein the lymphoproliferative disorder is T cell lymphoma or T cell leukemia;
[0578] wherein the infectious disease is selected from the group consisting of: tuberculosis, preferably tuberculosis caused by mycobacteria, Salmonella infection, Helicobacter infection, retroviral infection, preferably HIV or HTLV, cytomegalovirus infection, Candida infection, Staphylococcus infection, lymphocytic choriomeningitis virus infection, and viral hepatitis.
[0579] 15. The compound for use or the pharmaceutical composition for use according to item 13 or 14, wherein the compound of formula (I) inhibits coronin 1 expression.
[0580] 16. A vector comprising a coronin 1 (coro1a) promoter element, wherein in the vertebrate genome, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene and spans a sequence segment of at least about 700 bp in the genome.
[0581] 17. The vector according to item 16, further comprising a coronin 1 promoter reporter gene, wherein the coronin 1 promoter element is operably linked to the coronin 1 promoter reporter gene.
[0582] 18. The vector according to item 16 or 17, wherein the coronin 1 promoter element spans a sequence of at least about 700 bp to about 1500 bp in the genome, preferably the coronin 1 promoter element spans a sequence segment of at least about 700 bp in the genome.
[0583] 19. The vector according to any one of items 16 to 18, wherein the coronin 1 promoter element has at least 40%, preferably at least 50%, more preferably at least 60%, still more preferably at least 70%, still more preferably at least 80%, still more preferably at least 90%, still more preferably at least 95%, still more preferably at least 98%, still more preferably at least 99% identity with the sequences of SEQ ID NO: 1-6.
[0584] 20. A method for identifying a compound that modulates the activity of the coronin 1 promoter, comprising the following steps:
[0585] a. Providing a host cell comprising the vector of any one of items 15 to 17, wherein the host cell is capable of expressing the promoter reporter gene of the vector;
[0586] b. Subjecting the host cell to a compound to be tested; and
[0587] c. Measuring the expression of the coronin 1 promoter reporter gene in the host cell subjected to the compound to be tested.
[0588] 21. A method for preparing a compound of formula (I) as defined in item 10, the method comprising step (b) of asymmetric reduction of a pyridyl moiety via enantioselective partial transfer hydrogenation.
[0589] 22. The method according to item 21, further comprising step (e) of ring-opening of an aziridine by photochemical radiation (hv).
[0590] Further examples and embodiments are disclosed in the numbered clauses below.
[0591] 1. A compound of formula (I)
[0592]
[0593] or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer or isomer and mixture thereof, for treating or preventing a disease that can benefit from BRD3 inhibition directly or indirectly via reducing the expression of coronin 1,
[0594] wherein
[0595] R1 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted by one or more -O-C1-C6-alkyl;
[0596] R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted by one or more optional substituents independently selected from -OH, -NO2 and -halogen;
[0597] R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, wherein the cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl.
[0598] 2. The compound for use according to clause 1, wherein R1 is a phenyl optionally substituted with methoxy.
[0599] 3. The compound for use according to clause 1 or 2, wherein R1 is selected from 2-methoxyphenyl and phenyl.
[0600] 4. The compound for use according to any one of clauses 1 to 3, wherein R2 is 3-hydroxyphenyl.
[0601] 5. The compound for use according to any one of clauses 1 to 4, wherein R3 is -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) or an oxygen-containing saturated heterocyclic group, wherein the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted with one or more -C1-C6-alkyl groups.
[0602] 6. The compound for use according to any one of clauses 1 to 4, wherein R3 is selected from -C1-C6-alkylene-tetrahydro-2-furanyl, C1-C6-alkylene-tetrahydro-2H-pyran-4-yl and tetrahydro-2H-pyran-4-yl, wherein the tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl and the tetrahydro-2H-pyran-4-yl are each optionally substituted with one or more -C1-C6-alkyl groups.
[0603] 7. The compound for use according to any one of clauses 1 to 6, wherein R3 is tetrahydro-2H-pyran-4-yl.
[0604] 8. The compound for use according to clause 1, wherein the compound is selected from the group consisting of:
[0605] Tetrahydro-2-furanylmethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1);
[0606] Methyl 4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2);
[0607] 2-(Ethylthio)ethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3);
[0608] Methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5);
[0609] Tetrahydro-2-furanylmethyl 2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6);
[0610] Tetrahydro-2-furanylmethyl 2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7);
[0611] Methyl 4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8);
[0612] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9);
[0613] Tetrahydro-2-furanylmethyl 4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10);
[0614] Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11);
[0615] Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12);
[0616] Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13);
[0617] Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14);
[0618] Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15);
[0619] Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16);
[0620] 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17);
[0621] (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18);
[0622] (2,2,6,6-Tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19);
[0623] Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); and
[0624] tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21).
[0625] 9. A compound according to any one of clauses 1 to 8, wherein the compound of formula (I) has the absolute configuration of its stereocenters as shown in the following formula:
[0626]
[0627] 10. A compound for use according to any one of clauses 1 to 9, wherein a disease that may benefit from BRD3 inhibition is suitable for therapeutic intervention by directly inhibiting BRD3 or via regulation of coronin 1 expression through BRD3 inhibition, preferably in transplantation rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders.
[0628] 11. A compound for use according to any one of clauses 1 to 9, wherein a disease that may benefit from BRD3 inhibition is a BRD3-driven malignancy, such as NMC, OCCC, or rhabdomyosarcoma.
[0629] Compounds that selectively inhibit coronin 1 promoter activity identified by the fluorescence-based screening assay of the present invention Compound
[0630] Compounds 1 to 12 and 22 described in Table 1 were purchased from ChemBridge Corporation; 11199 Sorrento Valley Rd, Suite 206; San Diego, CA 92121 (USA). The racemic syntheses of compounds 11 to 21 are described in Example 1.
[0631] Example 2 shows the diastereoselective synthesis of compound 13a and its isomers.
[0632] Example 3 shows the asymmetric synthesis of compound 11c.
[0633] The syntheses of compounds 12e, 12g, 50a, 50b and 52a to 65a are described in Example 4.
[0634] Additional syntheses are shown in Example 5 by the enantioselective synthesis of compound 51a and the syntheses of compounds 66b and 67b.
[0635] Table 1. Compounds 1 - 22 and 50 - 67
[0636]
[0637]
[0638]
[0639]
[0640]
[0641]
[0642]
[0643]
[0644]
[0645]
[0646]
[0647]
[0648]
[0649]
[0650]
[0651]
[0652]
[0653] *For compounds containing (R / S-tetrahydrofuran-2-yl)methyl, the dr is defined as (D1)-4,7-trans:(D2)-4,7-trans:(D1)-4,7-cis:(D2)-4,7-cis
[0654] Exemplary intermediates for the synthesis of compounds that selectively inhibit coronin 1 promoter activity
[0655] Table 2. Intermediates 27, 29, 31 - 38 and 70 - 74
[0656]
[0657]
[0658] Table 2a. Intermediates 28, 30 and 39 。
[0659]
[0660] General synthetic methods for Examples 1 - 3
[0661] Solvents and reagents: Chemicals were purchased from ABCR, Alfa Aesar, ACROS, Sigma Aldrich, TCI, Strem, Combi-Blocks or Fluorochem and used without further purification unless otherwise stated. Anhydrous solvents were purchased through molecular sieves or obtained using an LC Technology Solutions SP-1 solvent purification system. Deuterated solvents were purchased from Armar Chemicals or Cambridge Isotope Laboratories. Silica Gel P60 was used for chromatographic purification by flash column chromatography at a pressure of 0.3 bar - 0.5 bar. Unless otherwise stated, the yields given refer to chromatographically purified and spectroscopically pure compounds. NMR spectra: On a BRUKER ASCEND, BRUKER AVIII, BRUKER DRX or BRUKER NEO (400 MHz / 500 MHz / 600 MHz for Silica Gel P60, chromatographic purification was carried out by flash column chromatography at a pressure of 0.3 bar - 0.5 bar. Unless otherwise stated, the yields given refer to chromatographically purified and spectroscopically pure compounds. NMR spectra: On a BRUKER ASCEND, BRUKER AVIII, BRUKER DRX or BRUKER NEO (400 MHz / 500 MHz / 600 MHz for 1Nuclear magnetic resonance spectra were recorded on a HNMR spectrometer. Measurements were carried out at room temperature or with a cold probe. Chemical shifts (δ) are reported in ppm, with the residual solvent signal as the internal standard. Data are reported as (s = singlet, d = doublet, t = triplet, m = multiplet or unresolved, coupling constant, integration). For mixtures of diastereoisomers, spectral signals of the major species are reported unless otherwise stated. Mass spectrometry: Mass spectrometry analysis was performed as high-resolution ESI and EI measurements by the mass spectrometry service of the Laboratorium für Organische Chemie at ETH, under the supervision of Dr. B. Gerrtis by L. Bertschi, M. Meier, and D. Wirz.
[0662] Example 1
[0663] Synthesis of the racemic scaffold for evaluation
[0664]
[0665] General Procedure A :
[0666] The aldehyde (1.00 equiv.), diketone (1.00 equiv.), acetoacetate (1.20 equiv.) and ammonium acetate (3.00 equiv.) were loaded into a round-bottom flask coupled with a magnetic stir bar. The heterogeneous mixture was heated to 175 °C; prior to this time, it became a homogeneous red molten solution and evaporation of volatile by-products was noted. Once evaporation had significantly decreased, the solution was cooled to room temperature. The crude residue was dissolved in ethyl acetate and water and transferred to a separating funnel. The aqueous layer was extracted with ethyl acetate and the organic extracts were dried over MgSO4, filtered and concentrated under reduced pressure to give a crude red / orange oily residue. The crude product was purified via silica gel column chromatography (DCM:EtOAc = 1:1) to give the 1,4-DHP product as a yellow solid.
[0667] General Procedure B :
[0668] The diketone (1.00 equiv.), aldehyde (1.00 equiv.), acetoacetate (1.00 equiv.), ammonium acetate (1.5 equiv.) and L-proline (0.100 equiv.) were loaded into a round-bottom flask coupled with a magnetic stir bar. Ethanol (1 M) was added and a homogeneous red solution was observed, which was stirred at room temperature until complete conversion was observed by TLC. The reaction mixture was poured into brine and extracted with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and evaporated to dryness. A crude solid was obtained. The product was purified via silica gel column chromatography (EtOAc:DCM = 1:4) to give a yellow solid.
[0669] Scaffolds prepared
[0670] Compound 11
[0671]
[0672] Synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (1.1 g, 5.0 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (611 mg, 5.00 mmol, 1.00 equiv), methyl 3-oxobutanoate (964 mg, 5.00 mmol, 1.00 equiv), ammonium acetate (385 mg, 5.00 mmol, 1.00 equiv) and L-proline (58 mg, 0.5 mmol, 0.10 equiv) in 5 mL of ethanol according to general procedure B. The reaction mixture was stirred overnight and the crude product was purified to give a yellow solid (1.4 g, 3.3 mmol, 67% yield, 5.1:1.0 d.r.). Compound 11 can be separated using preparative HPLC with a non-chiral stationary phase to give 11a and 11b, or with a chiral stationary phase to give 11c and 11d.
[0673] 1 H NMR (400 MHz, CDCl3) δ: 7.24–7.17 (m, 1H), 7.07 (dd, J = 7.7, 1.7 Hz, 1H), 7.02 (t, J = 7.8 Hz, 1H), 6.98–6.94 (m, 1H), 6.92–6.80 (m, 4H), 6.65–6.53 (m, 1H), 5.14 (s, 1H), 3.72 (s, 3H), 3.59 (s, 3H), 3.58–3.48 (m, 1H), 2.79–2.43 (m, 4H), 2.32 (s, 3H).
[0674] HRMS (ESI): C 25 H 26 NO5[M + H] + Calculated value for 420.1805, found 420.1807.
[0675] Non-chiral HPLC: Reprosil Gold 120 C18, H2O:ACN + 0.1% FA = within 10 min, 75:25 to 65:35, continued for 3 min at 65:35, 26.5 mL / min, 125 mm × 20 mm, 5 μm, t R (D1; minor) = 11.7 min; t R (D2; major) = 12.7 min.
[0676] Chiral HPLC: Dr. Maisch ReproSil Chiral NR, H2O:ACN + 0.1% FA = 62:48, 1 mL / min, 250 mm × 4.6 mm, 5 μm, t R (D1E1) = 7.4 min; t R (D1E2) = 7.8 min, e.r. => 99:1 (>98% ee), t R (D2E1) = 8.6 min; t R (D2E2) = 10.1 min, e.r. => 99:1 (>98% ee).
[0677] Compound 12
[0678]
[0679] Synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (3.96 g, 16.5 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (2.01 g, 16.5 mmol, 1.00 equiv), methyl 3-oxobutanoate (tetrahydrofuran-2-yl) (3.7 g, 20 mmol, 1.2 equiv) and ammonium acetate (3.8 g, 49 mmol, 3 equiv) according to General Procedure A. The reactants were stirred for 30 minutes and the crude product was purified to give a yellow solid (4.6 g, 9.4 mmol, 57% yield, 2:2:1:1 d.r.). Compound 12 can be separated by preparative HPLC using a achiral stationary phase to give 12a and 12b. After separation by preparative HPLC, 12c and 12d were obtained using enantiomerically pure methyl (S)- or (R)-3-oxobutanoate (tetrahydrofuran-2-yl) respectively. Using enantiomerically pure methyl (S)-3-oxobutanoate (tetrahydrofuran-2-yl), followed by chiral stationary phase by preparative HPLC, 12e and 12f were obtained.
[0680] 11H NMR (400 MHz, methanol-d4) δ 7.26–7.17 (m, 4H), 7.08–6.99 (m, 2H), 6.99–6.87 (m, 4H), 6.86–6.74 (m, 4H), 6.60–6.52 (m, 2H), 5.06 (s, 1H), 5.05 (s, 1H), 4.12–3.96 (m, 6H), 3.86–3.78 (m, 7H), 3.76–3.69 (m, 3H), 3.54 (tq, J=11.9, 4.0 Hz, 2H), 2.85–2.75 (m, 2H), 2.73–2.61 (m, 4H), 2.49–2.41 (m, 2H), 2.39 (s, 3H), 2.38 (s, 3H), 1.96–1.77 (m, 6H), 1.62–1.50 (m, 2H).
[0681] Representative analytical data for compound 12c derived from (S)-(tetrahydrofuran-2-yl) methyl 3-oxobutanoate in enantiomerically pure form:
[0682] 1 1H NMR (400 MHz, methanol-d4) δ: 7.28–7.14 (m, 2H), 7.03 (t, J=7.9 Hz, 1H), 6.99–6.88 (m, 2H), 6.84–6.73 (m, 2H), 6.60–6.53 (m, 1H), 5.05 (s, 1H), 4.12–3.94 (m, 3H), 3.81 (s, 3H), 3.70 (t, J=6.7, 2H) 3.60–3.47 (m, 1H), 2.91–2.59 (m, 3H), 2.52–2.40 (m, 1H), 2.39 (s, 3H), 1.95–1.76 (m, 3H), 1.64–1.47 (m, 1H).
[0683] HRMS (ESI): C 29 H 31 NNaO6 [M+Na] + Calculated for 512.2044, found 512.2037.
[0684] Achiral HPLC: Reprosil Gold 120 C18, H2O: ACN + 0.1% FA = from 75:25 to 65:35 in 22 min, hold at 65:35 for 5 min, 26.5 mL / min, 125 mm × 20 mm, 5 μm, t R (D1; minor) = 18.9 min; t R (D2; major) = 20.9 min.
[0685] Chiral HPLC: Dr. Maisch ReproSil Chiral NR, H2O:ACN + 0.1% FA = from 56:44 to 40:60 in 10 min, continue for 3 min, 1 mL / min, 250 mm × 4.6 mm, 5 μm, t R (D1.1) = 10.1 min; t R (D1.2) = 10.6 min, t R (D2.1) = 11.2 min; t R (D2.2) = 12.4 min.
[0686] Compound 13
[0687]
[0688] Synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (109 mg, 0.50 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (61.1 mg, 0.50 mmol, 1.00 equiv), 4-oxo-butanoic acid oxetan-3-yl ester (94.1 mg, 0.50 mmol, 1.00 equiv), ammonium acetate (57.8 mg, 0.75 mmol, 1.50 equiv) and L-proline (11 mg, 0.1 mmol, 0.2 equiv) in 0.5 mL ethanol according to general procedure B. The reactants were stirred overnight, then the product was precipitated and collected via vacuum filtration as a colorless solid (120 mg, 0.24 mmol, 49% yield, 5:1 d.r.).
[0689] 1 1H NMR (400 MHz, DMSO-d6) δ: 9.20 (s, 1H), 9.16 (s, 1H), 7.35–7.13 (m, 2H), 7.11–6.87 (m, 3H), 6.76–6.55 (m, 2H), 6.49 (d, J = 8.1 Hz, 1H), 4.89 (s, 1H), 4.86–4.75 (m, 1H), 3.87–3.66 (m, 4H), 3.63–3.50 (m, 1H), 3.49–3.39 (m, 2H), 3.37–3.29 (m, 1H), 2.86–2.65 (m, 1H), 2.66–2.52 (m, 2H), 2.43–2.22 (m, 4H), 1.88–1.75 (m, 1H), 1.72–1.61 (m, 1H), 1.60–1.46 (m, 1H), 1.44–1.30 (m, 1H).
[0690] HR-MS (ESI): C 29 H 32 NO6[M + H]+ The calculated value is 490.2224, and the measured value is 490.2223.
[0691] Chiral HPLC: Dr. Maisch ReproSil Chiral NR, H2O: ACN + 0.1% FA = 62:38, 1 mL / min, 250 mm × 4.6 mm, 5 μm, t R (D1E1, minor) = 7.4 min; t R (D1E2, minor) = 7.8 min, t R (D2E1, major) = 8.6 min; t R (D2E2, major) = 10.1 min.
[0692] Compound 14
[0693]
[0694] Synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (218 mg, 1.00 mmol, 1.00 equiv), benzaldehyde (0.1 mL, 1.0 mmol, 1.0 equiv), methyl 3-oxobutanoate (116 mg, 1.00 mmol, 1.00 equiv), ammonium acetate (116 mg, 1.50 mmol, 1.50 equiv) and L-proline (11 mg, 0.1 mmol, 0.1 equiv) in 1 mL of ethanol according to the general procedure B. The reactants were stirred overnight, then the product was precipitated and collected by vacuum filtration as a yellow solid (170 mg, 0.42 mmol, 42% yield, >20:1 d.r.).
[0695] 1 H NMR (400 MHz, CDCl3) δ: 7.40–7.30 (m, 2H), 7.27–7.18 (m, 3H), 7.17–7.08 (m, 2H), 6.97–6.82 (m, 2H), 6.22 (s, 1H), 5.17 (s, 1H), 3.77 (s, 3H), 3.69–3.52 (m, 4H), 2.83–2.70 (m, 1H), 2.68–2.49 (m, 3H), 2.40 (s, 3H).
[0696] HR-MS (ESI): C 25 H 26 NO4[M + H] + The calculated value is 404.1856, and the measured value is 404.1855.
[0697] Compound 15
[0698]
[0699] Synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (227 mg, 1.00 mmol, 1.00 equiv), 3-methoxybenzaldehyde (136 mg, 1.00 mmol, 1.00 equiv), methyl 3-oxobutanoate (116 mg, 1.00 mmol, 1.00 equiv), ammonium acetate (116 mg, 1.50 mmol, 1.50 equiv) and L-proline (11 mg, 0.1 mmol, 0.1 equiv) in 1 mL of ethanol according to General Procedure B. The reactants were stirred overnight and the crude product was purified to give a yellow solid (260 mg, 0.6 mmol, 60% yield, 4.4:1 d.r.).
[0700] 1 1H NMR (400 MHz, CDCl3) δ: 7.25–7.20 (m, 1H), 7.17–7.05 (m, 2H), 7.01–6.80 (m, 4H), 6.72–6.64 (m, 1H), 6.43 (s, 1H), 5.15 (s, 1H), 3.76 (d, J = 3.3 Hz, 6H), 3.66–3.54 (m, 4H), 2.81–2.49 (m, 4H), 2.37 (s, 3H).
[0701] HR-MS (ESI): C 26 H 28 NO5[M + H] + Calculated value for 434.1962, found 434.1960.
[0702] Compound 16
[0703]
[0704] Synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (227 mg, 1.00 mmol, 1.00 equiv), 2-hydroxybenzaldehyde (122 mg, 1.00 mmol, 1.00 equiv), methyl 3-oxobutanoate (116 mg, 1.00 mmol, 1.00 equiv), ammonium acetate (116 mg, 1.50 mmol, 1.50 equiv) and L-proline (11 mg, 0.1 mmol, 0.1 equiv) in 1 mL of ethanol according to General Procedure B. The reactants were stirred overnight and the crude product was purified to give a yellow solid (130 mg, 0.3 mmol, 31% yield, 6.7:1 d.r.).
[0705] 11H NMR (400 MHz, CDCl3) δ: 9.49 (s, 1H), 7.25–7.17 (m, 1H), 7.15–7.03 (m, 2H), 6.99 (dd, J = 7.7, 1.7 Hz, 1H), 6.96–6.90 (m, 2H), 6.90–6.79 (m, 2H), 5.19 (s, 1H), 3.79 (s, 3H), 3.74–3.56 (m, 1H), 3.54 (s, 3H), 2.87–2.53 (m, 4H), 2.51 (s, 3H).
[0706] HR-MS (ESI): C 25 H 25 NNaO5 [M+Na] + Calculated value for C22H25NNaO5 [M+Na]+: 442.1625, found: 442.1622.
[0707] Compound 17
[0708]
[0709] Synthesized according to general procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (218 mg, 1.00 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (122 mg, 1.00 mmol, 1.00 equiv), 4-methoxybutyl 3-oxobutanoate (245 mg, 1.00 mmol, 1.00 equiv), ammonium acetate (116 mg, 1.50 mmol, 1.50 equiv) and L-proline (11 mg, 0.1 mmol, 0.1 equiv) in 1 mL of ethanol. The reaction mixture was stirred overnight and the crude product was purified to give a yellow solid (460 mg, 0.72 mmol, 72% yield, 5:1 d.r.).
[0710] 1 1H NMR (400 MHz, methanol-d4) δ: 7.26–7.20 (m, 2H), 7.08–6.89 (m, 3H), 6.85–6.77 (m, 2H), 6.62–6.55 (m, 1H), 5.04 (s, 1H), 4.10–3.97 (m, 2H), 3.81 (s, 3H), 3.60–3.47 (m, 1H), 3.38–3.32 (m, 2H), 3.30 (s, 3H), 2.86–2.56 (m, 3H), 2.51–2.41 (m, 1H), 2.40 (s, 3H), 1.73–1.57 (m, 2H), 1.54–1.43 (m, 2H).
[0711] HR-MS (ESI): C 29 H 34NO6 [M+H] + The calculated value is 492.2381 and the measured value is 492.2376.
[0712] Compound 18
[0713]
[0714] Synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (125 mg, 0.57 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (69.9 mg, 0.57 mmol, 1.00 equiv), 4-oxa-4-cyclohexylmethyl 3-oxobutanoate (115 mg, 0.57 mmol, 1.00 equiv), ammonium acetate (66.2 mg, 0.86 mmol, 1.50 equiv) and L-proline (13 mg, 0.1 mmol, 0.2 equiv) in 0.75 mL of ethanol according to General Procedure B. The reaction mixture was stirred overnight and the crude product was purified to give a yellow solid (113 mg, 0.22 mmol, 39% yield, 5.3:1 d.r.).
[0715] 1 H NMR (400 MHz, DMSO-d6) δ: 7.23 (t, J = 7.6 Hz, 2H), 7.12–7.01 (m, 1H), 6.99–6.88 (m, 2H), 6.81 (dd, J = 7.1, 1.5 Hz, 2H), 6.64–6.54 (m, 1H), 5.04 (s, 1H), 3.99 (dd, J = 10.8, 6.9 Hz, 1H), 3.93–3.82 (m, 2H), 3.87–3.75 (m, 4H), 3.59–3.46 (m, 1H), 3.42–3.27 (m, 2H), 2.88–2.55 (m, 3H), 2.51–2.41 (m, 1H), 2.41 (s, 3H), 1.90–1.73 (m, 1H), 1.53–1.44 (m, 1H), 1.40–1.30 (m, 1H), 1.24–1.08 (m, 2H).
[0716] HR-MS (ESI): C 30 H 34 NO6 [M+H] + The calculated value is 504.2381 and the measured value is 504.2378.
[0717] Compound 19
[0718]
[0719] Synthesized according to General Procedure B from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (109 mg, 0.50 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (61.1 mg, 0.50 mmol, 1.00 equiv), (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl) methyl 3-oxobutanoate (128 mg, 0.50 mmol, 1.00 equiv), ammonium acetate (57.8 mg, 0.75 mmol, 1.50 equiv) and L-proline (11 mg, 0.1 mmol, 0.2 equiv) in 0.5 mL of ethanol. The reaction mixture was stirred overnight, then the product was precipitated and collected by vacuum filtration as a yellow solid (172 mg, 0.31 mmol, 61% yield, 7.7:1 d.r.).
[0720] 1 H NMR (400 MHz, DMSO-d6) δ: 9.20 (s, 1H), 9.12 (s, 1H), 7.31–7.19 (m, 2H), 7.04–6.90 (m, 3H), 6.70–6.63 (m, 2H), 6.54–6.47 (m, 1H), 4.93 (s, 1H), 3.93 (dd, J = 10.8, 6.4 Hz, 1H), 3.76 (s, 3H), 3.65 (dd, J = 10.7, 6.3 Hz, 1H), 3.40 (td, J = 13.1, 12.5, 4.0 Hz, 1H), 2.73 (dd, J = 17.2, 11.8 Hz, 1H), 2.62–2.51 (m, 2H), 2.36 (s, 3H), 2.32–2.22 (m, 1H), 2.10–1.97 (m, 1H), 1.43–1.26 (m, 2H), 1.12 (s, 3H), 1.10 (s, 3H), 1.03 (d, J = 2.9 Hz, 6H), 0.87–0.70 (m, 2H).
[0721] HR-MS (ESI): C 34 H 41 NNaO6 [M+Na] + Calculated for 582.2826, found 582.2822.
[0722] Compound 20
[0723]
[0724] Synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (35.9 mg, 0.16 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (20.1 mg, 0.16 mmol, 1.00 equiv), 3-oxobutyric acid oxetan-3-yl ester (26 mg, 0.16 mmol, 1.00 equiv), ammonium acetate (19.0 mg, 0.25 mmol, 1.50 equiv) and L-proline (3.78 mg, 0.03 mmol, 0.20 equiv) in 0.3 mL of ethanol according to General Procedure B. The reaction mixture was stirred overnight and the crude product was purified to give a yellow solid (46 mg, 0.1 mmol, 61% yield, 3.8:1 d.r.).
[0725] 1 1H NMR (400 MHz, DMSO-d6) δ: 9.30 (s, 1H), 9.19 (s, 1H), 7.35–7.20 (m, 2H), 7.09–6.88 (m, 3H), 6.72–6.64 (m, 2H), 6.54–6.47 (m, 1H), 5.36–5.25 (m, 1H), 4.90 (s, 1H), 4.79–4.67 (m, 2H), 4.54–4.42 (m, 1H), 4.31 (ddd, J = 7.3, 5.2, 0.9 Hz, 1H), 3.78 (s, 3H), 3.53–3.40 (m, 1H), 2.86–2.69 (m, 1H), 2.67–2.51 (m, 2H), 2.35–2.25 (m, 4H).
[0726] HR-MS (ESI): C 27 H 28 NO6[M + H] + Calculated value for 462.1911, found 462.1906.
[0727] Compound 21
[0728]
[0729] Synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (455 mg, 2.00 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (244 mg, 2.00 mmol, 1.00 equiv), tert-butyl 3-oxobutanoate (316 mg, 2.00 mmol, 1.00 equiv), ammonium acetate (231 mg, 3.00 mmol, 1.50 equiv) and L-proline (23 mg, 0.2 mmol, 0.1 equiv) in 2 mL of ethanol according to General Procedure B. The reaction mixture was stirred overnight and the crude product was purified to give a yellow solid (503 mg, 1.1 mmol, 54% yield, 5.9:1 d.r.).
[0730] 1 1H NMR (400 MHz, methanol-d4) δ: 7.25–7.18 (m, 2H), 7.03 (t, J = 7.8 Hz, 1H), 6.98–6.66 (m, 4H), 6.60–6.52 (m, 1H), 4.95 (s, 1H), 3.80 (s, 3H), 3.60–3.47 (m, 1H), 2.86–2.39 (m, 4H), 2.32 (s, 3H), 1.37 (s, 9H).
[0731] HR-MS (ESI): C 28 H 31 NNaO5 [M+Na] + Calculated for 484.2094, found 484.2093.
[0732] Reference Compound 70
[0733]
[0734] To a solution of methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-4,6,7,8-tetrahydro-1H-quinoline-3-carboxylate (419 mg, 1.00 mmol, 1.00 equiv) in THF (4 mL, 0.25 M) at room temperature was added LiOH (2 M aqueous solution) (5.0 ml, 10 mmol). The reaction mixture was then heated to reflux and stirred overnight. The mixture was diluted with ethyl acetate and extracted with water. The aqueous layer was acidified to pH 1 with concentrated HCl. The aqueous layer was then extracted with ethyl acetate. The combined organic layers were dried (sodium sulfate), filtered and concentrated to give the product as a yellow solid (270 mg, 0.66 mmol, 67% yield, 7:1 d.r.).
[0735] 1 1H NMR and LC-MS data are shown below.
[0736] Example 2
[0737] Diastereoselective synthesis of Compound 13a and its isomers
[0738]
[0739] Compound 13b
[0740]
[0741] The racemic enaminone 28 (82.0 mg, 282 μmol, 1.00 equiv) was dissolved in EtOH (0.25 mL, 1 M) and transferred to a vial coupled with a magnetic stir bar. The condensation of aldehyde and β-ketoester was carried out according to the reported procedure, such as Chemical and Pharmaceutical Bulletin, 1986, 34, 1589. 2-(3-Hydroxybenzylidene)-3-oxobutyric acid tetrahydro-2H-pyran-4-yl ester (27) (61.4 mg, 282 μmol, 1.00 equiv) was added and the mixture was heated to 80 °C and stirred for 36 h. The solvent was removed under reduced pressure and the residue was purified by flash silica column chromatography (DCM:MeOH = 20:1) to give the product as a yellow solid (72.0 mg, 147 μmol, 52%, 1:1 d.r.).
[0742] Alternative :
[0743] Synthesized from 5-(2-methoxyphenyl)cyclohexane-1,3-dione (4.04 g, 18.5 mmol, 1.00 equiv), 3-hydroxybenzaldehyde (2.26 g, 18.5 mmol, 1.00 equiv), 3-oxobutyric acid oxan-4-yl ester (3.44 g, 18.5 mmol, 1.00 equiv), ammonium acetate (2.14 g, 27.7 mmol, 1.50 equiv) and L-proline (426 mg, 0.37 mmol, 0.2 equiv) in ethanol (18.5 mL, 1 M) according to General Procedure B. The reactants were stirred overnight, then the product partially precipitated as an off-white solid (5.26 g, 10.7 mmol, 71% yield, 3:1 d.r.). The filtrate was concentrated under reduced pressure and the residue was purified by flash silica column chromatography (DCM:MeOH = 20:1) to give the product as an off-white solid (1.20 g, 2.57 mmol, 14%, 4:1 d.r). The overall yield was observed to be 85%.
[0744] 11H NMR (400 MHz, CD3OD) δ: 7.27–7.18 (m, 2H), 7.17–7.11 (m, 1H), 7.04 (t, J = 7.8 Hz, 1H), 7.00–6.87 (m, 5H), 6.84–6.77 (m, 2H), 6.76–6.67 (m, 3H), 6.60–6.48 (m, 2H), 5.04 (s, 1H), 5.00 (s, 1H), 4.92–4.84 (m, 3H), 3.94–3.69 (m, 10H), 3.66–3.46 (m, 5H), 3.46–3.38 (m, 2H), 2.86–2.50 (m, 8H), 2.48–2.30 (m, 6H), 1.98–1.80 (m, 2H), 1.78–1.57 (m, 4H), 1.52–1.41 (m, 2H).
[0745] HR-MS (ESI): See above
[0746] Compound 29
[0747]
[0748] A suspension of Hantzsch 1,4-DHP 13b (1.00 g, 2.04 mmol, 1.00 equiv) and 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (0.52 g, 2.25 mmol, 1.10 equiv) in DMSO (10.2 mL, 0.2 M) was stirred at room temperature for 15 minutes. The crude product was purified by flash silica gel column chromatography (DCM:MeOH = 10:1) to give the product as an off-white solid (0.93 g, 1.90 mmol, 93%).
[0749] 1 1H NMR (400 MHz, CD3OD) δ: 7.31–7.13 (m, 3H), 7.06–6.89 (m, 2H), 6.78 (ddd, J = 8.2, 2.5, 1.0 Hz, 1H), 6.70–6.53 (m, 2H), 4.95–4.90 (m, 1H), 3.92–3.82 (m, 4H), 3.73–3.58 (m, 2H), 3.54–3.38 (m, 4H), 3.06–2.90 (m, 1H), 2.84–2.71 (m, 1H), 2.57 (s, 3H), 1.78–1.52 (m, 2H), 1.42–1.22 (m, 2H).
[0750] HR-MS (ESI): C 29 H 30 NO6[M + H] +Calculated value: 488.2068, measured value: 488.2064.
[0751] Compound 13a
[0752]
[0753] Pyridine 29 (37.6 mg, 0.08 mmol, 1.00 equiv) was loaded into a vial coupled with a magnetic stir bar and dissolved in anhydrous DCM (0.8 mL, 0.1 M). Diethyl 2,6-dimethyl-1,4-dihydropyridine-3,5-dicarboxylate (44.2 mg, 0.16 mmol, 2.00 equiv) and (S)-TRIP (2.9 mg, 0.004 mmol, 0.05 equiv) were added and the mixture was stirred at room temperature for 42 h. The solvent was removed under reduced pressure and the residue was purified by flash silica column chromatography (DCM:EtOAc = 2:3) to afford the product as an off-white solid (37 mg, 0.07 mmol, 96%, 1:1 d.r., >98% ee). The two diastereomers (13a and 13e) of compound 13c can be separated using a Büchi pure chromatography system with a silica column (hexane:EtOAc = 9:1 to 1:9) to give pure 13a and 13e.
[0754] Compound 13a
[0755] 1 H NMR (500 MHz, CD3OD) δ: 7.24–7.19 (m, 2H), 7.04 (t, J = 7.8 Hz, 1H), 7.00–6.89 (m, 2H), 6.84–6.77 (m, 2H), 6.58–6.55 (m, 1H), 5.04 (s, 1H), 4.92–4.86 (m, 1H), 3.88–3.79 (m, 4H), 3.63–3.49 (m, 3H), 3.46–3.39 (m, 1H), 2.79 (dd, J = 17.6, 11.9 Hz, 1H), 2.72–2.63 (m, 3H), 2.48–2.35 (m, 4H), 1.95–1.85 (m, 1H), 1.78–1.60 (m, 2H), 1.50–1.41 (m, 1H).
[0756] HR-MS (ESI): See above
[0757] Chiral HPLC: Dr. Maisch ReproSil Chiral NR, H2O:ACN + 0.1% FA = 62:38, 1 mL / min, 250 mm × 4.6 mm, 5 μm, t R (D1E1, minor) = 7.4 min; tR (D1E2, minor) = 7.8 min, t R (D2E1, major) = 8.6 min; t R (D2E2, major) = 10.1 min.
[0758] Compound 13e
[0759] 1 H NMR (400 MHz, MeOD) δ 7.21–7.13 (m, 1H), 7.00 (dd, J = 36.5, 8.0 Hz, 1H), 6.96–6.92 (m, 2H), 6.77–6.69 (m, 3H), 6.55 (ddd, J = 8.1, 2.5, 1.0 Hz, 1H), 5.02 (s, 1H), 4.91 (dd, J = 7.4, 3.6 Hz, 1H), 3.91–3.82 (m, 4H), 3.82–3.76 (m, 1H), 3.67–3.54 (m, 2H), 3.45 (ddd, J = 11.5, 7.6, 3.6 Hz, 1H), 2.82–2.74 (m, 2H), 2.64–2.56 (m, 2H), 2.40 (s, 3H), 1.99–1.86 (m, 1H), 1.79–1.63 (m, 3H), 1.56–1.42 (m, 1H).
[0760] Other diastereoisomers of compound 13 (13d, 13f) can be obtained using (R)-TRIP accordingly.
[0761] Example 3
[0762] Enantioselective synthesis of Compound 11c
[0763]
[0764] Compound 30a
[0765]
[0766] A solution of [RhCl(C2H4)2]2 (152 mg, 0.39 mmol, 0.03 eq., prepared from RhCl3·xH2O according to https: / / doi.org / 10.1002 / 047084289X.rn01715) and 2-((1R,4R,7R)-7-isopropyl-5-methylbicyclo[2.2.2]oct-2,5-dien-2-yl)propan-2-ol (115 mg, 0.52 mmol, 0.04 eq.) in 1,4-dioxane (22 mL) was stirred at room temperature for 5 min. The synthesis of the ligand and this exact transformation have been described in "Org. Lett., 2008, 10, 19, 4387–4389". 1.5 M aqueous KOH solution (4.3 mL, 6.5 mmol, 0.5 eq.) was added and the resulting solution was stirred at room temperature for an additional 5 min. To this was added (2-methoxyphenyl)boronic acid (2.96 g, 19.5 mmol, 1.50 eq.) and cyclohexenone (1.26 mL, 13.0 mmol, 1.00 eq.) and an additional 1,4-dioxane (21 mL, 0.3 M total), and the resulting mixture was stirred at room temperature overnight (15 h). The reaction mixture was passed directly through a silica gel pad with Et2O and the solvent was removed in vacuo. The residue was purified by flash silica column chromatography (hexane:EtOAc = 4:1) to give the product as an orange oil (2.60 g, 12.7 mmol, 98%).
[0767] 1 1H NMR and HR-MS (ESI) were consistent with the literature spectra.
[0768] Chiral HPLC: Daicel Chiralpak OD-H, hexane: i PrOH = 97:3, 1 mL / min, λ = 254, t R (major) = 11.2 min; t R (minor) = 9.7 min, e.r. = 97:3 (94% ee).
[0769] Compound 32a
[0770]
[0771] To a solution of 2,2,6,6-tetramethylpiperidine (2.28 mL, 13.4 mmol, 1.07 equiv) in THF (88 mL) at 4 °C was added a 1.43 M hexane solution of n-BuLi (11 mL, 16.8 mmol, 1.34 equiv) (ice-water bath). After stirring for 1 h at the same temperature, the reaction mixture was cooled to -78 °C. Then TMSCl (2.22 mL, 17.5 mmol, 1.4 equiv) was added, followed by a solution of 30a (2.55 g, 12.5 mmol, 1.00 equiv) in THF (88 mL, 0.07 M in total). After stirring for 2 h at the same temperature, the reaction mixture was quenched by adding saturated aqueous NaHCO3, extracted with Et2O, dried over Na2SO4 and concentrated to give the crude silyl enol ether 31a, which was used in the next step without further purification.
[0772] The silyl enol ether was dissolved in the minimum amount of DMSO, and IBX·MPO complex (52.8 mL, 0.4 M in DMSO, 21.1 mmol, 2.00 equiv) was added at room temperature and the solution was stirred until completion was observed by TLC. After completion, the reaction mixture was diluted with aqueous NaHCO3 (5%) and extracted with ether (3 × 60 mL). The combined organic phases were washed with saturated aqueous NaHCO3, water and brine. After drying (MgSO4), the solvent was removed in vacuo to give the crude product, which was purified by flash column chromatography (hexane:EtOAc = 9:1) to give the product as a pale yellow oil (1.57 g, 7.78 mmol, 62%).
[0773] 1 1H NMR (400 MHz, CDCl3) δ: 7.24 (ddd, J = 8.1, 7.4, 1.8 Hz, 1H), 7.18 (dd, J = 7.6, 1.7 Hz, 1H), 7.10–7.04 (m, 1H), 6.95 (td, J = 7.5, 1.2 Hz, 1H), 6.89 (dd, J = 8.2, 1.1 Hz, 1H), 6.16–6.06 (m, 1H), 3.83 (s, 3H), 3.78–3.66 (m, 1H), 2.82–2.54 (m, 4H).
[0774] HR-MS (ESI): C 13 H 14 NaO2 [M+Na] + Calcd for 225.0886, found 225.0888.
[0775] Compound 33a
[0776]
[0777] At room temperature, under a nitrogen atmosphere, N1,N1-dimethylethane-1,2-diamine (0.13 mL, 1.01 mmol, 0.5 equiv) was added to a stirred solution of benzoic acid (246 mg, 2.01 mmol, 1.00 equiv), sodium bicarbonate (846 mg, 10.1 mmol, 5.00 equiv), tert-butyl (tosyloxy)carbamate (579 mg, 2.01 mmol, 1.00 equiv) in CHCl3 (15 mL). CHCl3 (5 mL) containing ketene 32a (489 g, 2.42 mmol, 1.20 equiv) was added in one portion and the resulting mixture was stirred at room temperature overnight (15 h). Water (30 mL) was added and the aqueous solution was extracted with CHCl3 (3 × 20 mL), and the combined organic layers were washed once with saturated brine, dried over NaSO4 and concentrated in vacuo. The resulting oily residue was purified by column chromatography (hexane EtOAc = 4:1) to give the product as an off-white solid (654 mg, 1.61 mmol, 73%, 2.8:1 d.r.).
[0778] 1 1H NMR (400 MHz, CDCl3) δ: 7.24–7.16 (m, 1H), 7.15–7.05 (m, 1H), 6.97–6.81 (m, 2H), 3.81 (s, 3H), 3.77–3.51 (m, 1H), 3.24–3.09 (m, 1H), 3.05–2.62 (m, 2H), 2.48–2.05 (m, 3H), 1.48 (s, 9H).
[0779] HR-MS (ESI): C 18 H 23 NNaO4 [M+Na] + Calcd for 340.1519, found 340.1515.
[0780] Chiral HPLC: Daicel Chiralpak OD-R, H2O:ACN + 0.1% FA = 1:1, 1 mL / min, λ = 254, t R (D1, major) = 32.3 min; t R (D1, minor) = 28.5 min; t R (D2, major) = 19.1 min; t R (D2, minor) = 23.7 min, e.r. = 97:3 (94% ee).
[0781] Compound 34a
[0782]
[0783] The BOC-protected aziridine 33a (78% purity, ketene impurity, 132 mg, 0.32 mmol, 1.00 equivalent) was divided into two 20 mL heat-dried schlenk tubes and degassed benzene (19 mL, 0.008 M) was added to both tubes. The containers were transferred to a UV reactor and irradiated at 350 nm for 5 h. The solutions were combined and concentrated under reduced pressure. The crude residue was purified by column chromatography (hexane:EtOAc = 3:2) to give the product as a colorless solid (84 mg, 0.26 mmol, 82%).
[0784] 1 1H NMR (400 MHz, CDCl3) δ: 7.26–7.20 (m, 1H), 7.15 (dd, J = 7.6, 1.7 Hz, 1H), 6.93 (td, J = 7.5, 1.1 Hz, 1H), 6.88 (dd, J = 8.2, 1.1 Hz, 1H), 6.55 (br s, 1H), 6.44 (d, J = 1.6 Hz, 1H), 3.81 (s, 3H), 3.78–3.65 (m, 1H), 2.84–2.51 (m, 5H), 1.48 (s, 9H).
[0785] HR-MS (ESI): C 18 H 23 NNaO4 [M+Na] + Calculated value for 340.1519, found 340.1518.
[0786] Chiral HPLC: Daicel Chiralpak OD-R, H2O:ACN + 0.1% FA = 1:1, 1 mL / min, λ = 254, t R (major) = 15.5 min; t R (minor) = 18.1 min, e.r. = 98:2 (96% ee).
[0787] Compound 11e
[0788]
[0789] The BOC-protected enaminone 34a (81.0 mg, 0.25 mmol, 1.00 equiv) was loaded into a 10 mL flask coupled with a magnetic stir bar and dissolved in a 1:1 mixture of DCM:TFA (2.2 mL, 0.2 M). The solution was stirred at room temperature for 1 h and the solvent was removed under reduced pressure. The residue was redissolved in ethyl acetate and washed with saturated aqueous sodium bicarbonate and brine, dried over magnesium sulfate and concentrated under reduced pressure to give the crude deprotected enaminone 28a, which was used in the next step without further purification.
[0790] Analytical data LC - MS / 1H NMR of 28a
[0791] rt = 0.84 min, 218.1 [M+H]+ (76% UV absorbance).
[0792] 1 H NMR (400 MHz, DMSO-d6) δ 7.27–7.17 (m, 2H), 7.04–6.41 (m, 4H), 4.98 (d, J = 0.9 Hz, 1H), 3.79 (s, 3H), 3.50 (tt, J = 11.4, 4.3 Hz, 1H), 2.59–2.51 (m, 1H), 2.45–2.29 (m, 2H), 2.14 (ddd, J = 16.0, 4.4, 1.4 Hz, 1H).
[0793] The crude deprotected enaminone was dissolved in EtOH (0.25 mL, 1 M) and transferred to an HPLC vial coupled with a magnetic stir bar. Methyl (E / Z) 2-(3-hydroxybenzylidene)-3-oxobutanoate (73.2 mg, 0.33 mmol, 1.33 equiv) was added and the mixture was heated to 80 °C and stirred for 20 h. The solvent was removed under reduced pressure and the residue was purified via flash silica column chromatography (hexane:EtOAc = 1:1) to give the product as a yellow solid (72.3 mg, 0.17 mmol, 69%, 1:1 d.r.). Methyl (E / Z) 2-(3-hydroxybenzylidene)-3-oxobutanoate had been prepared previously, see: Chemical and Pharmaceutical Bulletin, 1986, 34, 1589.
[0794] 1 H NMR and HR-MS (ESI) data are shown above.
[0795] Chiral HPLC: Daicel Chiralpak OD-R, H2O:ACN + 0.1% FA = 58:42, 1 mL / min, λ = 362, t R (D1, major) = 14.8 min; t R(D1, minor) = 17.3 min; t R (D2, major) = 16.4 min; t R (D2, minor) = 24.2 min, e.r. = 98:2 (96% ee).
[0796] Compound 35a
[0797]
[0798] A suspension of Hantzsch 1,4-DHP 11e (32.0 mg, 0.08 mmol, 1.00 equiv) and 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (17.3 mg, 0.08 mmol, 1.00 equiv) in dichloromethane (0.8 mL, 1 M) was stirred at 0 °C for 30 min. The precipitate was filtered, washed with dichloromethane (2 × 5 mL), and the filtrate was concentrated under reduced pressure. The residue was purified by flash silica gel column chromatography (hexane:EtOAc = 3:2) to give the product as an off-white solid (26.0 mg, 0.06 mmol, 82%).
[0799] 1 1H NMR (400 MHz, CDCl3) δ: 7.26–7.16 (m, 3H), 6.95 (td, J = 7.5, 1.1 Hz, 1H), 6.89 (dd, J = 8.3, 1.1 Hz, 1H), 6.82–6.73 (m, 1H), 6.66 (dd, J = 14.0, 7.5 Hz, 1H), 6.57 (d, J = 17.4 Hz, 1H), 3.93–3.83 (m, 1H), 3.82 (s, 3H), 3.56–3.36 (m, 5H), 2.92–2.81 (m, 2H), 2.60 (s, 3H).
[0800] HR-MS (ESI): C 25 H 24 NO5[M+H] + Calculated for 418.1649, found 418.1646.
[0801] Chiral HPLC: Daicel Chiralpak OD-R, H2O:ACN + 0.1% FA = 58:42, 1 mL / min, λ = 254, t R (major) = 26.1 min; t R (minor) = 24.0 min, e.r. = 98:2 (96% ee).
[0802] Compound 11c
[0803]
[0804] Pyridine 35a (22.0 mg, 0.05 mmol, 1.00 equiv) was loaded into an HPLC vial coupled with a magnetic stir bar and dissolved in anhydrous DCM (0.5 mL, 0.1 M). Diethyl 2,6-dimethyl-1,4-dihydropyridine-3,5-dicarboxylate (26.7 mg, 0.10 mmol, 2.00 equiv) and (S)-TRIP (1.984 mg, 0.003 mmol, 0.05 equiv) were added and the mixture was stirred at 40 °C for 16 h. The solvent was removed under reduced pressure and the residue was purified by flash silica column chromatography (hexanes:EtOAc = 1:1) to afford the product as an off-white solid (21 mg, 0.05 mmol, 95%, >20:1 d.r.).
[0805] 1 1H NMR and HR-MS (ESI) data are shown above.
[0806] Chiral HPLC: Daicel Chiralpak OD-R, H2O:ACN + 0.1% FA = 58:42, 1 mL / min, λ = 362, t R (major) = 16.3 min; t R (minor) = 24.2 min, e.r. = >99:1 (>99% ee).
[0807] Example 4
[0808] Synthesis of Compounds 12e, 12g, 50a, 50b, 52a - 65a
[0809]
[0810] General Procedure C :
[0811] At RT, alcohol (4.00 equiv), pyridine (4.00 equiv) and propanephosphonic anhydride (4.00 equiv, 50% w / w in DMF) were added to a stirred solution of acid 70a (0.07 - 0.19 mmol, 1.00 equiv) in acetonitrile (0.1 M). The reaction mixture was heated to 40 °C and stirred for 3 h to overnight. The mixture was cooled to RT, NH4Cl solution was added and the mixture was extracted with ethyl acetate. The combined organic layers were washed with water and the solvent was removed under pressure to afford the crude product. The crude product was purified by silica column chromatography (acetone:toluene) to afford the product in 27% - 56% yield.
[0812] General Procedure D :
[0813] Under RT, N,N'-diisopropylmethanediamine (3.00 eq) was added dropwise to a stirred solution of acid 70a (0.12 - 0.20 mmol, 1.00 eq) and alcohol (3.00 eq) in a DCM / NMP mixture (3:1, 0.08 M). The reaction mixture was stirred at 40 °C for 1 hour to overnight. Ethyl acetate was added to the reaction mixture and the organic layer was washed with water, dried using a phase separator and concentrated in vacuo. The crude product was purified by silica gel column chromatography (DCM / MeOH) and by reverse phase flash chromatography (water / ACN), optionally followed by extraction (DCM / water), to give the product in 14% - 28% yield.
[0814] General Procedure E :
[0815] Under RT, N,N'-diisopropylmethanediamine (3.00 eq) was added to a stirred solution of acid 70a (0.07 mmol, 1.00 eq) in alcohol (0.25 M). The reaction mixture was stirred at RT overnight. The mixture was concentrated in vacuo. The crude product was purified by reverse phase flash chromatography (water / ACN) to give the product in 52% - 60% yield.
[0816] Compound 70a
[0817]
[0818] At room temperature, LiOH·H2O (2.00 g, 46.5 mmol, 9.00 eq) was added to a stirred solution of ester 11c (2.17 g, 5.17 mmol, 1.00 eq) in a water / THF mixture (1:1, 0.14 M). The reactants were then heated at 50 °C and stirred at this temperature overnight. The reaction mixture was diluted with ethyl acetate and the two phases were separated. The aqueous phase was washed with ethyl acetate. The aqueous layer was acidified to pH 1 with concentrated HCl. The aqueous layer was extracted with ethyl acetate. The combined organic layers were dried using a phase separator and concentrated in vacuo to give the desired compound as a beige powder (1.4 g, 63%).
[0819] Analytical data LC - MS / 1H NMR
[0820] rt = 1.25 min, 406.0 [M+H]+ (91% UV absorbance).
[0821] 1H NMR (400 MHz, DMSO-d6) δ 11.72 (s, 1H), 9.12 (s, 1H), 9.06 (s, 1H), 7.29 (dd, J = 7.6, 1.7 Hz, 1H), 7.26–7.19 (m, 1H), 6.99 (ddd, J = 8.0, 4.5, 3.3 Hz, 2H), 6.94 (td, J = 7.4, 1.1 Hz, 1H), 6.67–6.60 (m, 2H), 6.49 (ddd, J = 8.0, 2.4, 1.1 Hz, 1H), 4.88 (s, 1H), 3.78 (s, 3H), 3.44 (t, J = 12.7 Hz, 1H), 2.75 (dd, J = 17.1, 11.8 Hz, 1H), 2.64–2.52 (m, 2H), 2.34–2.24 (m, 4H).
[0822] Table 3: Synthesis and analytical data of Compounds 12e, 12g, 50a, 50b, 52a - 65a
[0823]
[0824]
[0825]
[0826]
[0827]
[0828]
[0829]
[0830]
[0831]
[0832]
[0833] Example 5
[0834] Enantioselective synthesis of Compound 51a and synthesis of Compounds 66b and 67b
[0835]
[0836] Compound 51b
[0837]
[0838] 28a (55 mg, 0.25 mmol, 1.00 equiv) was successively charged into a 1 mL vial. The condensation of aldehyde and β-ketoester was carried out according to the reported procedure, for example, Chemical and Pharmaceutical Bulletin, 1986, 34, 1589. DMF (0.28 mL, 0.92 M) containing 2-[(3-hydroxyphenyl)methylene]-3-oxo-butanoic acid (4-methyltetrahydropyran-4-yl) ester (71) (101 mg, 0.33 mmol, 1.30 equiv) and molecular sieves were added. The reaction mixture was stirred at 100 °C overnight. The reaction mixture was concentrated in vacuo. The crude product was purified by silica gel column chromatography (acetone:toluene) to afford the desired compound (86 mg, 61%, 1:1 d.r).
[0839] Analytical data LC - MS / 1H NMR
[0840] 2 kinds of 50 / 50 diastereoisomers
[0841] rt = 0.85 and 0.86 min, 504.2 and 504.2 [M+H]+, total 90% Uv absorbance
[0842] 1H NMR (DMSO) δ: 9.12 (d, J = 6.5 Hz, 1H), 9.02 (d, J = 12.8 Hz, 1H), 7.34–7.10 (m, 1H), 7.05–6.42 (m, 7H), 4.88 (d, J = 18.5 Hz, 1H), 3.78 (d, J = 7.5 Hz, 3H), 3.70–3.46 (m, 3H), 3.29–3.23 (m, 2H), 2.68 (d, J = 6.9 Hz, 1H), 2.61–2.52 (m, 1H), 2.49–2.38 (m, 1H), 2.31 (d, J = 6.2 Hz, 4H), 1.97 (d, J = 13.2 Hz, 2H), 1.56 (d, J = 10.8 Hz, 2H), 1.34 (d, J = 1.3 Hz, 3H)
[0843] Compound 72a
[0844]
[0845] A suspension of Hantzsch 1,4-DHP 51b (86 mg, 90%, 0.15 mmol, 1.00 equiv) and 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (35 mg, 0.15 mmol, 1.00 equiv) in DCM (1.5 mL, 0.10 M) was stirred at 0 °C for 1 h. The reaction mixture was filtered, the solid was washed with DCM and the filtrate was concentrated under reduced pressure to give a residue. The crude product was purified by silica gel column chromatography (acetone:toluene) to afford the desired compound (67 mg, 81%).
[0846] Analytical data LC - MS / 1H NMR
[0847] rt = 0.94 min, 502.1 [M+H]+ (89% UV absorbance) (the impurity from LCMS at rt = 1.06 min was 6%, so the actual purity = 93%)
[0848] 1H NMR (DMSO) δ: 9.42 (s, 1H), 7.30–7.22 (m, 2H), 7.21–7.11 (m, 1H), 7.06–7.00 (m, 1H), 6.95 (td, J = 7.5, 1.1 Hz, 1H), 6.74 (dd, J = 8.3, 2.4 Hz, 1H), 6.57–6.46 (m, 2H), 3.81 (s, 4H), 3.53–3.34 (m, 3H), 3.26 (d, J = 16.6 Hz, 3H), 3.04–2.86 (m, 1H), 2.71–2.57 (m, 1H), 2.53 (s, 3H), 1.78 (s, 2H), 1.56 (s, 2H), 1.19 (s, 3H)
[0849] Compound 51a
[0850]
[0851] In a vial, pyridine 72a (67 mg, 90%, 0.120 mmol, 1.00 equiv) was dissolved in DCM (0.60 mL, 0.20 M). Then, diethyl 2,6-dimethyl-1,4-dihydropyridine-3,5-dicarboxylate (64 mg, 95%, 0.24 mmol, 2.00 equiv) and S-TRIP (1.9 mg, 97%, 2.40 μmol, 0.02 equiv) were added. The reaction mixture was stirred at 40 °C overnight. The solvent was removed under reduced pressure and the residue was purified via silica gel column chromatography (acetone:toluene) to afford the desired compound (23 mg, 37%).
[0852] Analytical data LC - MS / 1H NMR
[0853] rt = 2.38 min, 504.3 [M+H]+, 98% UV 220 nm
[0854] 1H NMR (DMSO-d6, 500 MHz) δ 9.12 (d, 2H, J = 7.5 Hz), 7.28 (dd, 1H, J = 1.5, 7.6 Hz), 7.23 (dt, 1H, J = 1.6, 7.8 Hz), 7.0 - 7.0 (m, 2H), 6.94 (t, 1H, J = 7.4 Hz), 6.6 - 6.7 (m, 2H), 6.5 - 6.5 (m, 1H), 4.91 (s, 1H), 3.77 (s, 3H), 3.5 - 3.6 (m, 2H), 3.4 - 3.5 (m, 1H), 3.2 - 3.3 (m, 2H), 2.73 (dd, 1H, J = 11.7, 17.1 Hz), 2.5 - 2.6 (m, 2H), 2.2 - 2.4 (m, 4H), 1.98 (br d, 2H, J = 14.1 Hz), 1.5 - 1.7 (m, 2H), 1.35 (s, 3H)
[0855] Chiral SFC: Pirkle Whelk-01 (R,R), CO2:MeOH + 0.5% IPAm = 6:3, 2.4 mL / min, 104 bar, λ = 254, t R (minor) = 3.9 min; t R (major) = 4.7 min, d.r. = 98:2.
[0856] Compound 66b
[0857]
[0858] 28a (35 mg, 0.16 mmol, 1.00 equiv) was successively charged into a 1 ml vial. The condensation of aldehyde and β-ketoester was carried out according to the reported method, such as Chemical and Pharmaceutical Bulletin, 1986, 34, 1589. DMF (0.18 mL, 0.92 M) and molecular sieves containing 2-(4-fluoro-3-hydroxybenzylidene)-3-oxobutanoic acid tetrahydro-2H-pyran-4-yl ester (73) (74 mg, 0.21 mmol, 1.30 equiv, 87%) were added. The reaction mixture was stirred overnight at 100 °C. The reaction mixture was concentrated in vacuo. The crude product was purified by reverse-phase column chromatography (water:acetonitrile) to give the desired compound (47 mg, 57%, 1:1 d.r.).
[0859] Analytical data LC - MS / 1H NMR
[0860] 2 kinds of 50 / 50 diastereoisomers
[0861] Retention times = 2.04 and 2.08 min, 508.4 [M+H]+, 48 + 50.8% UV 220 nm
[0862] 1H NMR (DMSO-d6, 600 MHz): δ (ppm) 9.40 - 9.62 (m, 1H), 9.00 - 9.31 (m, 1H), 7.21 - 7.28 (m, 1H), 7.12 - 7.19 (m, 1H), 6.92 - 7.00 (m, 2H), 6.83 - 6.89 (m, 1H), 6.70 - 6.82 (m, 1H), 6.50 - 6.63 (m, 1H), 4.86 (s, 1H), 4.77 - 4.83 (m, 1H), 3.76 - 3.80 (m, 3H), 3.69 - 3.76 (m, 1H), 3.34 - 3.68 (m, 4H), 2.65 - 2.78 (m, 1H), 2.51 - 2.61 (m, 1H), 2.38 - 2.49 (m, 1H), 2.27 - 2.33 (m, 4H), 1.77 - 1.83 (m, 1H), 1.62 - 1.69 (m, 1H), 1.49 - 1.56 (m, 1H), 1.31 - 1.38 (m, 1H)
[0863] Compound 67b
[0864]
[0865] 28a (40 mg, 0.18 mmol, 1.00 equiv) was successively charged into a 1 mL vial. The condensation of aldehyde and β-ketoester was carried out according to the reported method, e.g., Chemical and Pharmaceutical Bulletin, 1986, 34, 1589. DMF (0.20 mL, 0.92 M) containing 2-(2,4-difluoro-3-hydroxybenzylidene)-3-oxobutanoic acid tetrahydro-2H-pyran-4-yl ester (74) (79 mg, 0.24 mmol, 1.30 equiv) and molecular sieves were added. The reaction mixture was stirred at 100 °C overnight. The reaction mixture was concentrated in vacuo. The crude product was purified by reverse-phase column chromatography (water:acetonitrile) to give the desired compound (33 mg, 34%, 1:1 d.r.).
[0866] Analytical data LC - MS / 1H NMR
[0867] 2 kinds of 50 / 50 diastereoisomers
[0868] Retention times = 2.06 and 2.1 min, 526.3 and 526.4 [M+H]+, 45.5 and 54.5% UV 220 nm
[0869] 1H NMR (DMSO-d6, 500 MHz): δ (ppm) 9.69 - 9.82 (m, 1H), 9.11 - 9.25 (m, 1H), 6.84 - 7.34 (m, 4H), 6.75 - 6.82 (m, 1H), 6.50 - 6.70 (m, 1H), 5.04 (d, J = 18.0 Hz, 1H), 4.75 (td, J = 8.9, 4.4 Hz, 1H), 3.76 - 3.82 (m, 4H), 3.62 - 3.73 (m, 2H), 3.33 - 3.47 (m, 3H), 2.67 - 2.81 (m, 1H), 2.52 - 2.65 (m, 1H), 2.39 - 2.49 (m, 1H), 2.23 - 2.31 (m, 3H), 1.77 - 1.82 (m, 1H), 1.52 - 1.63 (m, 2H), 1.33 (dt, J = 12.8, 3.3 Hz, 1H)
[0870] Example 6
[0871] Screening assay and biological characterization for identifying inhibitors of coronin 1 promoter activity
[0872] To identify compounds with coronin 1 promoter inhibitory activity, the coronin 1 promoter was initially characterized by cloning into a promoterless plasmid driving a luciferase or fluorescence construct as a readout of promoter activity. Subsequently, we screened various compounds from a library to identify coronin 1 promoter inhibitory compounds. This was then verified by qPCR and Western blotting, and SAR-based optimization, safety assessment, and immunosuppressive activity assessment were performed in an autoimmune-inflammatory model of psoriasis. These procedures are detailed below:
[0873] Vector design, transfection and compound identification via fluorescence readout
[0874] The present inventors designed a fluorescence-based screening assay to identify compounds that selectively inhibit coronin 1 promoter activity. The vector used for this assay contains a promoter sequence consisting of: 3 kb or 1.53 kb (P1.5; SEQ ID NO: 1 - 3) or 1 kb or 737 bp (P.7; SEQ ID NO: 4 - 6) sequences, which are located upstream of the TSS of the coronin 1 gene in a plasmid lacking a promoter (promoterless vector) but containing a luciferase expression gene as a readout. J774 macrophages or RBL were transfected with this plasmid and luciferase activity was evaluated ( Figure 1)。Any other non-immune cells or preferably immune cell types can be used in place of macrophages or RBL cells. The 1530 base pair fragment of SEQ ID NOs: 1-3 located 5' (upstream) of the transcription start site of coronin 1 gave the best coronin 1 promoter activity in the luciferase activity assay. Additionally, fragment P0.7 also showed coronin 1 promoter activity in the luciferase activity assay( Figure 1 )。However, considering the presence of additional regulatory elements, the 1530 bp fragment was further characterized and used to develop a screening assay.
[0875] The murine coronin 1 promoter sequences of SEQ ID NOs: 1-6 were each cloned into plasmids lacking a promoter (promoterless) but containing a destabilized green fluorescent protein (GFP) cassette. Rat basophilic leukemia (RBL) cells were transfected with the plasmids, stable GFP-expressing cells were enriched, incubated with various compounds, and the inhibition of the coronin 1 promoter was evaluated by assessing the green fluorescence value( Figure 2 )。
[0876] As an unrelated promoter, the early cytomegalovirus promoter element was cloned into a promoterless red fluorescent protein (RFP) expression plasmid. Rat basophilic leukemia (RBL) cells were transfected with the plasmid, stable RFP-expressing cells were enriched, incubated with various compounds, and the red fluorescence value was evaluated. Analysis of the inhibition of an unrelated promoter driving red fluorescent protein (RFP) expression (in this case, the early cytomegalovirus promoter) evaluated the non-specificity of the compounds being analyzed.
[0877] Plasmids were independently transfected into immune cells (rat basophilic leukemia, RBL cells) to generate green- and red-fluorescent RBL cells, which were then enriched by flow cytometry. These cells were then mixed in equal proportions (1:1) and cultured in 96-well plates at 100,000 cells / well in 200 μl of phenol red-free RPMI supplemented with 8% fetal bovine serum, L-glutamate, and antimicrobials (penicillin, streptomycin) and various compounds (at 3 μg / ml and 5 μg / ml concentrations) from an available chemical library. At defined time points (8 hours, 24 hours, and 48 hours), GFP and RFP fluorescence were measured using a 96-well microplate reader (Synergy, BioTek Instruments). The top hit compounds identified from this initial screen of 12,000 compounds that selectively reduced GFP fluorescence are listed in Table 5. The selected compounds showed varying levels of modulation of GFP driven by the coronin 1 promoter and RFP fluorescence driven by the CMV promoter. After incubation with the top coronin 1 promoter inhibitory compounds, GFP and RFP fluorescence were analyzed with a microplate reader. Shown are the percentages of GFP reduction (left column) and RFP reduction (right column) at 48 hours for the compound at 5 μg / ml. Cycloheximide (CHX) served as a positive control, while medium and DMSO served as negative controls. Figures 3A to 3C Shown is the top hit of compound 11 from the initial screen that selectively reduced GFP values. Cells were imaged using a fluorescence microscope to verify fluorescence inhibition ( Figure 3A ) as well as to assess morphology and viability (in addition to GFP downregulation confirmation). Additionally, quantitative polymerase chain reaction (qPCR) of coronin 1 mRNA transcripts revealed a reduction for compound 11 ( Figure 3B ). The primers used for qPCR of RBL cells are listed below:
[0878] Cor1a forward primer: 5’GTG ACA GCT CTA TCC GGT ATT T 3’ (SEQ ID NO.:7)
[0879] Cor1a reverse primer: 5’ACG TTG AGA CTC CTT GGA AC 3’ (SEQ ID NO.:8)
[0880] GAPDH forward primer: 5’GGG AAA CCC ATC ACC ATC TT 3’ (SEQ ID NO.:9)
[0881] GAPDH reverse primer: 5’CCA GTA GAC TCC ACG ACA TAC T 3’ (SEQ ID NO.:10)
[0882] GAPDH was used as a housekeeping gene for normalization purposes. SYBR Green-based qPCR was performed for evaluation.
[0883] Western blot
[0884] RBL cells that had been incubated with the compound (10 μg / ml) for 96 hours were lysed at 4 °C in Triton-X 100 buffer (Roche) containing 0.2% SDS with protease and phosphatase inhibitors, followed by protein determination (BCA, Pierce) and SDS-PAGE. Equal amounts of protein were transferred to nitrocellulose and probed with antibodies against the indicated proteins (actin and coronin 1), followed by an HRP-conjugated secondary antibody and developed using an enhanced chemiluminescence imager (Fuji) Figure 3C )
[0885] Spleen cells from mice that had been administered compound 11 (150 mg / kg body weight, B.D, S.C route) or vehicle control (DMSO) for 5 days were lysed at 4 °C in Triton-X100 buffer (Roche) containing 0.2% SDS with protease and phosphatase inhibitors, followed by protein determination (BCA, Pierce) and SDS-PAGE, transferred to nitrocellulose and probed with antibodies against the indicated proteins (actin and coronin 1), followed by an infrared dye-conjugated secondary antibody and imaged using a Licor system Figure 7 、 Figure 11 )
[0886] Human PBMCs that had been incubated with the indicated compound (20 μg / ml concentration) for 96 hours were lysed at 4 °C in Triton-X 100 buffer (Roche) containing 0.2% SDS with protease and phosphatase inhibitors, followed by protein determination (BCA, Pierce) and SDS-PAGE, transferred to nitrocellulose and probed with antibodies against the designated proteins (actin and coronin 1), followed by an HRP-conjugated secondary antibody and developed using an enhanced chemiluminescence imager (Fuji) Figure 8A )
[0887] Analysis of coronin 1 promoter - driven GFP fluorescence in RBL cells incubated with calcium channel blockers :
[0888] Any changes in coronin 1 promoter-driven GFP fluorescence of RBL cells that had been incubated with the indicated concentrations of calcium channel blockers (amlodipine (3.125 μM) and verapamil (8 μM)) for 48 hours were analyzed by flow cytometry. The results showed that the calcium channel blockers had no effect on coronin 1 promoter activityFigure 4 )。
[0889] Inhibition (specific activity) of coronin 1 promoter - driven GFP using live - dead staining for cytotoxicity CMV promoter-driven suppression of RFP (non-specific activity) and EC of cell viability 50 Analysis :
[0890] RBL cells expressing GFP under the coronin 1 promoter and optionally RBL cells expressing RFP under the CMV promoter were mixed in equal amounts and incubated with the indicated concentrations of the compound for 48 to 65 hours, and the changes in the values of the coronin 1 promoter (GFP fluorescence) and CMV promoter (RFP fluorescence) were analyzed by flow cytometry. In addition, cells were labeled with a live-dead marker to assess the cell viability status by flow cytometry. Cycloheximide (CHX) was used as a positive control, and DMSO was used as a negative control. The effective concentrations (EC 50 ) values of coronin 1 promoter inhibition analyzed via GFP fluorescence, non-specific promoter inhibition analyzed via RFP fluorescence driven by the CMV promoter, and cell viability via live / dead staining are shown in Tables 6 and 7 as a measure of the toxicity of the compounds (10 - 22 and 50a - 65a) in flow cytometry. Based on the EC 50 analysis of the inhibition of GFP fluorescence driven by the coronin 1 promoter, the enantiomer of the (4S,7R)-configuration (structure Figures 9A to 9C ) was identified. For compounds containing two stereocenters, this is illustrated by enantiomers 11c and 13a. For compounds with more than two stereocenters, the most active nuclear configuration is also the (4S,7R) shown for compound 12e. Subsequent EC 50 evaluations were performed using compound 13a as the standard of relative potency (Table 7), and the relative potency was normalized to a value of 1.00 (relative potency calculated as [EC 50 GFP inhibition of 13a] / [EC 50 GFP inhibition of the compound of interest]).
[0891] In vitro toxicity assessment using the Alamar Blue assay :
[0892] The in vitro cytotoxicity test was performed using Alamar blue (Invitrogen, USA) according to the manufacturer's protocol. Briefly, RBL cells pretreated with a coronin 1 expression inhibitor or vehicle control were re-seeded and cultured in a 96-well plate at a concentration of 1×10 4 cells / ml of medium. Alamar blue was added to the wells and further incubated at 37 °C for 4 hours. The absorbance at 600 nm was measured using a microplate reader (Synergy, BioTek Instruments). DMSO and cycloheximide were used as vehicle and positive control, respectively ( Figure 5A ).
[0893] In vitro toxicity assessment using the MTT assay :
[0894] Using the manufacturer's protocol, MTT assays were performed with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Cayman Chemical). Briefly, RBL cells pretreated with coronin 1 expression inhibitor or vehicle control were re-seeded and cultured at a concentration of 1 × 10 4 cells / ml medium in 96-well plates, 10 μL of MTT was added and incubated at 37 °C for 4 h. Finally, the culture supernatant was removed and the formazan crystals were dissolved with 100 μl of crystal dissolving solution, and the absorbance at 570 nm was measured using a microplate reader (Synergy) Figure 5B ).
[0895] In vivo administration of coronin 1 promoter inhibitors to regulate body weight as a measure of toxicity and ADVIA analysis :
[0896] The coronin 1 expression inhibitor (compound 11) was initially dissolved in DMSO at a concentration of 100 mg / ml. In parallel, a 50:50 solution of miglyol 812 and kolliphor EL (M+K) was prepared. The coronin 1 expression inhibitor:M+K was mixed at a ratio of 30:70 and vortexed for 5 min to prepare a homogeneous suspension, resulting in a final concentration of 30 mg / ml. Subsequently, 100 μl / mouse was administered intraperitoneally or subcutaneously using an insulin syringe. The mice used in the study were divided into age- and sex-matched groups, weighed before the start of the study and their body weight, behavioral changes, fur changes, fecal consistency and urine color were monitored regularly. The administration of the compound continued for 14 days, at the end of which the animals were sacrificed and blood parameters were evaluated using the ADVIA platform( Figures 6A to 6E ).
[0897] In vivo administration of coronin 1 promoter inhibitors as a measure of in vivo coronin 1 reduction :
[0898] The coronin 1 expression inhibitor was initially dissolved in DMSO at a concentration of 100 mg / ml. In parallel, a 50:50 solution of miglyol 812 and kolliphor EL (M+K) was prepared. The coronin 1 expression inhibitor:M+K was mixed at a ratio of 30:70 and vortexed for 5 min to prepare a homogeneous suspension, resulting in a final concentration of 30 mg / ml. Subsequently, 100 μl / mouse was administered intraperitoneally or subcutaneously using an insulin syringe. The mice used in the study were divided into age- and sex-matched groups, weighed before the start of the study and their body weight, behavioral changes, fur changes, fecal consistency and urine color were monitored regularly. For coronin 1 downregulation studies, the administration continued for 5 days, and then the spleen was harvested and analyzed by western blotting( Figure 7 ).
[0899] Human peripheral blood monocyte culture for coronin 1 western blot and pro - inflammatory cytokine production :
[0900] Use standard Histopaque 1.077 gradient centrifugation methodology to enrich monocytes from heparinized or EDTA-treated blood or buffy coats from healthy volunteers. After enrichment, the monocyte fraction is washed thoroughly with plain RPMI and then counted and seeded at a density of 200,000 cells / well in a 96-well plate with a volume of 200 μl RPMI-1640 (Sigma), containing 1x penicillin and streptomycin (Gibco), 2 mM L-glutamine (Gibco), 10% heat-inactivated FCS (PAA), 50 units / ml heparin, and the indicated concentration of vehicle (DMSO) or coronin 1 inhibitor. The cells are incubated for five days in a humidified incubator at 37 °C with 5% CO2, and the expression inhibitors and vehicle are replenished by replacing 50% of the medium 48 hours after seeding. Subsequently, coronin 1 downregulation in the cells is evaluated by Western blot ( Figure 8A ), and in parallel, the cells are stimulated overnight with anti-CD3 (2 μg / ml) and anti-CD28 (10 μg / ml) antibodies and treated with brefeldin A for a duration of 4 hours and subjected to surface staining (for CD3, CD4, CD8, and CD19) and live-dead marker and fixed with 4% formaldehyde, permeabilized with 0.1% saponin and subjected to intracellular staining for interleukin-2 ( Figure 8B , Figure 8C ).
[0901] Human peripheral blood mononuclear cell culture for mixed lymphocyte reaction :
[0902] The mixed lymphocyte reaction (MLR) is an in vitro model used to evaluate allogeneic antigen-driven immune responses and is thus considered an in vitro model for transplant rejection responses (or alloimmune responses). To assess the inhibition of coronin 1 modulators on allogeneic responses using the MLR method, mononuclear cells from heparinized or EDTA-treated blood or buffy coats from two healthy volunteers were enriched using the standard Histopaque 1.077 gradient centrifugation methodology detailed above. After enrichment, one of the donor PBMCs was considered the "responder" and the other was considered the "stimulator". The "stimulator" was treated with mitomycin to prevent proliferation, while the "responder" PBMCs were not treated. The stimulator and responder PBMCs were washed thoroughly with normal RPMI and then counted and seeded separately at a density of 100,000 cells / well in a 96-well plate (responder plus stimulator = 200,000 cells / well), with the volume of the plate being 200 μl of RPMI-1640 (Sigma), containing 1x penicillin and streptomycin (Gibco), 2 mM L-glutamine (Gibco), and 10% heat-inactivated FCS (PAA) as well as the indicated concentration of vehicle (DMSO) or coronin 1 expression inhibitor. The cells were incubated with the expression inhibitor in a humidified incubator at 37 °C with 5% CO2 for five days, and at the end, 0.5 μCi of tritiated thymidine was added to all wells and further incubated for 20 hours, followed by harvesting on GF / C filters and measuring the counts of DNA incorporation using a Packard instrument as a measure of the immune response ( Figure 10 ).
[0903] Evaluation of the therapeutic activity of the compound in imiquimod-induced psoriasis :
[0904] Wild-type mice (Balb / c strain, 8 - 12 weeks old) were age- and sex-matched. The back skin was shaved with a trimmer over an area of approximately 2 cm 2 and topical application of 5% imiquimod cream (Aldara) was started on day 1 and continued until day 7 in the morning. For compound administration, the compound was topically applied to the mice twice daily starting 48 hours before the first application of imiquimod and throughout the experiment until day 7. In the morning, the compound was applied 2 hours before imiquimod ( Figure 12A ). The inflammatory lesions and general health status of the mice were scored daily as follows:
[0905] Grade Erythema Scale Skin thickening 0 No No Normal skin 1 Mild Thin flakes Mild 2 Moderate Moderate flakes Moderate 3 Severe (<1 cm2) Thin slice (<1 cm2) Rough and hard
[0906] Evaluation of the therapeutic activity of the compound in K5.Stat3-induced psoriasis:
[0907] Wild-type K5.Stat3 mice (FVB strain) were anesthetized and a transparent scotch tape was applied to the back over an area of approximately 2 cm 2The tape was peeled 30 times on the area. For compound administration, the compound 11 (75 mg / kg body weight per administration) was topically administered in a vehicle preparation with PPG400 and Kolliphor EL (3:1 ratio) two days before the tape peeling procedure and then twice daily until the end of the study. The lesions were scored for erythema, scaling, and thickening on a grading scale between 0 - 4 as follows.
[0908]
[0909] The time-course scoring of the disease score is shown in Figure 17 as follows.
[0910] Evaluation of the therapeutic activity of the compound in the DSS colitis model :
[0911] Wild-type mice were fed ad libitum with drinking water containing 2.5% or 3% DSS (MP Biomedicals, 36,000 - 50,000 M.wt. #02160110 colitis grade) for a duration of 5 to 7 days, and the kinetics of colitis disease progression were monitored. The DSS solution was replaced with fresh solution every three days. Administration of the compound (compound 12, 100 mg / kg body weight per administration) was started two days before providing DSS-containing water. Throughout the study, it was administered subcutaneously twice daily (BID; twice daily). The fur signs, lethargy, ano / peri-rectal inflammation, perianal staining, fecal consistency, and weight loss of the mice were evaluated regularly. The scoring was based on the following three main criteria: fecal consistency, blood in the feces, and weight loss. The scoring of feces was as follows: normal feces (score 0), semi-solid feces (score 1), mushy unformed feces (score 2), watery feces (score 3), and diarrhea (score 4). The scoring of fecal blood was as follows: no blood (score 0), occult (score 1), orange-red discoloration (score 2), red staining (score 3), and bloody (score 4). The scoring of weight loss was as follows: 0% loss (score 0), 8% - 10% loss (score 1), 10% - 15% loss (score 2), 15% - 19% loss (score 3), and 20% and above loss (score 4). The disease scores were plotted, where the scores from all three criteria were added together and shown. The study was terminated when the mice reached 20% weight loss. The colon was dissected from the ileocecal junction to the anus and measured with a ruler on a non-absorbent surface. Care was taken not to stretch the intestine. The results are shown in Figure 18 as follows.
[0912] Evaluation of the therapeutic activity of the compound in the allograft infection model :
[0913] To investigate whether compound 13a can maintain an anti-pathogen response while inducing suppression of the autoimmune response, we used an allogeneic infection model (permission number 1710) established with the approval of the Kantonale Veterinaeramt Basel-Stadt, Switzerland. Experiments were conducted in accordance with Swiss veterinary law and carried out in the animal facility of the Department of Biomedicine, University Hospital Basel, Switzerland. Healthy 13-week-old wild-type female C57BL / 6 mice (Janvier Labs, France) maintained under specific pathogen-free conditions (biosafety level 2) were anesthetized and then subcutaneously implanted with a sterile cylindrical Teflon tissue cage (32 mm × 10 mm; volume: 1.9 mL) with 130 regularly spaced holes (Angst+Pfister AG, Zurich, Switzerland). After the wound had completely healed, the sterility of the cage was tested. Prophylaxis (50 MPK, BID) was started 12 hours before infection with either vehicle control or compound 13a. Methicillin-resistant Staphylococcus aureus (MRSA) ATCC43300 (526 CFU / cage) or Candida albicans ATCC5341 (2000 CFU / cage) was injected directly into the cavity of each cage. Treatment was started immediately after infection and continued twice daily for 8 days. On days 1, 3, and 8 after infection, tissue cage fluid was collected to assess the planktonic bacterial load by plating. On day 8, the mice were sacrificed and the tissue cages of each mouse were removed under sterile conditions. The removed tissue cages were washed twice with phosphate-buffered saline, then vortexed for 30 seconds, sonicated at 130 W for 3 minutes, and vortexed again for 30 seconds to release adherent bacteria from the biofilm. The adherent bacteria were quantified by plating appropriate dilutions. The presence of regrowth of adherent bacteria was investigated by further incubating the sonicated cages in a suitable growth medium for the pathogen at 37 °C for 48 hours. Any visualization of a positive culture was defined as treatment failure. The results of this study are summarized in Figure 19 A to Figure 19 B.
[0914] Evaluation of the therapeutic activity of the compound in the mycobacterial infection model :
[0915] Mouse macrophages (J774, from ATCC) were cultured with compound 11 (3 mg / ml and 5 mg / ml) in medium (DMEM containing 10% heat-inactivated FCS) for 4 days, with the compound being renewed every 48 hours. Then the cells were seeded on 10-well slides and infected with Mycobacterium bovis BCG expressing GFP at 0.02 OD and cultured at 37 °C, 5% CO2 for 1 hour. Subsequently, the cells were washed three times to remove free bacteria and then tracked in complete medium at 37 °C, 5% CO2 for 3 hours. The cells were washed with PBS and fixed in cold methanol (-20 °C) for 4 minutes, after which they were blocked (PBS containing 5% FCS) and stained with primary antibodies against coronin 1 (rabbit serum 1002), LAMP-1 (rat, 1D4B), followed by staining with secondary antibodies labeled with Alexa-fluor goat anti-rabbit 633 and Alexa-fluor goat anti-rat 568 and fixed using antifade (Biorad). The slides were imaged using a confocal laser scanning microscope LSM510 Meta (Zeiss) and processed with the corresponding software. The results are shown in Figure 19 C.
[0916] Evaluation of the therapeutic activity of the compound in graft-versus-host disease (GvHD) :
[0917] The evaluation of the GvHD response was performed as follows. Briefly, total T cells were isolated from WT C57BL / 6Ly5.1 (I-A b ) mice by negative selection using a stem cell technology kit (#19851). The isolated cells were labeled with cell trace violet (Thermo Fisher) and intravenously transferred (14 × 10 6 cells) via tail vein injection into recipient BDF1 Ly5.2 (I-A bd ) mice (day 0). Subsequently, the mice were divided into groups receiving vehicle or compound 13a (50 MPK, BD, SC) for 7 consecutive days from day 1 to day 7. On day 7, the CTV dilution-based proliferation of the transferred T cells was analyzed by harvesting the spleen. Single cells were prepared and stained for CD3, CD4, CD8, Ly5.1, and viability markers and subjected to flow cytometry analysis. The percentage of Ly5.1+CTV low cells (divided cells) ([[]]END]] Figure 12B ) was extracted using FlowJo software.
[0918] Table 4: Sequences
[0919]
[0920]
[0921]
[0922]
[0923]
[0924]
[0925]
[0926] Table 5: Percentage change in GFP / RFP fluorescence after compound treatment. A selective decrease in the GFP value is particularly desired, with minimal change in the RFP value. Decrease
[0927]
[0928]
[0929] Table 6: Effective concentration (EC 50 ) value
[0930]
[0931]
[0932]
[0933]
[0934]
[0935] n.d. Not determined
[0936] Table 7: Relative potency values for coronin 1 promoter inhibition
[0937]
[0938]
[0939]
[0940]
[0941]
[0942] * Relative potency calculated as [EC 50 GFP inhibition 13a] / [EC 50 GFP inhibition of the compound of interest
[0943] Characterization of the compounds identified by the screening assay, together with the validation studies conducted in in vitro and in vivo biological assays, reveals that the compounds identified by the screening assay are immunosuppressive in nature and capable of inhibiting coronin 1 promoter activity.
[0944] Example 7
[0945] To identify the targets of coronatine 1 modulating compounds, thermal proteome profiling (TPP) was employed, a methodology based on the property that proteins change their thermal stability upon interaction with small molecules (Savitski, M.M. et al., Science, 2014. 346(6205): p. 1255784). To this end, rat basophilic leukemia (RBL) cells were incubated with compound 12e, then subjected to gradient thermal denaturation (37 °C / 41 °C / 44 °C / 47 °C / 50 °C / 53 °C / 56 °C / 59 °C / 63 °C / 67 °C), and mass spectrometry assessment was performed on proteins that became stable or unstable upon interaction with the compound. This procedure led to the identification of bromodomain-containing 3 (BRD3) protein as the top hit stabilized by the compound ( Figure 13 ). Interestingly, this is the only stable member in the bromodomain and extra-terminal (BET) family of proteins. Currently, no compounds selectively targeting BRD3 exist, nor is the effect of selective BRD3 inhibition or BRD3 depletion by in vivo gene knockout in animal models known.
[0946] The BET family consists of four members (BRD2, BRD3, BRD4, and BRDT), which are characterized by the presence of two bromodomains, namely bromodomain 1 (BD1) and bromodomain 2 (BD2), which recognize the acetylated N-terminal tails of histones and thus act as readers of the lysine acetylation state of chromatin. In addition, by interacting with components of the transcriptional machinery and chromatin remodeling enzymes (Taniguchi, Y., Int J Mol Sci, 2016.17(11)), they regulate diverse transcriptional processes involved in the cell cycle, organogenesis, carcinogenesis, and inflammatory pathways. The bromodomains of the four BET family members are highly conserved, approximately 110 amino acids in length, and folded into bromodomain modules that contain a left-handed bundle composed of four α-helices (αZ, αA, αB, αC), which are connected by loop regions (ZA and BC loops) that contribute to substrate specificity (Fujisawa, T. and P. Filippakopoulos, Nat Rev Mol Cell Biol, 2017.18(4): pp. 246-262). While BRD2 and BRD4 are involved in cell cycle regulation, learning and memory, and inflammation (Korb, E. et al., Nat Neurosci, 2015.18(10): pp. 1464-73, Belkina, A.C. et al., J Immunol, 2013.190(7): pp. 3670-8, LeRoy et al., Mol Cell, 2008.30(1): pp. 51-60), the function of BRD3 is less well understood and has been considered redundant with BRD2 (Stonestrom, A.J. et al., Blood, 2015.125(18): pp. 2825-34).
[0947] "BET inhibitors" are compounds that interact with these bromodomains BD1 and BD2 to inhibit their functions. Compounds that interact non-selectively with these bromodomains by binding to BD1 and BD2 have been identified, and the small molecule JQ1 is a precursor (Filippakopoulos, P. et al., Nature, 2010. 468(7327): pp. 1067-73). However, this compound is toxic due to non-selective inhibition of all BET family members (Shorstova, T. et al., Br J Cancer, 2021. 124(9): pp. 1478-1490, Qi, J. and Y. Shi, Cancer Cell, 2020. 37(6): pp. 764-766). To minimize these problems, compounds that selectively bind to BD1 of all BET families or BD2 of the BET family have recently been developed and characterized (Gilan, O. et al., Science, 2020. 368(6489): pp. 387-394, Faivre, E. J. et al., Nature, 2020. 578(7794): pp. 306-310). However, to our knowledge, no compounds that selectively target BRD3 have been reported in the literature. Interestingly, using our compound 12e, BRD3 is the only member of the BET protein family that is stabilized in a statistically significant manner, with a q-value of 0.0007. The TPP profiles of BRD2 and BRD4 revealed insignificant changes. This observation is in sharp contrast to the reported TPP data of other BET inhibitory compounds (JQ1, IBET-BD1, IBET-BD2, RVX-208, IBET-151) that trigger the thermal stabilization of BRD2, BRD3, and BRD4 proteins by binding to their bromodomains BD1 and / or BD2. Currently, no compounds that selectively target BRD3 exist, and the effects of selective BRD3 inhibition or BRD3 depletion by in vivo gene knockout in animal models are not known.
[0948] Based on the raw data from TPP, to further confirm the interaction of the compound with BRD3, the affinity of the (4S,7R)-configured compound 12e for the two bromodomains of BRD3 was analyzed using an in vitro assay system named bromoscan (Eurofins). This revealed that compound 12e preferentially binds to BD2 (with a Kd of approximately 10 nM), while the binding to BD1 (with a Kd of approximately 200 nM) is much weaker, as shown in Figure 15 . In this assay, compound 13a (Short Oxanyl D2E1, also known as SOD2E1) has a lower Kd value, 4 nM for BD2 and 150 nM for BD1, showing higher potency and approximately 40-fold selectivity for BD2 ( Figure 15 ).
[0949] To evaluate the role of BRD3 in regulating coronin 1 expression, RBL cells expressing GFP under the control of the coronin 1 promoter were treated with siRNA targeting brd3, which led to a significant downregulation of GFP driven by the coronin 1 promoter( Figure 14A ). These data together indicate that the compound binds to BRD3, thereby inhibiting coronin 1 transcription.
[0950] To understand the interaction mode of the compound with the bromodomains of BRD3, we co-crystallized compound 13a with its bromodomains BD1 and BD2 and obtained crystal diffraction data. The electron density maps of BRD3 BD1( Figure 16 , left panel) and BRD3 BD2( Figure 16 , right panel) bound to compound 13a were resolved at and resolutions, respectively. Amino acids in the hydrophobic pocket of the ZA loop that interacted with compound 13a were identified, thus confirming the molecular mechanism of the binding of this compound to the two bromodomains of BRD3.
[0951] These data confirm that the molecular target of the compound is BRD3, by regulating the expression of coronin 1 and immune responses in immune cells. Since we have demonstrated the immunosuppressive potential of coronin 1 promoter inhibitors in the context of autoimmune inflammatory diseases and allogeneic immune responses, the information provided in this article reveals the possibility of targeting BRD3 to control unwanted immune responses in the context of autoimmune and alloantigen-mediated diseases, in addition to BRD3-driven diseases.
[0952] Materials and methods
[0953] Thermal proteome profiling :
[0954] Thermal proteome profiling was performed as described (Savitski, M.M. et al., Science, 2014.346(6205): p. 1255784). Briefly, RBL cells (50 million / condition) were incubated with vehicle DMSO or compound 12e at concentrations of 6, 3 or 0 μM for 1 hour. At the end, cells were washed in ice-cold PBS, counted and subjected to heat denaturation (37 °C / 41 °C / 44 °C / 47 °C / 50 °C / 53 °C / 56 °C / 59 °C / 63 °C / 67 °C) for 3 minutes, lysed by freeze-thawing in liquid nitrogen, and the supernatant containing soluble proteins was separated by centrifugation at 100,000 for 30 minutes. Equal volumes of the supernatant were taken, subjected to trypsin digestion and labeled with 10plex-TMT (Thermo Fisher), and the labeled peptides were analyzed and quantified using mass spectrometryFigure 13 )。
[0955] BRD3 bromoscan analysis :
[0956] The T7 phage strain showing the bromodomain grows in a 24-well block in an Escherichia coli (E. coli) host derived from the BL21 strain. The E. coli is grown to the logarithmic phase and infected with T7 phage from a frozen stock solution (infection efficiency = 0.4), and incubated with shaking at 32 °C until lysis (90 minutes to 150 minutes). The lysate is centrifuged (5,000 xg) and filtered (0.2 μm) to remove cell debris. Streptavidin-coated magnetic beads are treated with biotinylated small molecules or acetylated peptide ligands at room temperature for 30 minutes to produce an affinity resin for bromodomain assays. The ligandated beads are blocked with excess biotin and washed with a blocking buffer (SeaBlock (Pierce), 1% BSA, 0.05% Tween 20, 1 mM DTT) to remove unbound ligands and reduce non-specific phage binding. The binding reaction is assembled by combining the bromodomain, ligandated affinity beads, and test compounds in 1x binding buffer (17% SeaBlock, 0.33x PBS, 0.04% Tween 20, 0.02% BSA, 0.004% sodium azide, 7.4 mM DTT). The test compounds are prepared as 1000X stock solutions in 100% DMSO. The Kd is determined using an 11-point 3-fold compound dilution series with one DMSO control point. All compounds for Kd measurement are distributed in 100% DMSO by acoustic transfer (non-contact dispensing). The compounds are then directly diluted into the assay such that the final concentration of DMSO is 0.09%. All reactions are carried out in polypropylene 384-well plates. The respective final volume is 0.02 ml. The assay plates are incubated with shaking at room temperature for 1 hour and the affinity beads are washed with wash buffer (1x PBS, 0.05% Tween 20). The beads are then resuspended in elution buffer (1x PBS, 0.05% Tween 20, 2 μM non-biotinylated affinity ligand) and incubated with shaking at room temperature for 30 minutes. The bromodomain concentration in the eluate is measured by qPCR. The bromoscan analysis is performed at Eurofins ( Figure 15 )。
[0957] BRD3 siRNA analysis :
[0958] Anti-brd3 Accel siRNA (target-specific siRNA) and control siRNA (non-targeting siRNA) were purchased from Dharmacon Horizon Discovery and 100 mM stock solutions were prepared in the provided siRNA buffer. In parallel, 5000 cells (WT RBL or GFP RBL cells) were seeded per well in a 48-well plate with 200 μL of Accell medium. The siRNA was added to appropriately labeled wells from the prepared stock solution at a final concentration of 1 μM. The plates were incubated at 37 °C with 5% CO2 for 72 hours, washed at the end with FACS buffer (PBS containing 2% fetal bovine serum and 10 mM EDTA), and further incubated on ice with FACS buffer containing a live-dead marker (Thermofisher) for 20 minutes. The cells were washed again in FACS buffer and acquired using a flow cytometer (BD Fortessa), and GFP fluorescence was analyzed using the program FlowJo (TreeStar) and the inhibition of coronin 1 promoter activity was evaluated as a measure of GFP reduction ( Figure 14A ).
[0959] Knockout of the BRD3 gene in our RBL cells using the CRISPR / Cas9 method :
[0960] At VectorBuilder (Neu-Isenburg, Germany), as gRNA#1 (TGGGATGCCAAGCCTTCCCG) (SEQ ID NO.: 11) and gRNA#6771 (AGGGCTTCGCTGCCGATATC) (SEQ ID NO.: 12), followed by protospacer adjacent motifs (PAMs) from Streptococcus pyogenes targeting exon 2 and exon 7 respectively, were used to generate plasmids containing two gRNAs targeting the rat Brd3 gene for generating brd3 knockout in RBL cells. According to the manufacturer's guidelines, using the Neon TM transfection system (Invitrogen), RBL cells (2.5×10 TM ) were transfected with 0.5 μg of plasmid by electroporation at 1200 V, 20 ms, and 2 pulses in a 10 μL Neon 5 transfection system pipette.
[0961] Transfected puromycin-resistant cells were selected and single-cell clones were amplified in a 96-well tissue culture plate, and BRD3 and coronin 1 expression were screened by flow cytometric analysis of the median fluorescence intensity (MFI) of cells from intracellular staining ( Figure 14B ).
[0962] Protein expression
[0963] His6-BRD3 BD1 and His6-BRD3 BD2 The plasmids were a gift from Nicola Burgess-Brown (Addgene plasmids #38940 and #38941). Plasmids were extracted from the delivered transformed Mach1 cells according to the ZR Plasmid Miniprep kit protocol (Zymo Research) and used to transform chemically competent Rosetta2(DE3) cells (Novagen). Rosetta2(DE3) colonies were grown on agar plates prepared with lysogeny broth (LB; 10 g tryptone, 5 g yeast extract, 10 g NaCl) supplemented with 50 μg / ml kanamycin and 30 μg / ml chloramphenicol (LB-Kan-Cm) at 37 °C. For protein expression, sufficient LB-Kan-Cm medium was inoculated with 1% transformed cell pre-culture and incubated at 37 °C. Growth cultures were induced with 0.25 mM isopropyl 1-thio-β-D-galactopyranoside (IPTG) at an OD600 of 0.6 - 0.7. The incubation temperature was reduced to 28 °C for overnight expression. Cells were harvested by centrifugation at 8,000 RCF for 10 minutes at 4 °C.
[0964] Protein purification
[0965] Purification was performed entirely at 4 °C. The cell pellet was homogenized in lysis buffer containing immobilized metal affinity chromatography (IMAC) loading buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 10 mM imidazole, 5% glycerol, 0.5 mM TCEP), which was supplemented with 1 mM PMSF, 100 μg / ml lysozyme, 0.1% Triton X-100, and DNase. Mechanical lysis was performed using a microfluidizer device set to 10,000 psi. The lysate was centrifuged at 14,000 RCF for 1 hour to remove cell debris and suspended particles. The clarified supernatant was applied to a 5 mL Ni-NTA column (Cytiva) pre-equilibrated with IMAC loading buffer. Using The pure system (Cytiva) was used to elute the bound protein with a linear gradient of IMAC elution buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 500 mM imidazole, 5% glycerol, 0.5 mM TCEP). The fractions containing the desired protein were pooled and mixed with 40 μg / ml TEV protease. The mixture was dialyzed overnight in a dialysis buffer (50 mM HEPES, pH 7.5, 250 mM NaCl, 5% glycerol, 0.5 mM TCEP) using a SnakeSkin dialysis tube (Thermo Scientific) with a molecular weight cut-off of 3,500 Da. The mixture was loaded onto a gravity flow column packed with 2.5 mL of Ni Sepharose resin (Cytiva) pre-equilibrated with IMAC loading buffer. The cleaved protein was collected from the flow-through and concentrated to a volume of 3 mL or less using an Amicon Ultra-15 centrifugal filter with a molecular weight cut-off of 3,000 Da. The concentrated sample was loaded onto a HiLoad 16 / 600 Superdex 200 pg gel filtration column (Cytiva) pre-equilibrated with SEC buffer (10 mM HEPES, pH 7.5, 200 mM NaCl, 5% glycerol). The fractions containing the desired protein were pooled and stored at -80 °C.
[0966] Protein crystallization
[0967] BRD3 dissolved in SEC buffer BD1 and BRD3 BD2 (see above) was co-crystallized with SOD2E1 using the sitting-drop vapor diffusion method. Three drops of MRC plate sets were prepared using a Gryphon robot (Art Robbins Instruments). In the mother liquor consisting of 0.1 M TRIS, pH 8.5 and 8% w / v PEG 8,000 (Crystal Screen HT C12, Hampton Research), in the presence of compound 13a dissolved in PEG 400 (1:1.5 molar ratio), BRD3 BD1 crystallized at an initial concentration of 11 mg / ml at 20 °C. In the mother liquor consisting of 0.1 M MES / imidazole, pH 6.5, 0.02 M each amino acid, 10% w / v 20,000 and 20% v / v PEGMME 550 (Morpheus HT-96H1, Molecular Dimensions), in the presence of compound 13a dissolved in PEG 400 (1:1.5 molar ratio), BRD3 BD2Crystallize at an initial concentration of 17 mg / ml at 20 °C. After 9.5 days of growth, the crystals were harvested and flash frozen in LN2.
[0968] X-ray data collection and structure determination
[0969] Collect X-ray diffraction data at the Swiss Light Source (SLS; Paul Scherrer Institut, Villigen, Switzerland). Index, integrate, scale, and merge the data using the XDS and CCP4i2 suites. Use pre-existing structures (PDB codes 3S91 and 3S92) as the first search models and solve the BRD3 crystal structure by molecular replacement using Phaser. BD1 and BRD3 BD2 crystal structures. For both crystal structures, further improve the phases and models by using multiple refinement cycles of REFMAC5 and by manual modeling using Coot. Build the model and restraint dictionary for compound 13a with eLBOW. Prepare figures with PyMOL version 2.4.2 ( LLC). Figure 16 )
Claims
1. A compound of formula (I) or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, wherein R1 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, halogen and -O-C1-C6-alkyl; R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl; R3 is selected from -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10 (preferably from 1 to 5, more preferably from 2 to 3, even more preferably 2), -C1-C6-alkylene-cycloalkyl, cycloalkyl, -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and oxygen-containing saturated heterocyclic group, where the cycloalkyl, the cycloalkyl in the -C1-C6-alkylene-cycloalkyl, the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted by one or more C1-C6-alkyl groups.
2. The compound according to claim 1, wherein R1 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more -O-C1-C6-alkyl; R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen; and R3 is selected from -C1-C6-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, -C3-C6-cycloalkyl, -C1-C6-alkylene-(oxygenated saturated heterocyclic group) and oxygenated saturated heterocyclic group, wherein the cycloalkyl, the oxygenated saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygenated saturated heterocyclic group) and the oxygenated saturated heterocyclic group are each optionally substituted with one or more C1-C6-alkyl.
3. The compound according to claim 1 or 2, wherein R1 is phenyl optionally substituted with methoxy.
4. The compound according to any one of claims 1 to 3, wherein R1 is selected from 2-methoxyphenyl and phenyl.
5. The compound according to any one of claims 1 to 4, wherein R2 is phenyl optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen.
6. The compound according to any one of claims 1 to 5, wherein R2 is 3-hydroxyphenyl.
7. The compound according to any one of claims 1 to 6, wherein R3 is selected from -C1-C6-alkylene-(oxygenated saturated heterocyclic group) or oxygenated saturated heterocyclic group, wherein the oxygenated saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygenated saturated heterocyclic group) and the oxygenated saturated heterocyclic group are each optionally substituted with one or more -C1-C6-alkyl.
8. A compound according to any one of claims 1 to 7, wherein R3 is selected from -C1-C6-alkylene-tetrahydro-2-furanyl, -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, tetrahydrofuran-3-yl, tetrahydro-2H-pyran-4-yl, oxepan-4-yl and 8-oxabicyclo[3.2.1]octan-3-yl, wherein the tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl, the tetrahydrofuran-3-yl, tetrahydro-2H-pyran-4-yl, oxepan-4-yl and 8-oxabicyclo[3.2.1]octan-3-yl are each optionally substituted by one or more -C1-C6-alkyl groups, preferably selected from -C1-C6-alkylene-tetrahydro-2-furanyl, C1-C6-alkylene-tetrahydro-2H-pyran-4-yl and tetrahydro-2H-pyran-4-yl, wherein the tetrahydro-2-furanyl moiety in the -C1-C6-alkylene-tetrahydro-2-furanyl, the tetrahydro-2H-pyran-4-yl moiety in the -C1-C6-alkylene-tetrahydro-2H-pyran-4-yl and the tetrahydro-2H-pyran-4-yl are each optionally substituted by one or more -C1-C6-alkyl groups.
9. A compound according to any one of claims 1 to 7, wherein R3 is selected from (tetrahydrofuran-2-yl)methyl, tetrahydrofuran-3-yl and tetrahydro-2H-pyran-4-yl, preferably wherein R3 is tetrahydro-2H-pyran-4-yl.
10. The compound according to claim 1, which is selected from the group consisting of: tetrahydro-2-furanylmethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (1); methyl 4-(4-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (2); 2-(ethylthio)ethyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (3); methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (4); methyl 4-(3-hydroxyphenyl)-2-methyl-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (5); tetrahydro-2-furanylmethyl 2-methyl-4-(3-nitrophenyl)-5-oxo-7-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (6); Tetrahydro-2-furanylmethyl 2-methyl-5-oxo-7-(2-thienyl)-4-(3-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (7); Methyl 4-(3-hydroxyphenyl)-7-(4-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (8); Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-(2-thienyl)-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (9); Tetrahydro-2-furanylmethyl 4-(2-fluorophenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (10); Methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (11); Tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); Tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); Methyl 7-(2-methoxyphenyl)-2-methyl-5-oxo-4-phenyl-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (14); Methyl 7-(2-methoxyphenyl)-4-(3-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (15); Methyl 4-(2-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (16); 4-Methoxybutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (17); (Tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-Tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); Oxetan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (20); tert-Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (21); Methyl 7-(4-chlorophenyl)-4-(3-hydroxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (22); Tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50); 4-Methyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (51); 2,2,6,6-Tetramethyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (52); 8-Oxabicyclo[3.2.1]octan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (53) Oxepan-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (54); Hexahydrofuro[2,3-b]furan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (55); Cyclopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (56); Cyclohexyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (57); Ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (58); Butyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (59); Neopentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (60); 2-Ethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (61); 2,2-dimethylbutyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (62); 4,4-dimethylpentyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (63); 2-(2-ethoxyethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (64); 2-(2-(2-(hexyloxy)ethoxy)ethoxy)ethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (65); tetrahydro-2H-pyran-4-yl 4-(4-fluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (66); and tetrahydro-2H-pyran-4-yl 4-(2,4-difluoro-3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (67).
11. The compound according to claim 1, which is selected from the group consisting of: tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); (tetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (18); (2,2,6,6-tetramethyltetrahydro-2H-pyran-4-yl)methyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (19); tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50); 4-methyltetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (51); 8-oxabicyclo[3.2.1]octan-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (53); and oxepan-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (54).
12. The compound according to claim 1, selected from the group consisting of: tetrahydro-2-furanylmethyl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (12); tetrahydro-2H-pyran-4-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylate (13); and tetrahydrofuran-3-yl 4-(3-hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylate (50).
13. The compound according to any one of claims 1 to 12, wherein the compound of formula (I) has the absolute configuration of its stereocenters as shown in the following formula: wherein R1, R2 and R3 are as defined in any one of claims 1 to 12.
14. The compound according to claim 1, wherein: the compound has the absolute configuration of its stereocenters as shown in the following formula: R1 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl; R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2, -halogen and -O-C1-C6-alkyl; and R3 is -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) or oxygen-containing saturated heterocyclic group, wherein the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted with one or more -C1-C6-alkyl groups.
15. The compound according to claim 1, wherein: the compound has the absolute configuration of its stereocenters as shown in the following formula: R1 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more -O-C1-C6-alkyl groups; R2 is selected from phenyl and thienyl, wherein the phenyl is optionally substituted with one or more optional substituents independently selected from -OH, -NO2 and -halogen; and R3 is -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) or oxygen-containing saturated heterocyclic group, wherein the oxygen-containing saturated heterocyclic group moiety in the -C1-C6-alkylene-(oxygen-containing saturated heterocyclic group) and the oxygen-containing saturated heterocyclic group are each optionally substituted with one or more -C1-C6-alkyl groups.
16. The compound according to claim 1, wherein: the compound has the absolute configuration of its stereocenters as shown in the following formula: R1 is selected from 2-methoxyphenyl and phenyl; R2 is 3-hydroxyphenyl; and R3 is selected from -C1-C8-alkyl, -(C1-C6-alkylene)-S-C1-C6-alkyl, -(C1-C6-alkylene)-O-C1-C6-alkyl, and -(C2-C4-alkylene-O) m -(C1-C6-alkyl), where m is an integer from 1 to 10, preferably from 1 to 5, more preferably from 2 to 3, and even more preferably 2.
17. The compound according to claim 16, wherein the compound is selected from: (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydro-3-quinolinecarboxylic acid methyl ester (11c); (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 4-methoxybutyl ester (17a); (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid tert-butyl ester (21a); and (4S,7R)-4-(3-Hydroxyphenyl)-7-(2-methoxyphenyl)-2-methyl-5-oxo-1,4,5,6,7,8-hexahydroquinoline-3-carboxylic acid 2-(2-ethoxyethoxy)ethyl ester (64a).
18. A pharmaceutical composition, the pharmaceutical composition comprising the compound according to any one of claims 1 to 17 or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, and a pharmaceutically acceptable carrier.
19. The compound according to any one of claims 1 to 17 or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, or the pharmaceutical composition according to claim 18, for use as a medicament.
20. The compound according to any one of claims 1 to 17 or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof, or the pharmaceutical composition according to claim 18, for inducing immunosuppression or for the treatment and / or prevention of diseases or disorders selected from the group consisting of: transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases and lymphoproliferative disorders.
21. The compound for use according to claim 20 or the pharmaceutical composition for use according to claim 20, wherein the autoimmune diseases are selected from the group consisting of: psoriasis, vitiligo, primary sclerosing cholangitis, multiple sclerosis, systemic lupus erythematosus, Hashimoto's thyroiditis, rheumatoid arthritis, myasthenia gravis, type I or type II diabetes, conditions secondary to type I or type II diabetes, vasculitis, pernicious anemia, Sjogren's syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis, allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis and allergic contact dermatitis; wherein the graft rejection reaction is selected from the group consisting of: acute or chronic rejection reactions of cells, tissues, organs, allografts, and xenografts, poor graft function status, graft-versus-host disease; rejection reactions of heart transplantation, skin transplantation, kidney transplantation, liver transplantation, islet transplantation, pancreas transplantation, lung transplantation, intestine transplantation, corneal transplantation, vascular transplantation, adrenal gland transplantation, hair transplantation, bone transplantation, cartilage transplantation, and ligament transplantation; wherein the inflammatory disease is selected from the group consisting of: inflammatory bowel disease, Crohn's disease, ulcerative colitis, endogenous asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, prurigo nodularis, eosinophilic esophagitis, hidradenitis suppurativa, fibrotic disorders, cardiovascular diseases, allergic disorders, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, skin manifestations of immune-mediated disorders, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and adult respiratory distress syndrome; wherein the lymphoproliferative disorder is T-cell lymphoma or T-cell leukemia; wherein the infectious disease is selected from the group consisting of: tuberculosis, preferably tuberculosis caused by mycobacterium, salmonella infection, helicobacter infection, retroviral infection, preferably HIV or HTLV, cytomegalovirus infection, candida infection, staphylococcus infection, lymphocytic choriomeningitis virus infection, and viral hepatitis.
22. The compound for use or the pharmaceutical composition for use according to claim 20 or 21, wherein the disease or disorder is selected from the group consisting of: infectious diseases and lymphoproliferative disorders, preferably wherein the lymphoproliferative disorder is T-cell lymphoma or T-cell leukemia; and preferably wherein the infectious disease is selected from the group consisting of: tuberculosis, preferably tuberculosis caused by mycobacterium, salmonella infection, helicobacter infection, retroviral infection, preferably HIV or HTLV, cytomegalovirus infection, candida infection, staphylococcus infection, lymphocytic choriomeningitis virus infection, and viral hepatitis.
23. The compound for use or the pharmaceutical composition for use according to any one of claims 20 to 22, wherein the compound of formula (I) inhibits coronin 1 expression.
24. A BRD3-selective bromodomain inhibitor for treating or preventing a disease that can benefit from BRD3 inhibition directly or indirectly via modulating coronin 1 promoter activity or via reducing the expression of coronin 1.
25. The BRD3-selective bromodomain inhibitor for use according to claim 24, wherein the disease that can benefit from BRD3 inhibition is suitable for therapeutic intervention by directly inhibiting BRD3 or via modulating coronin 1 promoter activity or via modulating coronin 1 expression by BRD3 inhibition.
26. The BRD3 selective bromodomain inhibitor for use according to claim 24 or 25, wherein the disease that can benefit from BRD3 inhibition is selected from transplant rejection, autoimmune diseases, inflammatory diseases, infectious diseases, and lymphoproliferative disorders.
27. The BRD3 selective bromodomain inhibitor for use according to claim 26, wherein the transplant rejection is selected from the group consisting of acute or chronic rejection of cells, tissues, organs, allografts, and xenografts, poor graft function status, graft-versus-host disease; rejection of heart transplantation, skin transplantation, kidney transplantation, liver transplantation, islet transplantation, pancreas transplantation, lung transplantation, intestine transplantation, corneal transplantation, vascular transplantation, adrenal transplantation, hair transplantation, bone transplantation, cartilage transplantation, and ligament transplantation; wherein the autoimmune diseases are selected from the group consisting of psoriasis, vitiligo, primary sclerosing cholangitis, multiple sclerosis, systemic lupus erythematosus, Hashimoto's thyroiditis, rheumatoid arthritis, myasthenia gravis, type I or type II diabetes, conditions secondary to type I or type II diabetes, vasculitis, pernicious anemia, Sjögren's syndrome, uveitis, Graves' ophthalmopathy, alopecia areata, allergic asthma, atopic dermatitis, allergic rhinitis, allergic conjunctivitis, myocarditis, hepatitis, and allergic contact dermatitis; wherein the inflammatory diseases are selected from the group consisting of inflammatory bowel disease, Crohn's disease, ulcerative colitis, endogenous asthma, inflammatory lung injury, inflammatory liver injury, inflammatory glomerular injury, atherosclerosis, osteoarthritis, myositis, polymyositis, prurigo nodularis, eosinophilic esophagitis, hidradenitis suppurativa, fibrotic disorders, cardiovascular diseases, allergic disorders, irritant contact dermatitis, eczematous dermatitis, seborrheic dermatitis, skin manifestations of immune-mediated disorders, inflammatory eye diseases, keratoconjunctivitis, myocardial infarction, stroke, intestinal ischemia, renal failure, hemorrhagic shock, traumatic shock, toxic shock, septic shock, and adult respiratory distress syndrome; wherein the infectious diseases are selected from the group consisting of tuberculosis, preferably tuberculosis caused by mycobacteria, Salmonella infection, Helicobacter infection, retroviral infection, preferably HIV or HTLV, cytomegalovirus infection, Candida infection, Staphylococcus infection, lymphocytic choriomeningitis virus infection, and viral hepatitis; wherein the lymphoproliferative disorder is T-cell lymphoma or T-cell leukemia.
28. The BRD3 selective bromodomain inhibitor for use according to claim 24 or 25, wherein the disease that can benefit from BRD3 inhibition is a BRD3-driven malignancy, such as NMC, OCCC, colorectal cancer, or rhabdomyosarcoma, or their metastases.
29. The BRD3 selective bromodomain inhibitor for use according to any one of claims 24 to 28, wherein the BRD3 selective bromodomain inhibitor is a compound according to any one of claims 1 to 16 or a pharmaceutically acceptable salt, stereoisomer, diastereoisomer, enantiomer, polymorph, racemic mixture, solvate or isomer and mixture thereof.
30. A vector comprising a coronin 1 (coro1a) promoter element, wherein in the vertebrate genome, the coronin 1 promoter element starts directly upstream of the transcription start site (TSS) of the coronin 1 gene and spans a sequence segment of at least about 700 bp in the genome.
31. The vector according to claim 30, further comprising a coronin 1 promoter reporter gene, wherein the coronin 1 promoter element is operably linked to the coronin 1 promoter reporter gene.
32. The vector according to claim 30 or 31, wherein the coronin 1 promoter element spans a sequence of at least about 700 bp to about 1500 bp in the genome, preferably the coronin 1 promoter element spans a sequence segment of at least about 700 bp in the genome.
33. The vector according to any one of claims 30 to 32, wherein the coronin 1 promoter element has at least 40%, preferably at least 50%, more preferably at least 60%, still more preferably at least 70%, still more preferably at least 80%, still more preferably at least 90%, still more preferably at least 95%, still more preferably at least 98%, still more preferably at least 99% identity with the sequences of SEQ ID NO: 1-6.
34. A cell comprising the vector according to any one of claims 30 to 33.
35. A method for identifying a compound that modulates the activity of the coronin 1 promoter, the method comprising the steps of: a. providing a host cell comprising the vector according to any one of claims 30 to 33, wherein the host cell is capable of expressing the promoter reporter gene of the vector; b. subjecting the host cell to a compound to be tested; and c. measuring the expression of the coronin 1 promoter reporter gene in the host cell subjected to the compound to be tested.
36. A method for preparing a compound of formula (I) as defined in claim 13, the method comprising step (b) of asymmetric reduction of a pyridine motif by enantioselective partial transfer hydrogenation.
37. The method according to claim 35, comprising step (b) of asymmetric reduction of the pyridine motif in compound XI by enantioselective partial transfer hydrogenation: wherein R1, R2 and R3 in compound XI are as defined for the compound of formula (I) in claim 1.
Citation Information
Patent Citations
Compounds for modulating TRPV3 function
WO2006122156A2
Polyhydroquinoline compounds and dihydropyridine compounds for inhibiting beta-amyloid production
WO2008070875A2
Pharmaceutical compositions to treat fibrosis
WO2011127164A2
Vitamin d receptor agonists and uses thereof
WO2013009799A1