Antibodies and uses thereof

Abstract

Antibodies, nucleic acids encoding the same, vectors comprising the nucleic acids, host cells, kits, methods of making hot start chimeric DNA polymerases or variants thereof, hot start chimeric DNA polymerases or variants thereof, and methods of amplification are provided. The antibody can specifically neutralize chimeric DNA polymerase or a variant thereof, and the hot start chimeric DNA polymerase prepared by using the antibody has excellent performance in conventional PCR amplification and normal temperature PCR amplification systems.

Description

Antibodies and their applications Technical Field

[0001] The present invention relates to the field of bioengineering, and specifically to antibodies, nucleic acids encoding the same, vectors containing the nucleic acids, host cells expressing or secreting the antibodies, kits containing the foregoing, methods for preparing hot-start chimeric DNA polymerases or variants thereof, hot-start chimeric DNA polymerases or variants thereof, and amplification methods. Background Art

[0002] In the actual application of PCR technology, since the DNA polymerase in the reaction system will also undergo polymerization reaction at room temperature, it will lead to non-specific amplification caused by low-stringency primer mismatch. This non-specific amplification will also consume primers and other components in the subsequent PCR reaction process, and lead to the production of non-specific bands including primer dimers and the reduction of the target DNA band yield, and even the problem of failing to amplify the target product.

[0003] Currently, the above technical problems are usually solved through hot-start PCR technology. During hot-start PCR, before high-temperature heating, anti-polymerase antibodies and polymerase are incubated to form a complex, namely hot-start DNA polymerase (antibody hot-start enzyme), which inhibits the polymerization activity of the polymerase, thereby suppressing the nonspecific amplification of the polymerase caused by nonspecific annealing of primers or primer dimers under low temperature conditions or during the heating stage before pre-denaturation. After high-temperature heating, the anti-polymerase antibodies are inactivated and the polymerase activity is restored, thus achieving the desired amplification effect. However, the amplification specificity of current hot-start DNA polymerases in hot-start PCR needs to be further improved.

[0004] Summary of the Invention

[0005] The present invention aims to solve one of the technical problems in the related art at least to a certain extent.

[0006] To this end, embodiments of the present invention provide antibodies, nucleic acids encoding the antibodies, vectors comprising the nucleic acids, host cells that express or secrete the antibodies, kits comprising the antibodies, nucleic acids, vectors, or host cells, methods for preparing hot-start chimeric DNA polymerases or variants thereof, hot-start chimeric DNA polymerases or variants thereof, and amplification methods. The antibodies are capable of specifically neutralizing the polymerization activity of the chimeric DNA polymerases or variants thereof.

[0007] In a first aspect, embodiments of the present invention provide an isolated antibody that specifically neutralizes the polymerization activity of a chimeric DNA polymerase or a variant thereof, the antibody comprising:

[0008] A heavy chain complementary determining region 1 (CDR1) having the amino acid sequence of SEQ ID NO: 1, a heavy chain complementary determining region 2 (CDR2) having the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 7, a heavy chain complementary determining region 3 (CDR3) having the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 8, a light chain complementary determining region 1 (CDR1) having the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 9, a light chain complementary determining region 2 (CDR2) having the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 10, and a light chain complementary determining region 3 (CDR3) having the amino acid sequence of SEQ ID NO: 6 or SEQ ID NO: 11.

[0009] In some embodiments, the isolated antibody specifically neutralizes the polymerization activity of a chimeric DNA polymerase or a variant thereof, and the antibody comprises:

[0010] The heavy chain complementary determining region 1 (CDR1) of the amino acid sequence set forth in SEQ ID NO:1, the heavy chain complementary determining region 2 (CDR2) of the amino acid sequence set forth in SEQ ID NO:2, and the heavy chain complementary determining region 3 (CDR3) of the amino acid sequence set forth in SEQ ID NO:3, and the light chain complementary determining region 1 (CDR1) of the amino acid sequence set forth in SEQ ID NO:4, the light chain complementary determining region 2 (CDR2) of the amino acid sequence set forth in SEQ ID NO:5, and the light chain complementary determining region 3 (CDR3) of the amino acid sequence set forth in SEQ ID NO:6;

[0011] or

[0012] The heavy chain complementary determining region 1 (CDR1) of the amino acid sequence shown in SEQ ID NO:1, the heavy chain complementary determining region 2 (CDR2) of the amino acid sequence shown in SEQ ID NO:7, and the heavy chain complementary determining region 3 (CDR3) of the amino acid sequence shown in SEQ ID NO:8, and the light chain complementary determining region 1 (CDR1) of the amino acid sequence shown in SEQ ID NO:9, the light chain complementary determining region 2 (CDR2) of the amino acid sequence shown in SEQ ID NO:10, and the light chain complementary determining region 3 (CDR3) of the amino acid sequence shown in SEQ ID NO:11.

[0013] In some embodiments, the chimeric DNA polymerase or variant thereof is derived from a B-family DNA polymerase.

[0014] In some embodiments, the chimeric DNA polymerase comprises the amino acid sequence shown in SEQ ID NO:12.

[0015] In some embodiments, the chimeric DNA polymerase variant comprises the amino acid sequence shown in SEQ ID NO:13.

[0016] In some embodiments, the antibody comprises a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 14 or SEQ ID NO: 16 and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 15 or SEQ ID NO: 17.

[0017] In some embodiments, the antibody comprises a heavy chain variable region of the amino acid sequence shown in SEQ ID NO: 14 and a light chain variable region of the amino acid sequence shown in SEQ ID NO: 15; or the antibody comprises a heavy chain variable region of the amino acid sequence shown in SEQ ID NO: 16 and a light chain variable region of the amino acid sequence shown in SEQ ID NO: 17.

[0018] In some embodiments, the antibody is 11F2F12, 30E5H7, 30E5H9, 12H2H6, 12H2G5, 12H2G1.

[0019] In some embodiments, the antibody is 11F2F12C2, 12H2G1D1.

[0020] In some embodiments, the antibody is a full-length antibody or an antigen-binding fragment thereof.

[0021] In a second aspect, embodiments of the present invention provide nucleic acids encoding the antibodies described in any embodiment of the first aspect.

[0022] In some embodiments, the nucleic acid encoding the heavy chain variable region of the amino acid sequence shown in SEQ ID NO:14 has the nucleotide sequence shown in SEQ ID NO:18; the nucleic acid encoding the light chain variable region of the amino acid sequence shown in SEQ ID NO:15 has the nucleotide sequence shown in SEQ ID NO:19.

[0023] In some embodiments, the nucleic acid encoding the heavy chain variable region of the amino acid sequence shown in SEQ ID NO:16 has the nucleotide sequence shown in SEQ ID NO:20; the nucleic acid encoding the light chain variable region of the amino acid sequence shown in SEQ ID NO:17 has the nucleotide sequence shown in SEQ ID NO:21.

[0024] In a third aspect, embodiments of the present invention provide a vector comprising the nucleic acid described in any embodiment of the second aspect.

[0025] In some embodiments, the vector is an expression vector.

[0026] In a fourth aspect, embodiments of the present invention provide host cells that express or secrete the antibody described in any embodiment of the first aspect.

[0027] In some embodiments, the host cell is cultured under appropriate conditions that allow for antibody expression, and the antibody of any embodiment of the first aspect can be harvested from the cell culture (eg, from the culture medium).

[0028] In a fifth aspect, an embodiment of the present invention provides a kit comprising the antibody described in any embodiment of the first aspect, the nucleic acid described in any embodiment of the second aspect, the vector described in any embodiment of the third aspect, or the host cell described in any embodiment of the fourth aspect.

[0029] In a sixth aspect, embodiments of the present invention provide a method for preparing a hot-start chimeric DNA polymerase or a variant thereof, comprising using the antibody described in any embodiment of the first aspect.

[0030] In some embodiments, the antibody and the chimeric DNA polymerase or variant thereof are used in a mass ratio of 0.75:1 to 10:1, preferably 1:1 to 8:1, more preferably 2:1 to 6:1, for example 4:1 to prepare the hot-start chimeric DNA polymerase or variant thereof.

[0031] In some embodiments, the antibody and chimeric DNA polymerase or variant thereof are prepared at a temperature of 20 to 40°C, such as 25 to 37°C, such as 30°C.

[0032] In a seventh aspect, an embodiment of the present invention provides a hot-start chimeric DNA polymerase or a variant thereof, obtained by the method described in any embodiment of the sixth aspect.

[0033] In an eighth aspect, an embodiment of the present invention provides an amplification method, comprising using the hot-start chimeric DNA polymerase or a variant thereof obtained by the method described in any embodiment of the sixth aspect or described in any embodiment of the seventh aspect.

[0034] In some embodiments, the hot-start chimeric DNA polymerase or variants thereof are used for PCR amplification or NGS library amplification.

[0035] In some embodiments, the PCR amplification reaction system and the NGS library amplification reaction system are prepared at 4°C-25°C, for example, 4°C or 20-25°C.

[0036] The antibodies provided in the embodiments of the present invention have a neutralizing activity of greater than 98% against chimeric DNA polymerase or its variants, and can effectively inhibit nonspecific amplification at low temperatures or during the heating stage before pre-denaturation.

[0037] The hot-start chimeric DNA polymerase prepared from antibodies provided in the embodiments of the present invention produces significantly fewer non-specific amplification products than similar commercial polymerases when the reaction system is prepared at a temperature of 4° C.-25° C. for amplification.

[0038] The annealing temperature range of the hot-start chimeric DNA polymerase prepared by the antibody provided in the embodiment of the present invention for PCR amplification is better than that of the same type of commercial polymerase, and the applicable temperature range is wide, which facilitates the user to adjust the temperature according to actual conditions.

[0039] The antibodies provided in the embodiments of the present invention can not only inhibit the polymerization activity of the chimeric DNA polymerase or its variants independently developed by the inventors in the early stage, so as to be further applied to conventional PCR amplification, site-directed mutagenesis and NGS library construction, but can also be used to inhibit the polymerization activity of the same type of DNA polymerase currently available on the market. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the technical solutions of the embodiments of the present disclosure, the following briefly introduces the drawings required for use in the embodiments or descriptions of the prior art. Obviously, the drawings described below are only some embodiments of the present disclosure, and a person skilled in the art can also obtain other drawings based on these drawings.

[0041] Figure 1 is a schematic diagram of the principle of detecting antibody neutralizing activity using the fluorescent probe method.

[0042] Figure 2 is a schematic diagram of the principle of detecting antibody neutralizing activity using the M13-7p method.

[0043] FIG3 is a schematic diagram showing the results of detecting the neutralizing activity of serum containing antibodies according to an embodiment of the present invention using the M13-7p method.

[0044] FIG4 is a schematic flow chart of a method for preparing an antibody according to an embodiment of the present invention.

[0045] FIG5 is a schematic diagram showing the results of detecting the neutralizing activity of an antibody according to an embodiment of the present invention using a fluorescent probe method.

[0046] FIG6 is a schematic diagram showing the amplification results of the light chain sequence and the heavy chain sequence of an antibody according to an embodiment of the present invention.

[0047] FIG7 is a schematic diagram of antibody SDS-PAGE analysis according to an embodiment of the present invention.

[0048] FIG8 is a schematic diagram showing the amplification effect of hot-start chimeric DNA polymerases prepared with different mass ratios of antibodies and enzymes according to an embodiment of the present invention.

[0049] FIG9 is a schematic diagram showing the results of an accelerated stability test of a hot-start chimeric DNA polymerase for antibody preparation according to an embodiment of the present invention.

[0050] FIG10 is a schematic diagram showing the amplification effect of a hot-start chimeric DNA polymerase prepared using an antibody according to an embodiment of the present invention under conventional preparation conditions on ice.

[0051] FIG11 is a schematic diagram showing the amplification effect of a hot-start chimeric DNA polymerase prepared using an antibody according to an embodiment of the present invention under room temperature conditions.

[0052] FIG12 is a statistical diagram of NGS library construction data of a hot-start chimeric DNA polymerase prepared using antibodies according to an embodiment of the present invention and a commercial polymerase. DETAILED DESCRIPTION

[0053] The embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to be used to explain the present invention, but should not be understood as limiting the present invention.

[0054] Antibodies are immunoglobulin molecules that can specifically bind to targets, such as carbohydrates, polynucleotides, lipids, polypeptides, etc., through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. As used herein, the term "antibody" encompasses not only complete (e.g., full-length) polyclonal or monoclonal antibodies, but also includes antigen-binding fragments thereof (e.g., Fab, Fab', F(ab')2, Fv), single chains (scFv), mutants thereof, fusion proteins comprising antibody portions, humanized antibodies, chimeric antibodies, diabodies, nanobodies, linear antibodies, single-chain antibodies, multispecific antibodies (e.g., bispecific antibodies), and any other modified configuration of immunoglobulin molecules comprising antigen recognition sites of desired specificity, including glycosylation variants of antibodies, amino acid sequence variants of antibodies, and covalently modified antibodies. Antibodies include antibodies of any class, such as IgD, IgE, IgG, IgA, IgM, or its subclass, and the antibody does not have to be of any particular class. Immunoglobulins can be divided into different classes based on the antibody amino acid sequence of their heavy chain constant domains. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, many of which can be further divided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy chain constant domains corresponding to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of the different classes of immunoglobulins are well known.

[0055] A typical antibody molecule comprises a heavy chain variable region (VH) and a light chain variable region (VL), which are generally involved in antigen binding, as well as a heavy chain constant region (CH) and a light chain constant region (CL). The VH and VL regions can be further subdivided into hypervariable regions, also called "complementarity determining regions" ("CDRs"), and interspersed with more conserved regions called "framework regions" ("FRs"). Each VH and VL is typically composed of three CDRs and four FRs, which are arranged from amino terminus to carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The extent of the framework regions and CDRs can be precisely identified using methods known in the art, for example, by the Kabat definition, the Chothia definition, the AbM definition, and / or the contact definition, all of which are well known in the art. See, e.g., Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, 5th ed., US Department of Health and Human Services, NIH Publication No. 91-3242, Chothia et al. (1989) Nature 342:877; Chothia, C. et al. (1987) J. Mol. Biol. 196:901-917, Al-lazikani et al. (1997) J. Molec. Biol. 273:927-948; and Almagro, J. Mol. Recognit. 17:132-143 (2004). See also hgmp.mrc.ac.uk and bioinf.org.uk / abs).

[0056] The antibodies described herein may be full-length antibodies comprising two heavy chains and two light chains, each of which comprises a variable domain and a constant domain. Alternatively, the antibodies described herein may be antigen-binding fragments of full-length antibodies. Examples of binding fragments encompassed by the term "antigen-binding fragment" of a full-length antibody include: (i) a Fab fragment, a monovalent fragment consisting of a VL, VH, CL, and CH1 domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments connected by a disulfide bridge in the hinge region; (iii) an Fd fragment consisting of a VH and CH1 domain; (iv) an Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature 341:544-546), consisting of a VH domain; and (vi) isolated complementary determining regions (CDRs) that retain function. In addition, although the two domains VL and VH of the Fv fragment are encoded by different genes, they can be connected by synthetic linkers using recombinant methods to form a single protein chain in which the VL and VH regions pair to form a monovalent molecule known as single-chain Fv (scFv). See, for example, Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883.

[0057] Antibodies capable of binding to chimeric DNA polymerases or variants thereof (preferably B family chimeric DNA polymerases or variants thereof) as described herein can be prepared by any method known in the art. See, for example, Harlow and Lane, (1998) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York.

[0058] In certain embodiments, antibodies specific to a target antigen (e.g., a B family chimeric DNA polymerase or a variant thereof) are prepared by conventional hybridoma technology. Full-length target antigens or fragments thereof, optionally connected to a carrier protein (e.g., KLH), can be used to immunize host animals to produce antibodies that bind to the antigen. The immunization route and schedule of the host animal are generally consistent with the mature and conventional techniques used for antibody stimulation and production. General techniques for producing antibodies are known in the art and are described herein. It is contemplated that any mammalian subject (including mice) or cells producing antibodies therefrom can be manipulated as the basis for producing mammalian (including mouse) hybridoma cell lines. Typically, a host animal is inoculated intraperitoneally, intramuscularly, orally, subcutaneously, intraplantarly, and / or intradermally with a certain amount of an immunogen (including a B family chimeric DNA polymerase or a variant thereof as described herein).

[0059] Hybridomas can be prepared from lymphocytes and fixed myeloma cells using Kohler, B. and Milstein, C. (1975) Nature 256: 495-497 or Buck, DW et al., modified In Vitro, 18: 377-381 (1982) conventional somatic cell hybridization techniques. Available myeloma cell lines (including but not limited to X63-Ag8.653 and those from Salk Institute, Cell Distribution Center, San Diego, Calif., USA) can be used for hybridization. Typically, the technology involves the use of a fusogen (e.g., polyethylene glycol) or by electrical means well known to those skilled in the art to fuse myeloma cells and lymphoid cells. After fusion, the cells are separated from the fusion medium and grown in a selective growth medium (e.g., hypoxanthine-aminopterin-thymidine (HAT) medium) to eliminate unhybridized parental cells. Any culture medium supplemented or not supplemented with serum as described herein can be used to culture hybridomas secreting monoclonal antibodies. As another alternative to cell fusion technology, EBV immortalized B cells can be used to produce the monoclonal antibodies described herein.If necessary, the hybridomas are expanded and subcloned, and the anti-immunogen activity of the supernatant is determined by conventional immunoassay methods (e.g., radioimmunoassay, enzyme immunoassay or fluorescent immunoassay).

[0060] Hybridoma cells that can be used as antibody sources include all derivatives and progeny cells of parent hybridoma cells that produce monoclonal antibodies that can interfere with DNA polymerase polymerization activity. Hybridoma cells that produce such antibodies can be grown in vitro or in vivo using known methods. If necessary, monoclonal antibodies can be isolated from culture medium or body fluids by conventional immunoglobulin purification procedures, such as ammonium sulfate precipitation, gel electrophoresis, dialysis, chromatography and ultrafiltration. Undesirable active substances (if any) can be removed, for example, by running preparation on an adsorbent made from an immunogen attached to a solid phase and eluting or releasing the desired antibody from the immunogen. A population of antibodies (e.g., monoclonal antibodies) can be generated by immunizing a host animal with a target antigen or a fragment containing a target amino acid sequence conjugated to a protein that is immunogenic in the species to be immunized (e.g., keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor) using a bifunctional or derivatizing agent such as maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine ​​residues), N-hydroxysuccinimide (through lysine residues), glutaraldehyde, succinic anhydride, SOCl, or R1N═C═NR, wherein R and R1 are different alkyl groups.

[0061] If desired, the antibody (monoclonal or polyclonal) of interest (e.g., produced by a hybridoma) can be sequenced and the polynucleotide sequence can then be cloned into a vector for expression or propagation. The sequence encoding the antibody of interest can be maintained in a vector in a host cell, which can then be expanded and frozen for future use. It will be apparent to those skilled in the art that one or more polynucleotide changes can be made to an antibody and still retain its binding specificity to the target antigen.

[0062] In an alternative embodiment, antibodies that can be combined with target antigens as described herein are separated from suitable antibody libraries.Antibody libraries comprising multiple antibody components can be used to identify antibodies that are combined with specific target antigens (for example, in this case, B family chimeric polymerases or their variants) according to conventional selection processes known in the art. In the selection process, the antibody library can be probed with the target antigen or its fragment, and the library members that can be combined with the target antigen can be separated, usually by being retained on a carrier. Multiple rounds of such screening processes (for example, including positive and negative selections) can be carried out to enrich the antibody library that can be combined with the target antigen. Each clone of the enrichment library can then be separated, and further characterized to identify clones with desired binding activity and biological activity. The sequence of heavy chain variable domains and light chain variable domains can also be determined by conventional methods. There are many conventional methods known in the art that can identify and separate antibodies that can be combined with target antigens as described herein, including phage display, yeast display, ribosome display or mammalian display technology.

[0063] ELISA can be used to assess the binding protein. For example, each protein is contacted with a microtiter plate coated with a target (such as a limited amount of target) on the bottom surface. The plate is washed with a buffer solution to remove non-specifically bound polypeptides. Then, the amount of the binding protein bound to the target on the plate is determined by detecting the plate with an antibody that can recognize the binding protein (such as a tag or constant portion of the binding protein). The antibody is connected to a detection system (for example, an enzyme that produces a colorimetric product when a suitable substrate is provided, such as alkaline phosphatase or horseradish peroxidase (HRP)). OD450 is a specific parameter for evaluating serum affinity for antigens using the Elisa method, and refers to the light absorption value measured at 450 wavelengths after the sample group reacts with the Elisa. Because the assay system itself has a certain base number (i.e., the assay system itself has a certain light absorption, which is blank), the index for the final evaluation is OD 450 -OD 空白 When (OD 450 -OD 空白 ) is higher, indicating that there are more specific affinity antibodies in the serum.

[0064] In some examples, antibodies that neutralize the polymerization activity of DNA polymerase are produced by recombinant techniques as exemplified below.

[0065] The nucleic acid of the heavy chain and light chain of the antibody as herein described can be cloned into an expression vector, and each nucleotide sequence is operably connected with a suitable promoter. In an example, each nucleotide sequence encoding heavy chain and light chain is operably connected with different promoters. Alternatively, the nucleotide sequence encoding heavy chain and light chain can be operably connected with a single promoter so that both heavy chain and light chain are expressed by the same promoter. If necessary, an internal ribosome entry site (IRES) can be inserted between the heavy chain and light chain encoding sequence.

[0066] In some examples, the nucleotide sequences encoding the two chains of an antibody are cloned into two vectors, which can be introduced into the same or different cells. When the two chains are expressed in different cells, they can each be isolated from the host cell expressing them, and the isolated heavy and light chains can be mixed and incubated under appropriate conditions to form the antibody.

[0067] Typically, methods known in the art can be used to clone the nucleic acid sequence of one or all chains of the antibody encoding the antibody into a suitable expression vector and operably connected to a suitable promoter. For example, the nucleotide sequence and the carrier can be contacted with a restriction enzyme under suitable conditions to produce complementary ends that can pair with each other on each molecule and to link together with a ligase. Alternatively, a synthetic nucleic acid linker can be connected to the end of the gene. These synthetic linkers contain the nucleic acid sequence corresponding to a specific restriction site in the carrier. The selection of expression vector / promoter will depend on the type of host cell used to produce the antibody.

[0068] A variety of promoters can be used to express the antibodies described herein, including but not limited to the cytomegalovirus (CMV) immediate early promoter, viral LTRs such as Rous sarcoma virus LTR, HIV-LTR, HTLV-1 LTR, simian virus 40 (SV40) early promoter, Escherichia coli lac UV5 promoter, and herpes simplex tk virus promoter.

[0069] The regulatable promoter including the operon repressor can be used. In one embodiment, the lac repressor from Escherichia coli can serve as a transcriptional regulator to regulate transcription from mammalian cell promoters with the lac operon (M. Brown et al., Cell, 49: 603-612 (1987); Gossen and Bujard (1992); M. Gossen et al., Natl. Acad. Sci. USA, 89: 5547-5551 (1992)), tetracycline repressor (tetR) is combined with transcription activator (VP 16) to form tetR mammalian cell transcription activator fusion protein tTa (tetR-VP 16), with a minimal promoter with tetO derived from the major immediate early promoter of human cytomegalovirus (hCMV), to produce tetR-tet operon system to control gene expression in mammalian cells. In one embodiment, a tetracycline inducible switch is used. When the tetracycline operator is correctly located downstream of the TATA element of the CMVIE promoter, a separate tetracycline repressor (tetR) rather than a tetR-mammalian cell transcription factor fusion derivative can act as an effective transregulator to regulate gene expression in mammalian cells (Yao et al., Human Gene Therapy, 10(16):1392-1399(2003)). A special advantage of this tetracycline-inducible switch is that the regulatable effect does not require the use of a tetracycline repressor-mammalian cell transactivator or repressor fusion protein, which in some cases may be toxic to cells (Gossen et al., Natl. Acad. Sci. USA, 89:5547-5551(1992); Shockett et al., Proc. Natl. Acad. Sci. USA, 92:6522-6526(1995)).

[0070] In addition, the vector may comprise, for example, some or all of the following: a selective marker gene, such as a neomycin gene for selection of stable or transient transfectants in mammalian cells; an enhancer / promoter sequence from the immediate early gene of human CMV for high-level transcription; transcription termination and RNA processing signals from SV40 for mRNA stabilization; an origin of replication and ColE1 of the SV40 polyomavirus for proper episomal replication; an internal ribosome binding site (IRES), a versatile multiple cloning site; and T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA. Suitable vectors and methods for generating vectors comprising transgenes are well known in the art and are available.

[0071] Examples of polyadenylation signals that can be used to practice the methods described herein include, but are not limited to, the human collagen I polyadenylation signal, the human collagen II polyadenylation signal, and the SV40 polyadenylation signal.

[0072] One or more vectors (e.g., expression vectors) comprising nucleic acids encoding any antibody can be introduced into suitable host cells to produce the antibody. Host cells can be cultured under suitable conditions to express the antibody or any of its polypeptide chains. Such antibodies or their polypeptide chains can be recovered (e.g., recovered from cells or culture supernatants) by conventional methods such as affinity purification from cultured cells. If desired, the polypeptide chains of the antibody can be incubated under suitable conditions for a suitable period of time to produce the antibody.

[0073] In some embodiments, the method for preparing the antibodies described herein relates to recombinant expression vectors encoding both the heavy and light chains of antibodies against DNA polymerase or variants thereof as described herein. The recombinant expression vector can be introduced into suitable host cells (e.g., dhfr-CHO cells) by conventional methods (e.g., calcium phosphate-mediated transfection). Positively transformed host cells can be selected and cultured under suitable conditions to express the two polypeptide chains that form the antibody, which can be recovered from the cells or culture medium. If necessary, the two chains recovered from the host cells can be incubated under suitable conditions to form the antibody.

[0074] In one example, two recombinant expression vectors are provided, one encoding the heavy chain of an antibody against chimeric DNA polymerase or its variant, and the other encoding the light chain of an antibody against chimeric DNA polymerase or its variant. Both of the two recombinant expression vectors can be introduced into suitable host cells (e.g., dhfr-CHO cells) by conventional methods (e.g., calcium phosphate-mediated transfection). Alternatively, each expression vector can be introduced into suitable host cells. Positive transformants can be selected and cultivated under suitable conditions to allow the polypeptide chain expression of the antibody. When two expression vectors are introduced into the same host cell, the antibody produced therein can be recovered from the host cell or from the culture medium. If desired, polypeptide chains can be recovered from the host cell or from the culture medium, and then hatched under suitable conditions to form the antibody. When two expression vectors are introduced into different host cells, they can each be recovered from the corresponding host cell or from the corresponding culture medium. Then two polypeptide chains can be hatched under suitable conditions to form the antibody.

[0075] Standard molecular biology techniques are used to prepare the recombinant expression vector, transfect the host cells, select the transformants, culture the host cells and recover the antibody from the culture medium. For example, some antibodies can be isolated by affinity chromatography using a matrix coupled to protein A or protein G.

[0076] Any nucleic acid encoding the heavy chain, light chain, or both of an antibody against a chimeric DNA polymerase or variant thereof as described herein, a vector (eg, an expression vector) containing the nucleic acid, and a host cell comprising the vector are within the scope of the present disclosure.

[0077] The antibodies against the chimeric DNA polymerase or its variants thus prepared can be characterized using methods known in the art to detect and / or measure the reduction, improvement or neutralization of the activity of the chimeric DNA polymerase or its variants, for example, affinity activity and neutralization activity.

[0078] In embodiments of the present invention, the term "affinity activity" refers to the ability of an antibody to bind to a chimeric DNA polymerase or variant thereof. In some specific embodiments, affinity activity refers to the titer of serum or subcloned cells containing the corresponding antibody against the chimeric DNA polymerase or variant thereof as an antigen as determined by ELISA.

[0079] In the examples of the present invention, the term "neutralizing activity" refers to the ability of an antibody to inhibit the polymerization activity of a target chimeric DNA polymerase or variant thereof after binding to the target chimeric DNA polymerase. While antibodies with neutralizing activity must be able to bind to the target antibody, binding alone does not necessarily guarantee neutralizing activity. Therefore, after affinity screening, verification of the neutralizing activity of the antibody is still necessary.

[0080] In some embodiments, the chimeric DNA polymerase or its variant is derived from a B-family DNA polymerase. B-family DNA polymerases, including phi29, Pfu, and Kod polymerases, are widely used in next-generation sequencing and typically exhibit high processivity and strand displacement activity. Chimeric DNA polymerases are engineered from these wild-type DNA polymerases to enhance their performance.

[0081] It should be noted that members of the B family DNA polymerase have high sequence homology and highly conserved spatial structure. Therefore, those skilled in the art can expect that the antibodies according to the embodiments of the present invention can be widely used to neutralize the polymerization activity of currently commercially available B family DNA polymerases.

[0082] In an embodiment of the present invention, the neutralizing activity of antibodies in serum is detected by a fluorescent probe method (molecular beacon method). The molecular beacon method reflects the degree to which the activity of the target chimeric DNA polymerase or its variant is suppressed by detecting the rate at which the fluorescent signal is generated, and the principle is shown in Figure 1. The molecular beacon method uses a hairpin structure with a fluorescent luminescent group and a fluorescent light-emitting group at both ends as a template for amplification. When there is no antibody with neutralizing activity in the reaction system, the polymerization activity of the target chimeric DNA polymerase or its mutant enables it to extend the primer and then open the hairpin structure, so that the luminescent group and the quenching group are separated, and a fluorescent signal is generated; and when there is an antibody with neutralizing activity in the reaction system, the polymerization activity of the target chimeric DNA polymerase or its mutant is suppressed, and the chimeric DNA polymerase or its variant cannot open the hairpin structure, so it is impossible to separate the luminescent group and the quenching group. Therefore, when a reaction system without antibodies is set as a positive control and a negative control of a reaction system without DNA polymerase or its variants, the rate at which the fluorescent signal is generated in the serum can be detected to determine the level of the neutralizing activity of the antibody. It is understandable that the slower the rate at which the fluorescent signal is generated, the stronger the neutralizing activity of the antibody. This method can be used for preliminary qualitative analysis of the neutralizing activity of antibodies.

[0083] In the embodiments of the present invention, the neutralizing activity of the antibody was further screened by the M13-7P substrate method. The M13-7P substrate method reflects the degree of inhibition of the activity of the target chimeric DNA polymerase or its variant by detecting the yield of double-stranded DNA. The principle of this method is shown in Figure 2. The M13-7P substrate method uses the M13-7p substrate as a template for amplification. The substrate is formed by pre-annealing 7 M13 primers and single-stranded DNA M13 (NEB). When there is no antibody with neutralizing activity in the reaction system, the polymerization activity of the target chimeric DNA polymerase or its variant allows the primer to guide the synthesis of double-stranded DNA (dsDNA); and when there is an antibody with neutralizing activity in the reaction system, the polymerization activity of the target chimeric DNA polymerase or its mutant is inhibited and double-stranded DNA cannot be synthesized. Therefore, by quantitatively detecting the yield of double-stranded DNA in the reaction system through the qubit kit, the level of the neutralizing activity of the antibody can be determined. It is understood that the higher the yield of synthesized double-stranded DNA, the weaker the neutralizing activity of the antibody; conversely, the lower the yield of synthesized double-stranded DNA, the stronger the neutralizing activity of the antibody. This method can be used to further quantitatively analyze the neutralizing activity of the antibody.

[0084] In some embodiments, the hot-start chimeric DNA polymerase prepared using the antibodies of the present invention has excellent stability. In practical applications, considering the ease of use and performance stability of the product, the hot-start chimeric DNA polymerase is generally formulated into a PCR ReadyMix format. The accelerated stability test in the following example shows that the hot-start chimeric DNA polymerase prepared with the antibodies of the present invention and the chimeric DNA polymerase in a 2:1 mass ratio in the PCR ReadyMix format can be stored at -20°C for at least 1 year.

[0085] The following examples detailing the first aspect of the present invention provide isolated antibodies.

[0086] In some embodiments, the isolated antibody specifically neutralizes the polymerization activity of a chimeric DNA polymerase or a variant thereof, the antibody comprising: a heavy chain complementary determining region 1 (CDR1) having the amino acid sequence of SEQ ID NO: 1, a heavy chain complementary determining region 2 (CDR2) having the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 7, a heavy chain complementary determining region 3 (CDR3) having the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 8, a light chain complementary determining region 1 (CDR1) having the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 9, a light chain complementary determining region 2 (CDR2) having the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO: 10, and a light chain complementary determining region 3 (CDR3) having the amino acid sequence of SEQ ID NO: 6 or SEQ ID NO: 11.

[0087] The sequence of the heavy chain complementarity determining region 1 (CDR1) shown in SEQ ID NO: 1 is GFTFSSYA.

[0088] The sequence of the heavy chain complementarity determining region 2 (CDR2) shown in SEQ ID NO: 2 is ITSGGIYT.

[0089] The sequence of the heavy chain complementarity determining region 3 (CDR3) shown in SEQ ID NO: 3 is ARRLGSPWWYFDV.

[0090] The sequence of the light chain complementarity determining region 1 (CDR1) shown in SEQ ID NO: 4 is QSLLNSNNQKNY.

[0091] The sequence of the light chain complementarity determining region 2 (CDR2) shown in SEQ ID NO: 5 is FAS.

[0092] The sequence of the light chain complementarity determining region 6 (CDR3) shown in SEQ ID NO: 6 is QQHYSTPYT.

[0093] The sequence of the heavy chain complementarity determining region 1 (CDR1) shown in SEQ ID NO: 1 is GFTFSSYA.

[0094] The sequence of the heavy chain complementarity determining region 2 (CDR2) shown in SEQ ID NO: 7 is ISSGYST.

[0095] The sequence of the heavy chain complementarity determining region 3 (CDR3) shown in SEQ ID NO: 8 is ARVPLYYGSGWNAMDY.

[0096] The sequence of the light chain complementarity determining region 1 (CDR1) shown in SEQ ID NO: 9 is QNINAW.

[0097] The sequence of the light chain complementary determining region 2 (CDR2) shown in SEQ ID NO: 10 is KAS.

[0098] The sequence of the light chain complementarity determining region 3 (CDR3) shown in SEQ ID NO: 11 is QQGQSYPWT.

[0099] In some embodiments, the isolated antibody specifically neutralizes the polymerization activity of a chimeric DNA polymerase or a variant thereof, the antibody comprising: 6 CDRs comprising, or essentially consisting of, or consisting of the following amino acid sequences: a heavy chain complementary determining region 1 (CDR1) of the amino acid sequence shown in SEQ ID NO: 1, a heavy chain complementary determining region 2 (CDR2) of the amino acid sequence shown in SEQ ID NO: 2, and a heavy chain complementary determining region 3 (CDR3) of the amino acid sequence shown in SEQ ID NO: 3, a light chain complementary determining region 1 (CDR1) of the amino acid sequence shown in SEQ ID NO: 4, a light chain complementary determining region 2 (CDR2) of the amino acid sequence shown in SEQ ID NO: 5, and a light chain complementary determining region 3 (CDR3) of the amino acid sequence shown in SEQ ID NO: 6.

[0100] In some embodiments, the isolated antibody specifically neutralizes the polymerization activity of a chimeric DNA polymerase or a variant thereof, the antibody comprising: 6 CDRs comprising, or consisting essentially of, or consisting of: a heavy chain complementary determining region 1 (CDR1) of the amino acid sequence shown in SEQ ID NO: 1, a heavy chain complementary determining region 2 (CDR2) of the amino acid sequence shown in SEQ ID NO: 7, and a heavy chain complementary determining region 3 (CDR3) of the amino acid sequence shown in SEQ ID NO: 8, and a light chain complementary determining region 1 (CDR1) of the amino acid sequence shown in SEQ ID NO: 9, a light chain complementary determining region 2 (CDR2) of the amino acid sequence shown in SEQ ID NO: 10, and a light chain complementary determining region 3 (CDR3) of the amino acid sequence shown in SEQ ID NO: 11.

[0101] In some embodiments, the antibody comprises a heavy chain complementary determining region 1 (CDR1), a heavy chain complementary determining region 2 (CDR2), and a heavy chain complementary determining region 3 (CDR3), which collectively have at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to the heavy chain CDRs of the antibodies provided herein. In some embodiments, the antibody comprises a light chain complementary determining region 1 (CDR1), a light chain complementary determining region 2 (CDR2), and a light chain complementary determining region 3 (CDR3), which collectively have at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) sequence identity to the light chain CDRs of the antibodies provided herein.

[0102] In some embodiments, the antibody comprises the same heavy chain complementary determining regions (CDR1, CDR2, CDR3) and the same light chain complementary determining regions (CDR1, CDR2, CDR3) as an isolated antibody, e.g., any antibody provided herein. In a specific example, the antibody comprises the same heavy chain variable region (CDR1, CDR2, CDR3) and the same light chain variable region (CDR1, CDR2, CDR3) as an isolated antibody, e.g., any reference antibody provided herein.

[0103] In a specific embodiment, the antibody comprises the same VL CDR1, CDR2, CDR3 and VH CDR1, CDR2, CDR3 as antibody MM001.

[0104] In a specific embodiment, the antibody comprises the same VL CDR1, CDR2, CDR3 and VH CDR1, CDR2, CDR3 as antibody MM002.

[0105] In some embodiments, the chimeric DNA polymerase comprises the amino acid sequence set forth in SEQ ID NO: 12. In some embodiments, the chimeric DNA polymerase consists essentially of the amino acid sequence set forth in SEQ ID NO: 12. In some embodiments, the chimeric DNA polymerase consists of the amino acid sequence set forth in SEQ ID NO: 12.

[0106] In some embodiments, the chimeric DNA polymerase has an amino acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to the amino acid sequence of SEQ ID NO:12.

[0107] In some embodiments, the chimeric DNA polymerase variant comprises the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, the chimeric DNA polymerase consists essentially of the amino acid sequence set forth in SEQ ID NO: 12. In some embodiments, the chimeric DNA polymerase consists of the amino acid sequence set forth in SEQ ID NO: 12.

[0108] In some embodiments, the chimeric DNA polymerase variant has an amino acid sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) identical to the amino acid sequence of SEQ ID NO:13.

[0109] The chimeric DNA polymerase has the sequence set forth in SEQ ID NO: 12

[0110]

[0111] The chimeric DNA polymerase variant has the sequence set forth in SEQ ID NO: 13

[0112]

[0113] In some embodiments, the antibody comprises a heavy chain variable region (VH) sequence comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 14. In some embodiments, the antibody comprises a light chain variable region (VL) sequence comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 15. In some embodiments, the antibody comprises a heavy chain variable region (VH) sequence comprising the amino acid sequence of SEQ ID NO: 14 and a light chain variable region (VL) sequence comprising the amino acid sequence of SEQ ID NO: 15. In some embodiments, the antibody comprises a heavy chain variable region (VH) sequence consisting essentially of the amino acid sequence of SEQ ID NO: 14 and a light chain variable region (VL) sequence consisting essentially of the amino acid sequence of SEQ ID NO: 15. In some embodiments, the antibody comprises a heavy chain variable region (VH) sequence consisting of the amino acid sequence of SEQ ID NO: 14 and a light chain variable region (VL) sequence consisting of the amino acid sequence of SEQ ID NO: 15.

[0114] In some embodiments, the antibody comprises a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 14 or SEQ ID NO: 16 and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 15 or SEQ ID NO: 17.

[0115] In some embodiments, the antibody comprises a heavy chain variable region (VH) sequence comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 16. In some embodiments, the antibody comprises a light chain variable region (VL) sequence comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 17. In some embodiments, the antibody comprises a heavy chain variable region (VH sequence) comprising the amino acid sequence of SEQ ID NO: 16 and a light chain variable region (VL) sequence comprising the amino acid sequence of SEQ ID NO: 17. In some embodiments, the antibody comprises a heavy chain variable region (VH sequence) comprising the amino acid sequence of SEQ ID NO: 16 and a light chain variable region (VL) sequence comprising the amino acid sequence of SEQ ID NO: 17. In some embodiments, the antibody comprises a heavy chain variable region (VH sequence) consisting essentially of the amino acid sequence of SEQ ID NO: 16 and a light chain variable region (VL) sequence consisting essentially of the amino acid sequence of SEQ ID NO: 17. In some embodiments, the antibody comprises a VH sequence consisting of the amino acid sequence of SEQ ID NO: 16 and a VL sequence consisting of the amino acid sequence of SEQ ID NO: 17.

[0116] In some embodiments, any of the antibodies disclosed herein may comprise a heavy chain variable domain (VH) having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity to the VH of an isolated antibody disclosed herein. Alternatively or in addition, the antibody may comprise a light chain variable domain (VL) having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity to the VL of an isolated antibody.

[0117] In some embodiments, the antibody comprises a VH region that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) identical to the VH region of the amino acid sequence set forth in SEQ ID NO: 14. In some embodiments, the antibody comprises a VL region that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) identical to the VL region of the amino acid sequence set forth in SEQ ID NO: 15. In some embodiments, the antibody comprises a VH region that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) identical to the VH region of the amino acid sequence set forth in SEQ ID NO: 14; and a VL region that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) identical to the VL region of the amino acid sequence set forth in SEQ ID NO: 15.

[0118] In some embodiments, the antibody comprises a VH region that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) identical to the VH region of the amino acid sequence set forth in SEQ ID NO: 16. In some embodiments, the antibody comprises a VL region that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) identical to the VL region of the amino acid sequence set forth in SEQ ID NO: 17. In some embodiments, the antibody comprises a VH region that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identical to the VH region of the amino acid sequence set forth in SEQ ID NO: 16; and a VL region that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identical to the VL region of the amino acid sequence set forth in SEQ ID NO: 17.

[0119] The sequence of the heavy chain variable region shown in SEQ ID NO: 14 is

[0120]

[0121] The sequence of the light chain variable region shown in SEQ ID NO: 15 is

[0122]

[0123] The sequence of the heavy chain variable region shown in SEQ ID NO: 16 is

[0124]

[0125] The sequence of the light chain variable region shown in SEQ ID NO: 17 is

[0126]

[0127] In some embodiments, the antibody is 11F2F12, 30E5H7, 30E5H9, 12H2H6, 12H2G5, or 12H2G1.

[0128] In some embodiments, any of the antibodies disclosed herein may comprise an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity to the 11F2F12, 30E5H7, 30E5H9, 12H2H6, 12H2G5, or 12H2G1 antibody.

[0129] In some embodiments, the antibody is 11F2F12C2 or 12H2G1D1. It should be noted that 11F2F12C2 and MM001 can be used interchangeably, and 12H2G1D1 and MM002 can be used interchangeably herein.

[0130] In some embodiments, any of the antibodies disclosed herein may comprise an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) sequence identity to the 11F2F12C2 or 12H2G1D1 antibody.

[0131] In some embodiments, the antibody is a full-length antibody or an antigen-binding fragment thereof. In some instances, the antibody is a Fab or single-chain antibody.

[0132] According to an embodiment of the present invention, the inhibition rate of antibodies 11F2F12, 30E5H7, 30E5H9, 12H2H6, 12H2G5, and 12H2G1 on the polymerization activity of the chimeric polymerase is greater than 90%, and the inhibition rate of antibodies 11F2F12C2 and 12H2G1D1 on the polymerization activity of the chimeric polymerase is greater than 98%.

[0133] Embodiments of the second aspect of the present invention provide isolated nucleic acids (nucleic acid sets), which encode antibodies as described in any embodiment of the first aspect. In some embodiments, the heavy chain and light chain of the antibody are encoded by two independent nucleic acid molecules (nucleic acid sets). In other embodiments, the heavy chain and light chain of the antibody are encoded by one nucleic acid molecule, which can be in a polycistronic form or under the control of different promoters. In some embodiments, the nucleic acid or nucleic acid set is located on one or two vectors. In some instances, one or two vectors can be one or two expression vectors.

[0134] In some embodiments, the nucleic acid encoding the heavy chain variable region of the amino acid sequence set forth in SEQ ID NO: 14 has the nucleotide sequence set forth in SEQ ID NO: 18. In some embodiments, the nucleic acid encoding the light chain variable region of the amino acid sequence set forth in SEQ ID NO: 15 has the nucleotide sequence set forth in SEQ ID NO: 19.

[0135] In some embodiments, the nucleic acid encoding the heavy chain variable region of the amino acid sequence of SEQ ID NO: 16 has the nucleotide sequence of SEQ ID NO: 20. In some embodiments, the nucleic acid encoding the light chain variable region of the amino acid sequence of SEQ ID NO: 17 has the nucleotide sequence of SEQ ID NO: 21.

[0136] In a third aspect, embodiments of the present invention provide vectors comprising a nucleic acid (or nucleic acid set) as described in any embodiment of the second aspect. In some embodiments, the nucleic acid or nucleic acid set is located on one or two vectors. In some embodiments, the vector is an expression vector.

[0137] In a fourth aspect, embodiments of the present invention further provide host cells that express or secrete the antibodies described in the embodiments of the first aspect. In some embodiments, the host cells are cultured under suitable conditions that allow for antibody expression and can harvest the antibodies described in any of the embodiments of the first aspect from cell culture (e.g., from culture medium).

[0138] In one example, DNA encoding a monoclonal antibody specific for a target antigen can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that specifically bind to genes encoding the heavy and light chains of the monoclonal antibody). After isolation, the DNA can be placed into one or more expression vectors, which are then transfected into host cells, such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells (which otherwise would not produce immunoglobulin protein), to obtain synthesis of the monoclonal antibody in the recombinant host cells.

[0139] In a fifth aspect, embodiments of the present invention provide a kit comprising the antibody as described in any embodiment of the first aspect, the nucleic acid as described in any embodiment of the second aspect, and the vector as described in any embodiment of the third aspect. In some embodiments, the kit may further comprise the host cell as described in any embodiment of the fourth aspect.

[0140] In a sixth aspect, embodiments of the present invention provide a method for preparing a hot-start chimeric DNA polymerase or a variant thereof, comprising using the antibody as described in any embodiment of the first aspect.

[0141] In some embodiments, the hot-start chimeric DNA polymerase or variant thereof is prepared by using an antibody and a chimeric DNA polymerase or variant thereof in a mass ratio of 0.75:1 to 10:1, preferably 1:1 to 8:1, more preferably 2:1 to 6:1, for example 4:1.

[0142] In some specific embodiments, the antibodies of the present invention are incubated with a chimeric DNA polymerase or a variant thereof at a mass ratio of 2:1 at 37°C for 15 minutes to obtain a hot-start chimeric DNA polymerase or a variant thereof. In some specific examples, the hot-start chimeric DNA polymerase or a variant thereof can be formulated into a PCR ReadyMix (2×) format.

[0143] In some embodiments, the antibody and the chimeric DNA polymerase or variant thereof are prepared at a temperature of 20 to 40°C, such as 25 to 37°C, such as 30°C.

[0144] In a seventh aspect, embodiments of the present invention provide a hot-start chimeric DNA polymerase or a variant thereof, obtained by the method described in any embodiment of the sixth aspect. In an eighth aspect, embodiments of the present invention provide an amplification method, comprising using a hot-start chimeric DNA polymerase or a variant thereof obtained by the method described in any embodiment of the sixth aspect or described in any embodiment of the seventh aspect.

[0145] In some embodiments, the hot-start chimeric DNA polymerase or a variant thereof is used for PCR amplification and NGS library amplification.

[0146] In some embodiments, the PCR amplification reaction system and the NGS library amplification reaction system are prepared at 4°C-25°C, for example, 4°C or 20-25°C.

[0147] The embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to be used to explain the present invention, but should not be understood as limiting the present invention.

[0148] Example

[0149] Example 1

[0150] In this example, chimeric DNA polymerase was used as an antigen to immunize mice, and then the affinity and neutralization activities of antibodies in the serum collected from the immunized mice were detected.

[0151] 1.1 Immunization of mice with chimeric DNA polymerase as antigen

[0152] Three rounds of immunization were performed on five BALB / c mice using chimeric DNA polymerase (SEQ ID NO: 12, purity above 90%, dissolved in 1×PBS buffer as a stock solution) as an antigen.

[0153] First round of immunization: Each mouse was intraperitoneally injected with 100 μg of Freund's complete adjuvant, with a total dose of 1 ml per mouse.

[0154] The second and third rounds of immunization: mice were intraperitoneally injected with 50 μg / 0.5 ml / mouse Freund's incomplete adjuvant, with an interval of 2 weeks between each round of immunization.

[0155] Ten days after the third round of immunization, blood was collected from the saphenous vein of the hind limbs of the mice, placed in an EP tube at room temperature for one hour, and then centrifuged at 3000 rpm for 10 minutes to obtain the supernatant, i.e., serum, which was stored at -80°C.

[0156] 1.2 ELISA assay to detect the affinity activity of antibodies in serum

[0157] (1) The stock solution of chimeric DNA polymerase was diluted to 0.5 μg / ml and added to the ELISA plate at 100 μL per well. The plate was then coated at 4°C overnight.

[0158] (2) Add 200 μL of PBST to the wells of the ELISA plate, shake and wash the plate for 10 minutes, and repeat the above washing step with PBST three times; add 200 μL of PBS to the wells of the ELISA plate again, shake and wash the plate for 10 minutes, and repeat the above washing step with PBS three times.

[0159] (3) Add 200 μL of blocking solution (1% BSA-PBS) to the wells of the ELISA plate and incubate at 37°C for 1-2 hours.

[0160] (4) Add 100 μL of diluted post-immune serum to the wells of the ELISA plate and incubate at 37°C for 2 hours. Then repeat step (2).

[0161] (5) Add 100 μL of freshly prepared goat anti-mouse antibody diluted solution (Goat Anti-Mouse IgG H&L (HRP) to the wells of the ELISA plate, product number ab97023, purchased from abcam) and incubate at 37°C for 1 hour. Repeat step (2).

[0162] (6) Tetramethylbenzidine microporous peroxidase substrate (TMB) was used as a substrate to carry out the reaction at room temperature in the dark for 10 minutes.

[0163] (7) Add 50 μL of stop solution (0.1 mol / L sulfuric acid) to the wells of the ELISA plate where the reaction is being carried out in the dark, and use a microplate reader to measure the absorbance of the liquid in the ELISA plate at a wavelength of 450 nm.

[0164] The results of ELISA reaction to detect the affinity activity of antibodies in mouse serum are shown in Table 1. The results showed that after three rounds of immunization, the titers of the sera of five mice were all greater than 1:512000, and cell fusion was possible.

[0165] Table 1 Serum titers of 5 mice after three immunizations

[0166]

[0167]

[0168] 1.3 Fluorescent probe method to detect the neutralizing activity of serum containing antibodies

[0169] (1) 2 μL of chimeric DNA polymerase (0.13 mg / ml) was mixed with 3.9 μL of serum from mouse AE before and after immunization, and the mixture was incubated at 37° C. for 15 minutes.

[0170] (2) Add 11.5 μL of PBS buffer to obtain a chimeric DNA polymerase-serum mixture with a concentration of 0.015 mg / ml, and place the mixture on ice until use.

[0171] (3) Primer 1 (TGTACAGCTAATCC, SEQ ID NO: 22) and a molecular beacon with a fluorescent group at the 5' end and a quencher group at the 3' end (5'FAM-CGGCCAAGGATTAGCTGTACATAGGCCG-3'Dabcyl, SEQ ID NO: 23) were mixed in equal moles and then cooled from 95°C to 30°C at an annealing rate of 0.5°C / min to obtain a fluorescent probe substrate.

[0172] (4) Prepare a reaction system containing the following components: 2 μL of the chimeric DNA polymerase-serum premix obtained in step (2), 4 μL of 5× reaction buffer (10 mM Tris-HCl, 80 mM KCl, 2 mM MgCl2, 0.1% NP40, 0.1% Tween 20, pH 9.0), 0.5 μL of 10 mM dNTPs, 11.5 μL of nuclease-free water, and 2 μL of the fluorescent probe substrate obtained in step (3). The positive control (PC) is the above reaction system without serum; the negative control (NC) is the above reaction system without chimeric DNA polymerase.

[0173] (5) The reaction system was incubated at 40°C for 1 hour, and the fluorescence signal generated by the polymerization reaction was monitored by qPCR detection method, with the fluorescence signal collected every 30 seconds.

[0174] Because antibodies can specifically bind to DNA polymerase, they inhibit the polymerization reaction involved in DNA polymerase, manifesting as a decrease in the rate of fluorescent signal generation. Therefore, when the qPCR detection method results show that the rate of fluorescent signal generation is inhibited, it indicates the presence of neutralizing antibodies in the serum sample.

[0175] Figure 3 shows the neutralizing activity of serum containing antibodies detected by the fluorescent probe method, wherein the groups are a chimeric DNA polymerase group (PC) without serum incubation; an enzyme-free reaction mixture group (NC), in which the enzyme is replaced by nucleic acid-free water in the detection system; a pre-immune serum & enzyme group (NC2), which represents the incubation of the chimeric DNA polymerase with serum from pre-immune mice; a post-immune serum & enzyme heat shock group (PC2), which represents the addition of the fluorescent probe reaction system to the hot-start chimeric DNA polymerase after heat stimulation treatment at 95°C for 3 minutes under the condition of antibody inactivation; and a post-immune serum & enzyme group, which represents the preparation of the hot-start chimeric DNA polymerase by incubation of the chimeric DNA polymerase with post-immune serum, i.e., the treatment group.

[0176] The results in Figure 3 show that for five immunized mice, AE, the fluorescence signal of the post-immune serum & enzyme group was consistent with that of the reaction mixture group without enzyme (NC), compared to the fluorescence signal of the chimeric DNA polymerase group (PC) without serum incubation. This indicates that no or almost no polymerization reaction occurred in the reaction system, indicating that the polymerization activity of the chimeric DNA polymerase in the reaction system was inhibited. Therefore, it was determined that the serum of all five immunized mice contained antibodies with neutralizing activity. Furthermore, after heat stimulation, the fluorescence signal of the post-immune serum & enzyme heat-stimulated group increased, and the growth rate was similar to that of the PC group, indicating that heat stimulation can restore the polymerization activity of the chimeric DNA polymerase.

[0177] 1.4 M13-7P substrate assay for neutralizing activity of serum containing antibodies

[0178] (1) 2 μL of chimeric DNA polymerase (0.13 mg / ml) was mixed with 3.9 μL of serum from immunized mouse AE, and the mixture was incubated at 37° C. for 15 minutes.

[0179] (2) Add 11.5 μL of PBS buffer to obtain a chimeric DNA polymerase-serum mixture with a concentration of 0.015 mg / ml, and place the mixture on ice until use.

[0180] (3) M13 single-stranded DNA (M13mp18 single-stranded DNA, purchased from NEB, catalog number #N4040S) and the seven primers shown in Table 2 were annealed by gradient cooling (from 95°C to 30°C at an annealing rate of 0.5°C / min) to obtain M13-7p substrate.

[0181] Table 2 Primer sequences used in M13-7p detection

[0182] Primer name and number Base sequence (5' to 3' end) M13-primer 2, SEQ ID NO: 24CAAAGCGAACCAGACCGGAAGCAAACTCCAACAM13-primer 3, SEQ ID NO: 25AGACAGCATCGGAACGAGGGTAGCAACGGCTM13-primer 4, SEQ ID NO: 26GAACCAGAGCCACCACCGGAACCGCCTCM13-primer 5, SEQ ID NO: 27AGCGAACCTCCCGACTTGCGGGAGGM13-primer 6, SEQ ID NO: 28ACCTTTTACATCGGGAGAAACAATAACGGATTCGCCTGATTGCM13-primer 7, SEQ ID NO: 29GCTTAATGCGCCGCTACAGGGCGCGTM13-primer 8, SEQ ID NO: 30AGAGGATCCCCGGGTACCGAGCTCGAATTC

[0183] (4) Prepare a reaction system containing the following components: 1 μL of the chimeric DNA polymerase-serum mixture obtained in step (2), 5 μL of 5× reaction buffer (10 mM Tris-HCl, 80 mM KCl, 2 mM MgCl2, 0.1% NP40, 0.1% Tween 20, pH 9.0), 3 μL of M13-7P substrate, 1 μL of 10 mM dNTPs, 2 μL of 2 mM MgCl2, and 13 μL of nuclease-free water. The positive control (PC) is the above reaction system without serum; the negative control (NC) is the reaction system without the chimeric DNA polymerase.

[0184] (5) The reaction system was incubated at 40°C for 20 minutes, and then 2.5 μL of EDTA (0.5 M) was added to the reaction system to terminate the reaction.

[0185] (6) Using Qubit TM The dsDNA HS Detection Kit measures the yield of synthesized double-stranded DNA to determine the neutralization activity of antibodies against chimeric DNA polymerases.

[0186] Because antibodies specifically bind to DNA polymerase, they inhibit double-stranded DNA synthesis. Lower double-stranded DNA production indicates lower polymerization activity of the chimeric DNA polymerase, and correspondingly, stronger neutralizing activity of the antibody.

[0187] Table 3 Neutralizing activity of serum containing antibodies detected by M13-7 substrate method

[0188]

[0189] The results in Table 3 show that the serum of the five immunized mice AE contained antibodies with neutralizing activity, with an inhibition rate of 97.3%. In addition, the polymerization activity of the chimeric DNA polymerase was fully restored after heat shock treatment at 95°C for 3 minutes.

[0190] Based on the above affinity activity and neutralization activity test results, immunized mouse A was selected for subsequent cell fusion experiments.

[0191] Example 2

[0192] In this example, splenocytes of immunized mouse A were fused with mouse myeloma cells to prepare hybridoma cells, and monoclonal antibodies produced by the hybridoma cells were obtained according to the flow chart shown in FIG4 .

[0193] 2.1 Preparation of hybridoma cells

[0194] (1) Immunized mouse A was sacrificed and fixed on a dissecting board to remove the spleen. The spleen was homogenized in a glass homogenizer to obtain mouse splenocytes.

[0195] (2) The diluted spleen cells were fused with mouse SP2 / 0Ag14 myeloma cells.

[0196] (3) The successfully fused cells are cultured in a 96-well plate. These cells are the initial clone cells of the hybridoma.

[0197] 2.2 Affinity activity of antibodies produced by the first subclone

[0198] (1) The target chimeric DNA polymerase is used to coat a 96-well plate, and then the supernatant of the initial cloned cells is added to the coated 96-well plate for an ELISA reaction to detect the affinity activity of the antibody.

[0199] (2) Based on the antibody affinity test results, 30-40 hybridoma primary clones with higher affinity are selected for the first round of limiting dilution to obtain first subclones corresponding to each selected primary clone. Then, 5-7 of the multiple first subclones are selected as first subclones.

[0200] (3) The supernatant of 200 first subclone cells was subjected to Elisa affinity activity detection, wherein the antigen used was 1 μg / mL chimeric DNA polymerase and the detection system was 10 μL.

[0201] Table 4 below shows the Elisa test results of the antibodies produced by 200 first subclone cells, wherein the OD value of the blank was 0.045.

[0202] Table 4 Affinity activity of the first subclone cell antibody determined by ELISA assay

[0203]

[0204]

[0205]

[0206] 2.3 Neutralizing activity of antibodies produced by the first subclone

[0207] (1) The supernatant of 200 first subclone cells (5 ml each) was added to 200 μL of Protein A agarose resin (purchased from Beijing Sino-Bio Technologies Co., Ltd., catalog number #10600-P07E-RN) for affinity adsorption, and then eluted with eluent (0.1 M glycine, 0.02 M arginine, acetic acid, pH 3.0) and dialyzed into 1× PBS buffer to obtain purified antibodies produced by each first subclone cell.

[0208] (2) The antibody (0.26 mg / ml) and chimeric DNA polymerase (0.13 mg / ml) were mixed in equal volumes at a mass ratio of 2:1, and the mixture was incubated at 37°C for 15 minutes to obtain a hot-start chimeric DNA polymerase.

[0209] (3) Fluorescent probe method to detect neutralizing activity of antibodies

[0210] a. Add PBS to obtain a 40-fold diluted hot-start chimeric DNA polymerase solution.

[0211] b. Prepare a reaction system containing the following components: 2 μL of diluted hot-start chimeric DNA polymerase solution, 4 μL of 5× reaction buffer (10 mM Tris-HCl, 80 mM KCl, 2 mM MgCl2, 0.1% NP40, 0.1% Tween 20, pH 9.0), 0.5 μL of 10 mM dNTPs, 11.5 μL of nuclease-free water, and 2 μL of the aforementioned fluorescent probe substrate. A positive control (PC) consisted of the above reaction system without antibody; a negative control (NC) consisted of the above reaction system without chimeric DNA polymerase.

[0212] c. Incubate the above reaction system at 40°C for 1 hour, and use qPCR detection method to monitor the fluorescent signal generated during the amplification reaction.

[0213] Figure 5 shows the neutralizing activity of antibodies detected by the fluorescent probe method. Figure 5 shows that compared with the positive control group, 12 of the 200 antibodies in the antibody & enzyme group exhibited significantly reduced fluorescence signal change rates, indicating that these 12 antibodies had potent neutralizing activity. They are 1-39 (16G4E2), 1-1 (26E2B1), 2-19 (30E5B10), 1-49 (6D7G1), 1-47 (6D7G4), 2-62 (30E5H7), 2-1 (11F2F12), 3-9 (30E5H9), 3-18 (12H2H6), 3-72 (12H2G1), 3-40 (30E5C10), and 3-39 (12H2G5).

[0214] (4) Detection of neutralizing activity of antibodies using the M13-7p substrate method

[0215] a. Add PBS to obtain a 2-fold diluted hot-start chimeric DNA polymerase solution.

[0216] b. Prepare a reaction system containing the following components: 1 μL of diluted hot-start chimeric DNA polymerase, 5 μL of 5× reaction buffer (10 mM Tris-HCl, 80 mM KCl, 2 mM MgCl2, 0.1% NP40, 0.1% Tween 20, pH 9.0), 3 μL of M13-7p substrate, 1 μL of 10 mM dNTPs, 2 μL of 2 mM MgCl2, and 13 μL of nuclease-free water. A positive control (PC) consisted of the above reaction system without antibody; a negative control (NC) consisted of the above reaction system without chimeric DNA polymerase.

[0217] c. The above reaction system was incubated at 40°C for 20 minutes, and then 2.5 μL EDTA (0.5 M) was added to the reaction system to terminate the reaction.

[0218] d. Use Qubit TM The dsDNA HS Detection Kit measures the yield of synthesized double-stranded DNA to determine the neutralization activity of antibodies against chimeric DNA polymerases.

[0219] Because antibodies specifically bind to DNA polymerase, they inhibit double-stranded DNA synthesis. Lower double-stranded DNA production indicates lower polymerization activity of the chimeric DNA polymerase, and correspondingly, stronger neutralizing activity of the antibody.

[0220] Table 5 Neutralizing activity of antibodies detected by M13-7p substrate method

[0221]

[0222] As shown in Table 5, the neutralizing activity of the antibodies detected by the M13-7p substrate assay was essentially consistent with that detected by the probe assay. Antibodies produced by 12 of the 200 first subclone cells significantly inhibited the polymerization activity of the chimeric DNA polymerase, with six of these antibodies exhibiting inhibition exceeding 90%. These antibodies were 11F2F12, 30E5H7, 30E5H9, 12H2H6, 12H2G5, and 12H2G1.

[0223] 2.4 Screening and seed preservation based on antibodies produced by secondary subcloned cells

[0224] (1) Based on the six antibodies with high neutralizing activity identified in 2.3, three first subclone cells, 11F2F12, 12H2G1, and 30E5H9, were selected for further subcloning to obtain the corresponding second subclone cells.

[0225] (2) The neutralizing activity of the antibodies produced by the second subclone cells was further confirmed. The results are shown in Table 6.

[0226] Table 6 Neutralizing activity of antibodies corresponding to the second subcellular compartment detected by M13-7p substrate method

[0227] Second sub-cell line number ID Activity inhibition degree MM00112H2G1D1 96.76% MM00211F2F12C2 98.08% MM00330E5H9A5 93.08%

[0228] Further analysis confirmed that among the three sub-cell lines, MM003 was not monoclonal. The stable cell lines MM001 and MM002 corresponding to the monoclonal antibodies 11F2F12C2 and 12H2G1D1 were stored in liquid nitrogen.

[0229] Example 3

[0230] This example is based on the two monoclonal antibodies in Example 2, and the nucleic acids encoding the antibodies are sequenced and the antibodies are purified.

[0231] 3.1 Culture of secondary cells corresponding to monoclonal antibodies.

[0232] a. Perform routine disinfection in the cell laboratory and irradiate with ultraviolet light for 30 minutes.

[0233] b. Place the culture medium in a constant temperature water bath at 37°C for more than 20 minutes.

[0234] c. Remove the cryovial from the liquid nitrogen tank and immediately place it in a 37°C water bath. Shake rapidly until the cryovial is completely thawed.

[0235] d. Transfer the cell suspension into a 15 ml centrifuge tube, slowly add 9 ml of culture medium (RPMI 1640 medium, 20% FBS), and centrifuge at 1000 rpm for 5 minutes.

[0236] e. Resuspend the cells in 4 mL of culture medium, transfer to a T25 culture flask, and incubate at 37°C to obtain sufficient cells for subsequent steps.

[0237] 3.2 Determine the variable region sequences of antibody light and heavy chains

[0238] (1) Total RNA was extracted from cell lines MM001 and MM002 (PureLink RNA Mini Kit, Invitrogen) TM , catalog number #12183018A).

[0239] (2) Using the above total RNA as a template, cDNA was synthesized by RT-PCR (SuperScript TM II Reverse Transcriptase, Invitrogen TM , catalog number #18064071).

[0240] (3) Using cDNA as a template, PCR amplification was performed using the Mouse IgG Library Primer Set Kit (purchased from progen, catalog number #F2010), using 11 pairs of light chain amplification primers and 11 pairs of heavy chain amplification primers.

[0241] (4) Gel electrophoresis was performed on each of the 22 amplified products to identify the amplified products containing the heavy chain variable region and the amplified products containing the light chain variable region. As shown in Figure 6, the eighth pair of heavy chain primers successfully amplified the heavy chain variable region fragments of the antibodies secreted by the MM001 and MM002 cell lines; the fifth pair of light chain primers successfully amplified the light chain variable region fragments of the antibodies secreted by the MM001 and MM002 cell lines. The variable region DNA fragments of the antibody light and heavy chains were concentrated around 400 bp.

[0242] (5) The products amplified by the eighth heavy chain primer pair and the fifth light chain primer pair were subjected to gel electrophoresis again and the The corresponding light chain variable region fragment and heavy chain variable region fragment in the gel were recovered using a gel extraction kit (purchased from Omega, catalog number #D2500-02).

[0243] (6) The light chain variable region fragment and the heavy chain variable region fragment were ligated into a T vector (pMD 19-T vector cloning kit, Takara, catalog number #6013), transformed into Escherichia coli DH5α, amplified, and sent for sequencing.

[0244] The coding sequences of the light chain variable region fragment and the heavy chain variable region fragment of antibodies MM001 and MM002 were determined by sequencing. The amino acid sequences of the light chain variable region fragment and the heavy chain variable region fragment were then determined by DNA transcription and translation.

[0245] By comparing with the IMGT database, the three complementary determining region sequences in the heavy chain variable region fragment and the light chain variable region fragment were determined.

[0246] 3.3 Antibody purification and storage

[0247] (1) The MM001 and MM002 cell lines obtained in 3.1 were acclimated and cultured in serum-free HybriSFM-P1B medium (purchased from Shanghai Aopuma Biotechnology Co., Ltd., product number H081801-001).

[0248] (2) The acclimated cells were suspended and cultured in HybriSFM-P1B hybridoma cell culture medium.

[0249] (3) The supernatant of the suspension culture system obtained after centrifugation was affinity purified using a Protein A agarose resin column.

[0250] a. Prepare a Protein A agarose resin purification column (purchased from Beijing Sino Biological Technology Co., Ltd., catalog number #10600-P07E-RN).

[0251] b. Load the cell supernatant onto the purification column for affinity adsorption at a loading rate of 8 ml / min (binding buffer is 1× PBS).

[0252] c. Elute with elution buffer (0.1 M glycine, 0.02 M arginine, acetic acid, pH 3.0) to obtain purified antibody. The eluted antibody was then dialyzed into 2× PBS. The absorbance was measured at 280 nm, and the antibody concentration was calculated using the Bradford assay.

[0253] (4) The antibody was stored in storage solution (1×PBS + 50% glycerol) at a concentration of 1.2 mg / mL.

[0254] (5) Perform SDS-PAGE analysis on the antibody.

[0255] The SDS-PAGE analysis results of the antibody are shown in Figure 7. The light chain and heavy chain of the antibody are located around 25 kDa and 55 kDa, respectively, and have high purity, meeting the application requirements.

[0256] Example 4

[0257] This example is based on the antibodies MM001 and MM002 purified in Example 3, and the performance of the hot-start chimeric DNA polymerase prepared by using these antibodies is verified in multiple ways.

[0258] 4.1 Preparation of hot-start chimeric DNA polymerases under different conditions

[0259] Hot-start chimeric DNA polymerases were obtained by incubating antibodies MM001 and MM002 with a B-family chimeric DNA polymerase (SEQ ID NO: 12) for 15 minutes at 25°C, 30°C, and 37°C, respectively, at antibody-to-chimeric DNA polymerase weight ratios of 2:1, 4:1, and 6:1. The neutralization activity of the hot-start chimeric DNA polymerases was determined using the M13-7p substrate assay.

[0260] Table 6 Effects of antibody-polymerase mass ratio and temperature on the polymerization activity of hot-start chimeric DNA polymerases

[0261]

[0262]

[0263] Table 6 shows that antibodies MM001 and MM002 exhibited an inhibitory effect of more than 98% on the polymerization activity of chimeric DNA polymerase at three different reaction temperatures and three different antibody-polymerase mass ratios.

[0264] 4.2 Effects of Antibodies on the Polymerization Activity of Chimeric DNA Polymerase Variants

[0265] Antibodies MM001 / MM002 at a mass ratio of 2:1 were incubated with a chimeric DNA polymerase variant (SEQ ID NO: 13) at 37°C for 15 minutes to obtain a hot-start chimeric DNA polymerase variant. The effect of antibodies MM001 / MM002 on the polymerization activity of the chimeric DNA polymerase variant was detected using the M13-7p substrate method.

[0266] Table 7 Effect of Antibody MM001 / MM002 on the Polymerization Activity of Chimeric DNA Polymerase Variants

[0267]

[0268] Table 7 shows the effects of MM001 and MM002 on the polymerization activity of the chimeric DNA polymerase variant. The results show that antibodies MM001 and MM002 also have a good neutralizing effect on the chimeric DNA polymerase variant.

[0269] 4.3 Amplification effects of hot-start chimeric DNA polymerases prepared with different antibody-polymerase mass ratios

[0270] Antibodies MM001 and M002 were incubated with a B-family chimeric DNA polymerase (SEQ ID NO: 12) at different antibody-polymerase mass ratios (0.75:1, 1:1, 2:1, 3:1, 4:1, 5:1, 8:1, and 10:1) at 37°C for 15 minutes to obtain hot-start chimeric DNA polymerases.

[0271] PCR reaction systems containing the hot-start chimeric DNA polymerases prepared at various mass ratios as described above were prepared at room temperature for the smaller target fragment hACTG1 (485 bp) and the larger target fragment hCYB5A (998 bp), respectively. The reaction systems were incubated at room temperature for more than 30 minutes, and then PCR amplification was performed at an annealing temperature of 61°C. The results are shown in FIG8 .

[0272] The gel electrophoresis results in Figure 8 show that, compared to the amplification products produced by the non-hot-start chimeric DNA polymerase, which exhibited a distinct diffuse pattern, the hot-start DNA polymerase prepared at all antibody-to-polymerase mass ratios significantly reduced the diffuse pattern of amplification products, while the target amplification product band was more concentrated, demonstrating that the hot-start chimeric DNA polymerase improved PCR amplification. Furthermore, compared to the non-hot-start chimeric DNA polymerase, amplification performance was significantly enhanced when the antibody-to-chimeric DNA polymerase mass ratio was greater than or equal to 2:1, and no significant differences in amplification performance were observed for ratios greater than 2:1.

[0273] 4.4 Accelerated stability testing of hot-start chimeric DNA polymerases

[0274] The antibody and chimeric DNA polymerase were incubated at 37°C for 15 minutes at an antibody-polymerase mass ratio of 2:1 to obtain a hot start chimeric DNA polymerase. The hot start chimeric DNA polymerase was formulated as PCR ReadyMix (2×). The hot start chimeric DNA polymerase in PCR ReadyMix format was placed in a 37°C oven for a two-week accelerated stability test, and samples were taken at specific time intervals and the neutralizing activity of the antibody was tested by the M13-7p assay. The results are shown in Table 8.

[0275] Table 8 Accelerated stability test

[0276]

[0277] Table 8 shows that the inhibitory effect of the hot-start polymerase in the form of PCR ReadyMix on the polymerization activity of the chimeric DNA polymerase was maintained at above 99% after being stored in a 37°C oven for 16 days, indicating that the hot-start chimeric DNA polymerase prepared by the antibody in the examples of the present invention has good stability.

[0278] Using the E. coli gDNA rRNA-1.5 kb gene as a template, amplification reactions were performed using PCR reaction systems containing the aforementioned PCR ReadyMix hot-start chimeric DNA polymerases stored for different days (with a PCR ReadyMix non-hot-start chimeric DNA polymerase as a control). The yields of amplified products obtained using the PCR ReadyMix hot-start chimeric DNA polymerases stored for different days (relative to the PCR ReadyMix non-hot-start chimeric DNA polymerase) were then calculated and compared, as shown in Table 9. Simultaneously, gel electrophoresis was performed on each amplification product, as shown in FIG9 .

[0279] Table 9 Accelerated stability test

[0280]

[0281] Table 9 and Figure 9 show that after 8 days of accelerated stability testing, the hot-start chimeric DNA polymerases prepared from the antibodies of the present examples still exhibited excellent hot-start and amplification performance. Even after 8 days of accelerated stability testing, the hot-start chimeric DNA polymerases still achieved amplification product yields exceeding 73% compared to the non-hot-start chimeric DNA polymerases, demonstrating that the hot-start chimeric DNA polymerases prepared from antibodies MM001 and MM002 can be stored at -20°C for extended periods (e.g., 1 year).

[0282] 4.5 Perform conventional PCR amplification using a hot-start chimeric DNA polymerase at 0-4°C

[0283] PCR reactions were set up on ice (0-4°C) using hot-start chimeric DNA polymerases prepared with antibodies MM001 and MM002 for the smaller target fragment hUQCRC1 (315 bp), the medium target fragment hPRPH (744 bp), and the larger target fragment hCYB5A (998 bp). Control PCR reactions were performed using a non-hot-start chimeric DNA polymerase and a commercially available hot-start polymerase (Supplier K-HS, purchased from Kapa Biosystems, catalog #KK2611). PCR amplifications were performed using a classic three-step protocol with 30 cycles at various annealing temperatures (55.4°C, 58.1°C, 61°C, and 63.7°C). All amplified products were then subjected to gel electrophoresis to compare the amplification performance of the hot-start chimeric DNA polymerases prepared with antibodies MM001 and MM002.

[0284] Figure 10 shows the amplification performance of the hot-start chimeric DNA polymerase prepared using the antibodies in the examples of the present invention in PCR amplification reactions at different annealing temperatures. Figure 10 shows that compared to non-hot-start chimeric DNA polymerases and commercially available hot-start polymerases of the same type, the hot-start chimeric DNA polymerase prepared using the antibodies provided in the examples of the present invention significantly reduced the amount of diffuse amplification products after the amplification reaction when the PCR amplification system was prepared at 0-4°C. Furthermore, at an annealing temperature of 58.1°C, the larger target fragment hCYB5A (998 bp) and the medium target fragment hPRPH (744 bp) were still amplified with significantly higher specificity. Even at an annealing temperature as low as 55.4°C, the smaller target fragment hUQCRC1 (315 bp) was still amplified with significantly higher specificity. These results demonstrate that the hot-start chimeric DNA polymerase prepared using the antibodies in the examples of the present invention has excellent specific amplification performance and outperforms non-hot-start chimeric DNA polymerases and commercially available hot-start polymerases in terms of annealing temperature.

[0285] 4.6 PCR amplification using hot-start chimeric DNA polymerase at room temperature

[0286] Considering that it is difficult to always maintain 0 to 4°C when preparing a large number of PCR reaction systems. Therefore, using the E. coli gDNA rRNA-1.5kb gene as a template, a PCR reaction system containing antibodies MM001 and MM002 in the examples of the present invention to prepare a hot-start chimeric DNA polymerase was prepared at room temperature (e.g., room temperature, such as 20-30°C), and a corresponding PCR reaction system containing a commercial hot-start polymerase of the same type (Supplier K-HS, purchased from Kapa Biosystems, catalog number #2611) was used as a control. PCR amplification reactions were performed on the above different reaction systems at different annealing temperatures (50.0°C, 51.0°C, 53.1°C, 56.4°C, 60.6°C, 63.9°C, 66.0°C, and 67.0°C), using a classic three-step amplification procedure with 30 cycles. Then, all amplified products were subjected to gel electrophoresis to compare the amplification effects of the hot-start chimeric DNA polymerases prepared with antibodies MM001 and MM002.

[0287] Figure 11 shows the amplification effect of the hot-start chimeric DNA polymerase prepared by the antibody in the embodiment of the present invention on the PCR amplification reaction at different annealing temperatures. Figure 11 shows that when the PCR amplification system is prepared using the commercial hot-start polymerase of the same type, the amplification product is significantly reduced when the amplification reaction is carried out at an annealing temperature of 60.6°C, the amplification product is very small or almost disappears when the amplification reaction is carried out at an annealing temperature of 63.9°C, and no amplification product is obtained when the amplification reaction is carried out at an annealing temperature of 66.0°C and 67.0°C. In contrast, the hot-start chimeric DNA polymerase prepared by the antibody provided in the embodiment of the present invention is used to prepare the PCR amplification system at room temperature. The target amplification product can still be stably obtained at an annealing temperature of 63.9°C. Compared with the amplification reaction carried out at annealing temperatures of 50.0°C, 51.0°C, 53.1°C, 56.4°C and 60.6°C, the target amplification product is not significantly reduced; and even when the amplification reaction is carried out at annealing temperatures of 66.0°C and 67.0°C, a small amount of target amplification product can be obtained. These results indicate that even when the hot-start chimeric DNA polymerase prepared using the antibodies in the examples of the present invention is used for amplification reactions at room temperature, excellent amplification effects can be achieved, and the annealing temperature is superior to that of non-hot-start chimeric DNA polymerases and commercial hot-start polymerases of the same type.

[0288] 4.7 Hot-Start Chimeric DNA Polymerases for NGS Amplification

[0289] A hot-start chimeric DNA polymerase prepared with the MM002 antibody was used for WES library construction, and a control containing a commercially available hot-start polymerase of the same type (Supplier K-HS, purchased from Kapa Biosystems, Catalog #2611) was used to compare library yield and quality, as shown in Figure 12. The Standard MPS sequencing report on the BGI G400 platform demonstrated that the library yield and gene coverage achieved with the hot-start chimeric DNA polymerase prepared with the MM002 antibody were comparable to those achieved with the commercial control enzyme.

[0290] From the above description, those skilled in the art can easily ascertain the essential features of the present invention and, without departing from the spirit and scope of the present invention, can make various changes and modifications to the present invention to adapt it to various uses and conditions. Therefore, other embodiments are also within the scope of the claims.

[0291] Although various inventive embodiments have been described and illustrated herein, a person of ordinary skill in the art will readily devise a variety of other means and / or structures for performing the functions described herein and / or obtaining the results and / or one or more advantages thereof, and each of these variations and / or modifications is considered to be within the scope of the inventive embodiments described herein. More generally, a person skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the specific application or applications in which the teachings of the present invention are used. A person skilled in the art will recognize or be able to ascertain, using only routine experimentation, many equivalents to the specific inventive embodiments described herein. Therefore, it should be understood that the foregoing embodiments are given by way of example only, and that, within the scope of the appended claims and their equivalents, embodiments of the present invention may be practiced in a manner other than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods is included within the inventive scope of the present disclosure, provided such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent.

[0292] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0293] All references, patents, and patent applications disclosed herein are hereby incorporated by reference with respect to the subject matter for which they are individually cited, which in some cases may be incorporated in their entirety.

[0294] Unless explicitly stated to the contrary, nouns used herein without quantifiers should be understood to mean "at least one."

[0295] As used in the specification and claims, the phrase "and / or" should be understood to refer to "one or both" of the elements so combined, i.e., elements that exist together in some cases and separately in other cases. Multiple elements indicated with "and / or" should be interpreted in the same manner, i.e., "one or more" of the elements so connected. In addition to the elements explicitly identified by the "and / or" clause, other elements may optionally be present, whether related or unrelated to those specifically identified. Thus, as a non-limiting example, in one embodiment, when used in conjunction with open language such as "comprising," a reference to "A and / or B" may refer to only A (optionally including elements other than B); in another embodiment, to only B (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); and so on.

[0296] As used herein in the specification and claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as inclusive, i.e., including at least one of several elements or a list of elements, but also including more than one; and optionally unspecified items. Only explicitly indicating the opposite term, such as "only one" or "exactly one" or when used in the claims, "consisting of..." will refer to the inclusion of precisely one element of several elements or a list of elements. In general, the term "or" as used herein is interpreted as indicating mutually exclusive alternatives ("one or the other but not both") only when it precedes an exclusive term such as "either of two," "one of...", "only one of..." or "exactly one of...". When used in the claims, "consisting essentially of..." should have the ordinary meaning used in the field of patent law.

[0297] As used herein in the specification and claims, when referring to a list of one or more elements, the phrase "at least one" should be understood to mean at least one element selected from any one or more elements in the list of elements, but not necessarily including at least one of each and every element specifically identified in the list of elements, and not excluding any combination of elements in the list of elements. This definition also allows that elements other than the elements specifically identified in the list of elements to which the phrase "at least one" refers may optionally be present, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or equivalently, "at least one of A or B," or equivalently, "at least one of A and / or B") may mean, in one embodiment, at least one A, optionally including more than one A, and the absence of B (and optionally including elements other than B); in another embodiment, at least one B, optionally including more than one B, and the absence of A (and optionally including elements other than A); in yet other embodiments, at least one A, optionally including more than one A, and at least one B, optionally including more than one B (and optionally including other elements); etc.

[0298] It should also be understood that in any method claimed herein that includes more than one step or action, the order of the steps or actions of the method is not necessarily limited to the order of the steps or actions of the method as recited unless clearly indicated to the contrary.

[0299] In the present invention, the terms "one embodiment," "some embodiments," "examples," "specific examples," or "some examples" mean that the specific features, structures, materials, or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples.

[0300] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

[0301]

[0302]

[0303]

[0304]

[0305]

[0306]

[0307]

[0308]

[0309]

[0310]

[0311]

Claims

1. An isolated antibody, characterized in that The antibody specifically neutralizes the polymerization activity of a chimeric DNA polymerase or a variant thereof, and the antibody comprises: A heavy chain complementary determining region 1 having an amino acid sequence as shown in SEQ ID NO:1, a heavy chain complementary determining region 2 having an amino acid sequence as shown in SEQ ID NO:2 or SEQ ID NO:7, a heavy chain complementary determining region 3 having an amino acid sequence as shown in SEQ ID NO:3 or SEQ ID NO:8, a light chain complementary determining region 1 having an amino acid sequence as shown in SEQ ID NO:4 or SEQ ID NO:9, a light chain complementary determining region 2 having an amino acid sequence as shown in SEQ ID NO:5 or SEQ ID NO:10, and a light chain complementary determining region 3 having an amino acid sequence as shown in SEQ ID NO:6 or SEQ ID NO:

11.

2. The antibody according to claim 1, characterized in that The antibody comprises: A heavy chain complementary determining region 1 having the amino acid sequence of SEQ ID NO: 1, a heavy chain complementary determining region 2 having the amino acid sequence of SEQ ID NO: 2, a heavy chain complementary determining region 3 having the amino acid sequence of SEQ ID NO: 3, a light chain complementary determining region 1 having the amino acid sequence of SEQ ID NO: 4, a light chain complementary determining region 2 having the amino acid sequence of SEQ ID NO: 5, and a light chain complementary determining region 3 having the amino acid sequence of SEQ ID NO: 6; or a heavy chain complementary determining region 1 having the amino acid sequence of SEQ ID NO: 1, a heavy chain complementary determining region 2 having the amino acid sequence of SEQ ID NO: 7, a heavy chain complementary determining region 3 having the amino acid sequence of SEQ ID NO: 8, a light chain complementary determining region 1 having the amino acid sequence of SEQ ID NO: 9, a light chain complementary determining region 2 having the amino acid sequence of SEQ ID NO: 10, and a light chain complementary determining region 3 having the amino acid sequence of SEQ ID NO: 11; Optionally, the chimeric DNA polymerase or its variant is derived from a B family DNA polymerase.

3. The antibody according to claim 1, characterized in that The chimeric DNA polymerase comprises the amino acid sequence shown in SEQ ID NO:

12.

4. The antibody according to claim 1, characterized in that The chimeric DNA polymerase variant comprises the amino acid sequence shown in SEQ ID NO:

13.

5. The antibody according to claim 1, characterized in that The antibody comprises a heavy chain variable region of the amino acid sequence shown in SEQ ID NO:14 or SEQ ID NO:16 and a light chain variable region of the amino acid sequence shown in SEQ ID NO:15 or SEQ ID NO:

17.

6. The antibody according to claim 1, characterized in that The antibody comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO: 14 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO: 15; or the antibody comprises a heavy chain variable region with an amino acid sequence as shown in SEQ ID NO: 16 and a light chain variable region with an amino acid sequence as shown in SEQ ID NO:

17.

7. The antibody according to claim 1, characterized in that The antibody is 11F2F12, 30E5H7, 30E5H9, 12H2H6, 12H2G5 or 12H2G1.

8. The antibody according to claim 1, characterized in that The antibody is 11F2F12C2 or 12H2G1D1.

9. The antibody according to claim 1, characterized in that The antibody is a full-length antibody or an antigen-binding fragment thereof.

10. A nucleic acid, characterized in that The nucleic acid encodes the antibody of any one of claims 1-9.

11. The nucleic acid according to claim 10, characterized in that The nucleic acid encoding the heavy chain variable region of the amino acid sequence shown in SEQ ID NO:14 has the nucleotide sequence shown in SEQ ID NO:18; the nucleic acid encoding the light chain variable region of the amino acid sequence shown in SEQ ID NO:15 has the nucleotide sequence shown in SEQ ID NO:

19.

12. The nucleic acid according to claim 10, characterized in that The nucleic acid encoding the heavy chain variable region of the amino acid sequence shown in SEQ ID NO:16 has the nucleotide sequence shown in SEQ ID NO:20; the nucleic acid encoding the light chain variable region of the amino acid sequence shown in SEQ ID NO:17 has the nucleotide sequence shown in SEQ ID NO:

21.

13. A carrier, characterized in that The vector comprises the nucleic acid of any one of claims 10 to 12, and optionally, the vector is an expression vector.

14. A host cell, characterized in that The host cell expresses or secretes the antibody according to any one of claims 1 to 9.

15. The host cell according to claim 14, characterized in that Cultivating the host cell under appropriate conditions that allow for expression of the antibody enables the antibody as described in any one of claims 1-9 to be harvested from the cell culture.

16. A kit, characterized in that: The kit comprises the antibody according to any one of claims 1 to 9, the nucleic acid according to any one of claims 10 to 12, the vector according to claim 13 or the host cell according to claim 14 or 15.

17. A method for preparing a hot-start chimeric DNA polymerase or a variant thereof, characterized in that: Comprising the use of the antibody described in any one of claims 1-9.

18. The method according to claim 17, characterized in that The antibody and the chimeric DNA polymerase or variant thereof are prepared in a mass ratio of 0.75:1 to 10:1, preferably 1:1 to 8:1, more preferably 2:1 to 6:1, for example 4:1 to prepare the hot-start chimeric DNA polymerase or variant thereof.

19. The method according to claim 17 or 18, characterized in that The antibody and the chimeric DNA polymerase or variant thereof are prepared at a temperature of 20 to 40°C, such as 25 to 37°C, such as 30°C.

20. A hot-start chimeric DNA polymerase or a variant thereof, obtained by the method according to any one of claims 17 to 19.

21. A method for nucleic acid amplification, characterized in that: The invention comprises a hot-start chimeric DNA polymerase or a variant thereof obtained using the method according to any one of claims 17 to 19 or according to claim 20.

22. The nucleic acid amplification method according to claim 21, characterized in that The hot-start chimeric DNA polymerase or its variant is used for PCR amplification or NGS library amplification.

23. The nucleic acid amplification method according to claim 19, characterized in that: The reaction system for PCR amplification and the reaction system for NGS library amplification are prepared at 4-25°C, for example, 4°C or 20-25°C.

Images