Use of circpde5a inhibitors in the preparation of a medicament for the treatment of prosthetic joint aseptic loosening

Abstract

The present application relates to the application of circPDE5A inhibitor in the preparation of drugs for treating aseptic loosening of artificial joints. The present application confirms that circPDE5A has a positive correlation with the occurrence of aseptic loosening. And through RNA Pull-Down experiment and mass spectrometry (MS) analysis, it is confirmed that circPDE5A can affect the regulation of LACC1 signal pathway by interacting with LACC1, and then affect the inflammatory response of macrophages. In addition, through in vivo animal experiments, the results of mouse skull osteolysis model show that the injection of lentivirus for knocking down circPDE5A can reduce the osteolysis induced by Ti particles. In general, the present application provides a new idea and theoretical basis for the research and development of drugs for treating aseptic loosening of artificial joints, and has important clinical value and social significance.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine and relates to the application of circPDE5A inhibitors in the preparation of drugs for treating aseptic loosening of artificial joints. Background Technology

[0002] Artificial joint replacement surgery is a primary surgical treatment for advanced osteoarthritis, particularly suitable for conditions such as osteoarthritis, rheumatoid arthritis, and avascular necrosis of the femoral head. This technique can significantly relieve joint pain, improve function, and enhance patients' quality of life. With advancements in technology and improvements in surgical materials, the success rate and long-term efficacy of artificial joint replacement surgery have continuously improved. However, due to complications such as prosthesis wear, loosening, and osteolysis, prosthesis failure can still occur after joint replacement surgery, especially aseptic loosening, which is one of the most common causes of revision surgery. Statistics show that the proportion of revision surgeries due to aseptic loosening is increasing year by year, and the complexity and cost of revision surgery are far greater than those of the initial replacement surgery. Therefore, how to effectively prevent and treat aseptic loosening has become an important research topic in the field of artificial joint replacement.

[0003] Aseptic loosening is a pathological osteolytic process triggered by chronic inflammation around the prosthesis. Parts generated from prosthesis wear (such as titanium particles) are the main pathogenic factor. After being phagocytosed by macrophages, these particles induce macrophage activation and the release of numerous pro-inflammatory factors, such as tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and RANKL (receptor activator of nuclear factor-κB). These factors accelerate bone resorption and dissolution by promoting osteoclast differentiation and activity. Studies have shown that the inflammatory response of macrophages is a key regulatory node in aseptic loosening. For example, regulating the activation of the NLRP3 inflammasome can significantly reduce macrophage-mediated inflammation, thereby improving bone loss. Therefore, inhibiting the release of pro-inflammatory macrophage factors or regulating their functional state may significantly improve the pathological process of aseptic loosening.

[0004] Circular RNAs (circRNAs) are a class of non-coding RNAs with a closed circular structure, formed by backsplicing of RNA, exhibiting high stability and specific regulatory functions. In recent years, research on circRNAs in inflammation, tumors, and metabolic diseases has received widespread attention. Circular RNAs can indirectly regulate target gene expression by binding to microRNAs (miRNAs) as a "sponge," and can also directly interact with proteins, participating in the regulation of signaling pathways. For example, studies have found that the circRNA circHIPK3 can promote the excessive secretion of inflammatory factors in macrophages by adsorbing miR-561 and miR-192, thereby exacerbating the inflammatory response. Furthermore, circZNF609, by binding to mitochondrial-associated proteins, regulates the production of reactive oxygen species (ROS) and the secretion of inflammatory factors in macrophages, playing an important role in various inflammatory diseases. These studies suggest that circRNAs may play a crucial role in macrophage inflammatory responses and downstream bone loss.

[0005] LACC1 (Laccase Domain Containing 1) is a key regulatory molecule discovered in inflammatory diseases in recent years. It influences inflammatory and immune responses by modulating the arginine-polyamine metabolic pathway in macrophages. Arginine metabolism is an important biochemical pathway in macrophages, and its metabolites, nitric oxide (NO) and polyamines, have a bidirectional regulatory effect on inflammatory responses. Studies have shown that LACC1 inhibits inflammatory responses by enhancing the activity of arginase 1, promoting the production of anti-inflammatory polyamine products. Furthermore, the absence of LACC1 is closely associated with macrophage dysfunction in diseases such as inflammatory bowel disease (IBD). Although the specific role of LACC1 in aseptic loosening has not yet been fully explored, its potential value in macrophage metabolic regulation provides direction for future research. Summary of the Invention

[0006] The purpose of this invention is to address the problems existing in the treatment of aseptic loosening of artificial joints in the prior art, thereby identifying a circular RNA, circPDE5A, that is closely related to aseptic loosening of artificial joints. The specific inhibitor of circPDE5A provided by this invention can be used to regulate LACC1-mediated macrophage arginine-polyamine metabolism and pro-inflammatory responses, thereby intervening in the pathological process of titanium particle-induced aseptic loosening. By targeting and inhibiting circPDE5A, the excessive activation of macrophage inflammatory signaling pathways can be effectively reduced, the osteolytic microenvironment can be improved, and ultimately a safe and effective new drug can be provided for the treatment of aseptic loosening.

[0007] To achieve the above objectives, the present invention is accomplished by the following means:

[0008] The first aspect of this invention provides the use of circPDE5A inhibitors in the preparation of medicaments for treating aseptic loosening of artificial joints and / or improving physiological indicators related to aseptic loosening of artificial joints.

[0009] Preferably, the physiological indicators related to aseptic loosening of artificial joints are selected from one or more of the following: inflammatory factor levels, macrophage inflammatory response core regulatory factor levels, spermidine levels, spermine levels, ornithine decarboxylase 1 levels, and craniolipolysis effect.

[0010] Preferably, the inflammatory factor is selected from one or more of TNF-α and IL-1β.

[0011] Preferably, the core regulatory factor of macrophage inflammatory response is selected from LACC1.

[0012] Preferably, the circPDE5A inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the circPDE5A gene.

[0013] Preferably, the circPDE5A inhibitor is selected from siRNA designed based on the circPDE5A gene.

[0014] Preferably, the siRNA sequence is selected from one or more of SEQ ID NO: 1 (5'-GGAAGAGAGAAATGGTCAA-3') and SEQ ID NO: 2 (5'-AATCATAGGGAAGAGAGAA-3').

[0015] A second aspect of the present invention provides the use of a reagent for detecting circPDE5A expression levels in the preparation of products for prognostic assessment of aseptic loosening of artificial joints.

[0016] Preferably, the reagent for detecting circPDEA5A expression level includes a primer pair that specifically detects circPDEA5 level.

[0017] Preferably, the upstream sequence of the primer pair is shown in SEQ ID NO: 3 (5'-AGAAGTTGACCAAATTACAGGCT-3'), and the downstream sequence is shown in SEQ ID NO: 4 (5'-CCATGCATTGACCATTTCTCTCT-3').

[0018] A third aspect of the present invention provides a pharmaceutical composition for treating aseptic loosening of artificial joints and / or improving physiological indicators related to aseptic loosening of artificial joints, comprising a circPDE5A inhibitor and a pharmaceutically acceptable carrier.

[0019] Preferably, the physiological indicators related to aseptic loosening of artificial joints are selected from one or more of the following: inflammatory factor levels, macrophage inflammatory response core regulatory factor levels, spermidine levels, spermine levels, ornithine decarboxylase 1 levels, and craniolipolysis effect.

[0020] Preferably, the inflammatory factor is selected from one or more of TNF-α and IL-1β.

[0021] Preferably, the core regulatory factor of macrophage inflammatory response is selected from LACC1.

[0022] Preferably, the circPDE5A inhibitor is selected from one or more of siRNA, shRNA, and sgRNA designed based on the circPDE5A gene.

[0023] Preferably, the circPDE5A inhibitor is selected from siRNA designed based on the circPDE5A gene.

[0024] Preferably, the sequence of the siRNA is selected from one or more of SEQ ID NO: 1 and SEQ ID NO: 2.

[0025] Preferably, the pharmaceutically acceptable carrier includes one or more of fillers, binders, disintegrants, solvents, preservatives, lubricants, and flavoring agents.

[0026] Unless otherwise specified, in the context of this invention, the term "circPDE5A inhibitor" refers to a substance capable of specifically downregulating the level or activity of circPDE5A. This can be achieved through methods such as antisense oligonucleotides, siRNA, shRNA, sgRNA, antagomiRs, miRNA sponges, miRNA erasers, target masking, and / or multi-target methods to downregulate circPDE5A expression levels and / or activity. Primers and / or primer pairs refer to PCR primers used to synthesize the circPDE5A gene cDNA strand in PCR, thereby detecting the expression level of the circPDE5A gene mRNA. In addition to the primers and / or primer pairs listed in this invention, those skilled in the art are fully capable of designing corresponding primers and / or primer pairs based on the circPDE5A gene sequence using conventional methods and techniques in the field, including but not limited to molecular biology, and screening the designed primers and / or primer pairs using conventional experimental methods, as long as they can specifically detect the circPDE5A expression level.

[0027] This invention, through extensive research, performed high-throughput sequencing of circRNAs in mouse bone marrow-derived macrophages stimulated by Ti particles. The study identified and characterized significantly high expression of circPDE5A, and verified its high expression around prostheses in patients with aseptic loosening, while also verifying its circulation effect. By detecting its expression in Ti particle-induced macrophages and around prostheses in patients with aseptic loosening, a positive correlation was demonstrated with the occurrence of aseptic loosening. Furthermore, RNA pull-down assays and protein mass spectrometry (MS) analysis were used to screen differentially expressed proteins that bind to circPDE5A, predicting that LACC1 is a potential core regulatory gene in the macrophage inflammatory response activated by wear particles. circPDE5A can influence the regulation of the LACC1 signaling pathway through interaction with LACC1, thereby affecting the macrophage inflammatory response. Detection of its expression in Ti particle-induced macrophages and around prostheses in patients with aseptic loosening further demonstrates its positive correlation with the occurrence of aseptic loosening. Furthermore, in vivo animal experiments using a mouse cranial osteolysis model showed that lentiviral injection with knockdown of circPDE5A could alleviate Ti particle-induced osteolysis. In summary, this invention provides new ideas and a theoretical basis for drug development to treat aseptic loosening of artificial joints, and has significant clinical value and social implications. Attached Figure Description

[0028] Figure 1 Volcano plot of gene expression results in mouse bone marrow-derived macrophages induced by wear particles, obtained using RNA high-throughput sequencing.

[0029] Figure 2 This is a schematic diagram showing the results of using PCR technology to detect the expression of circPDE5A in Ti particle-induced macrophages.

[0030] Figure 3 This diagram illustrates the results of detecting circumvolution of circPDE5A using a ribonuclease (RNase R) that removes linear RNA.

[0031] Figure 4 This is a schematic diagram showing the results of using FISH technology to detect the expression of circPDE5A in the periprosthetic synovium of aseptically loosened patients.

[0032] Figure 5 This is a schematic diagram showing the results of detecting the distribution of circPDE5A in the cell nucleus and cytoplasm using an immunofluorescence assay (IF).

[0033] Figure 6 To detect the expression of inflammatory factors produced by macrophages induced by Ti particles after targeted overexpression / knockdown of circPDE5A using ELISA technology.

[0034] Figure 7 To screen differentially expressed proteins that bind to circPDE5A using RNA pull-down assays and protein mass spectrometry (MS) analysis, and to predict through bioinformatics analysis that LACC1 is a potential core regulatory gene in the macrophage inflammatory response activated by wear particles.

[0035] Figure 8 This diagram illustrates the results of using PCR technology to detect the mRNA expression level of LACC1 in macrophages after targeted overexpression / knockdown of circPDE5A and using Western blotting technology to detect the protein expression level of LACC1 in macrophages after targeted overexpression / knockdown of circPDE5A.

[0036] Figure 9 This diagram illustrates the results of using ELISA to detect the secretion levels of downstream spermidine (Spd) and spermine (Spm) produced by macrophages induced by Ti particles after targeted overexpression / knockdown of LACC1, and the inhibitory effect of targeted knockdown of LACC1 on the secretion levels of pro-inflammatory factors TNF-α and IL-1β by ornithine decarboxylase 1 (ODC1) overexpression.

[0037] Figure 10 This is a schematic diagram of the results of micro-CT scan of the mouse skull. Detailed Implementation

[0038] To make the objectives, technical solutions, and effects of this invention clearer and more explicit, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0039] Unless otherwise specified, all cells used in this invention were cultured according to ATCC guidelines. All cell lines were identified by short tandem repeat analysis at the China Center for Type Culture Collection (Wuhan) and their presence of mycoplasma contamination was verified using a PCR detection kit (Shanghai Biothrive Sci). Cell lines were then cryopreserved in liquid nitrogen for subsequent experiments. All reagents and consumables used in this invention were commercially available or prepared using conventional methods. The experimental methods used in this invention, such as molecular biology and cell biology experiments, are conventional methods and techniques in the art.

[0040] Representative results from biological experiments were selected from replicates and presented in contextual figures, with data displayed as mean ± SD as specified in the figures. All experiments were repeated at least three times. Data were analyzed using GraphPad Prism 8.0. Differences between means of two or more groups were compared using t-tests or ANOVA. A p-value < 0.05 was considered statistically significant.

[0041] Example 1

[0042] First, an in vitro model of macrophages stimulated by abrasive particles was established. The specific steps are as follows:

[0043] (1) Under sterile conditions, femurs and tibias of 8-week-old male C57BL / 6J mice were isolated, and bone marrow cells were extracted. 10 ng / mL macrophage colony-stimulating factor was added to DMEM high-glucose medium containing 1% penicillin and 10% FBS, and the cells were cultured at a constant temperature of 37°C and 5% CO2 for 5-7 days to obtain mature mouse bone marrow-derived macrophages.

[0044] (2) Dilute the titanium particle solution (Alfa Aesar) with sterile water, filter it with Isopore membranes with pore sizes of 10 μm, 1.2 μm and 0.2 μm to obtain titanium particles in the range of 0.82±0.12 μm, and wash with 75% ethanol for 48 hours.

[0045] (3) After the ethanol has completely evaporated, the titanium particles were weighed and sterilized with ethylene oxide. The sterilization of the titanium particles was confirmed by assay of horseshoe crab cell lysates, and the particles were diluted with PBS to a concentration of 9 × 10⁻⁶. -3 A solution of titanium particles at a concentration of g / mL.

[0046] (4) At different time points, the titanium particles prepared in step (3) were used to stimulate macrophages derived from mouse bone marrow to establish an in vitro model of abrasive particles stimulating macrophages.

[0047] Macrophages derived from an in vitro model of wear-and-tear particle-stimulated macrophages were analyzed using circRNA high-throughput sequencing technology. The specific steps are as follows:

[0048] (1) Mouse bone marrow-derived macrophages were lysed with titanium particles for 4 hours using the Trizol kit, and total RNA was extracted. The quality and integrity of the RNA samples were assessed using an Agilent 2100 bioanalyzer.

[0049] (2) The sample was treated with RNase R to selectively degrade linear RNA while retaining closed circular RNA resistant to RNase R.

[0050] (3) After enzyme digestion, the RNA is washed using methods such as column purification or magnetic bead purification to ensure that purified circular RNA is obtained. Next, specific primers are added to the RNA fragments and reverse transcribed into cDNA. The cDNA is then end-repaired, poly(A) tails are added, and Illumina sequencing adapters are ligated.

[0051] (4) The cDNA was digested with uracil-N-glycosylation enzyme (UNG), and size selection was performed by agarose gel electrophoresis. PCR amplification was then performed to enrich the target fragment. High-throughput sequencing was then performed using Illumina HiSeq 4000. The sequencing data were strictly filtered to remove reads containing adapter sequences or with a quality value lower than 20 (Q value ≤ 20).

[0052] (4) Gene-level readouts of the mouse reference genome (GRCm38) were performed using MapSplice and HTSeq, and differentially expressed genes (DEGs) were screened using the R package with FDR < 0.05 and log2 (fold change) > 1 as criteria. Differentially expressed circRNAs were identified by volcano plot and heatmap analysis.

[0053] Subsequently, qPCR was used to detect the expression of circPDE5A in Ti particle-induced macrophages. The specific steps are as follows:

[0054] (1) Total RNA was extracted from Ti particle-stimulated macrophages using the RNAiso Plus kit (9109, TaKaRa Biotechnology) and the RNA concentration was measured.

[0055] (2) RNA was reverse transcribed into cDNA using the TaKaRa reverse transcription kit, and the expression of circPDE5A in Ti particle-stimulated mouse bone marrow macrophages at various time points was detected by qPCR using GAPDH as an internal control.

[0056] The primers used for circPDE5A and GAPDH are as follows:

[0057] circPDE5A-Forword: AGAAGTTGACCAAATTACAGGCT (SEQ ID NO: 3);

[0058] circPDE5A-Reverse: CCATGCATTGACCATTTCTCTCT (SEQ ID NO: 4);

[0059] GAPDH-Forword: TGTGTCCGTCGTGGATCTGA (SEQ ID NO: 5);

[0060] GAPDH-Reverse: TTGCTGTTGAAGTCGCAGGAG (SEQ ID NO: 6).

[0061] The volcano plot of gene expression results is shown below. Figure 1As shown. The results showed that circPDE5A was highly expressed in wear-particle-induced mouse bone marrow-derived macrophages; and that circPDE5A was highly expressed in titanium particle-induced mouse bone marrow-derived macrophages at different time points (see...). Figure 2 The above results suggest that circPDE5A is highly expressed in an in vitro model of macrophages stimulated by wear particles, indicating that circPDE5A is associated with the occurrence of wear particle-induced macrophage inflammatory responses.

[0062] Example 2

[0063] First, the ring formation of circPDE5A is checked. The specific steps are as follows:

[0064] (1) After extracting total RNA from BMDM macrophages, DNase I was first used to remove genomic DNA contamination. The RNA samples were divided into two groups: one group was treated with RNase R to selectively degrade linear RNA, and the other group was untreated as a control.

[0065] (2) After RNase R digestion, the RNA was purified to remove the enzyme and other small molecule interferences. Subsequently, the two groups of RNA were reverse transcribed into cDNA, and PCR amplification was performed using primers designed to detect the circPDE5A specific circular region.

[0066] (3) After amplification, the PCR products were separated by 2% agarose gel electrophoresis, and the nucleic acid bands were stained with ethidium bromide (EB) or other fluorescent dyes. The bands were observed under ultraviolet light. Circular RNA (circPDE5A), due to its specific circular structure, still showed obvious amplification bands after RNase R treatment, while the signal of linear RNA was significantly weakened or disappeared. By comparing the band intensity and position between the treated and untreated groups, the circularity of circPDE5A and the stability of its circular structure could be confirmed.

[0067] Subsequently, FISH technology was used to detect the expression of circPDE5A in the periprosthetic synovium of patients with aseptic loosening. The specific steps are as follows:

[0068] (1) The periprosthetic synovial tissue from aseptic loosening patients and the control group tissue were fixed with 4% paraformaldehyde for 12 hours, and then dehydrated with xylene to prepare paraffin-embedded blocks and sections.

[0069] (2) Synovial tissue sections were subjected to heating, dewaxing, and rehydration steps to restore their hydration state. Then, the sections were treated with proteinase K at room temperature for 15 minutes to enhance tissue permeability.

[0070] (3) The slides were hybridized with a 5'-DIG-labeled Neat1-specific probe at 37°C for 18 hours. After hybridization, the DIG-labeled probe was detected by immunostaining, using anti-DIG-POD antibody and streptavidin-HRP sequentially. The signal amplification step was performed using a tyramine signal amplification kit (TSA, Perkin Elmer, Waltham, PA), reacting for 15 minutes in the dark to enhance the fluorescence signal.

[0071] (4) The slides were counterstained with DAPI to mark the cell nuclei, and the images were observed and acquired using a confocal microscope.

[0072] Furthermore, the distribution of circPDE5A in Ti particle-induced macrophages was detected using immunofluorescence technology. The specific steps are as follows:

[0073] (1) Take 1×10 5 BMDM macrophages were seeded into confocal dishes and cultured in an incubator for 24 hours. Then, the corresponding stimulants were added according to different groups.

[0074] (2) After stimulation, the supernatant was discarded at the corresponding time point, and paraformaldehyde was added for fixation. After washing, 0.1% Triton X-100 was added to break the membrane and shaken slowly for 15 minutes.

[0075] (3) After washing three times with PBS, add blocking sheep serum to the dish and block for 30 min. Add the primary antibody to the confocal dish and incubate overnight at 4°C. On the second day, discard the primary antibody, wash with PBS, add 100 μl of the corresponding fluorescent secondary antibody, and incubate at room temperature for 1 h in the dark. Then discard the secondary antibody and wash three times with PBS.

[0076] (4) Add DAPI-containing anti-fluorescence quenching mounting medium and observe it under a confocal microscope.

[0077] Test results as follows Figure 3-5 As shown in the figure. The results show that, compared with the linear RNA control group, circPDE5A exhibits higher resistance to RNase R digestion, with a total length of 679 nt, and is located in exons 2 to 3 of the PDE5A gene (see Figure 1). Figure 3 FISH assay results showed that circPDE5A expression was elevated in the periprosthetic synovium of patients with aseptic loosening (see [link to FISH assay]). Figure 4 Immunofluorescence (IF) assays showed that circPDE5A was distributed in both the nucleus and cytoplasm (see [link to IF assay]). Figure 5The above results indicate that circPDE5A exhibits good circulatory stability and is highly expressed in the periprosthetic synovium of patients with aseptic loosening, suggesting that circPDE5A is associated with the occurrence of aseptic loosening.

[0078] Example 3

[0079] First, ELISA was used to detect the expression of inflammatory factors induced by Ti particles in macrophages after targeted overexpression / knockdown of circPDE5A. This included plasmids targeting overexpressing mice and siRNAs targeting knockdown mice (si-circPDE5A#1, sequence as shown in SEQ ID NO: 1, GGAAGAGAGAAATGGTCAA; si-circPDE5A#2, sequence as shown in SEQ ID NO: 2, AATCATAGGGAAGAGAGAA). Both plasmids were designed and constructed by GenePharma, and mock vectors and negative control siRNAs (NC) were used as controls. In validating the knockdown effect of siRNAs, si-circPDE5A#1 showed superior inhibitory effects; therefore, si-circPDE5A#1 was used for validation in subsequent experiments.

[0080] The specific steps for ELISA testing are as follows:

[0081] (1) 5×10 5 Mouse bone marrow-derived macrophages were seeded into six-well plates and cultured for 24 hours, and then cultured sequentially in Opti-MEMI reduced serum medium for 12 hours.

[0082] (2) Add 7.5 μL of Lipofectamine RNAiMAX transfection reagent to each well and transfect 200 pmol siRNA. Collect the culture supernatant of mouse bone marrow-derived macrophages that have been transfected with each group of plasmids after Ti particle stimulation, centrifuge and discard the fragments.

[0083] (3) The expression of inflammatory factors TNF-α and IL-1β was determined using an instant enzyme-linked immunosorbent assay (ELISA) kit.

[0084] Test results as follows Figure 6 As shown in the figure. The results showed that, compared with the control group, targeting and overexpressing circPDE5A promoted the production of inflammatory factors by Ti particles induced by macrophages, while knocking down circPDE5A with si-circPDE5A inhibited the production of inflammatory factors by Ti particles induced by macrophages.

[0085] Subsequently, RNA pull-down and protein mass spectrometry (MS) analysis were used to screen for differentially expressed proteins that bind to circPDE5A, and bioinformatics analysis was used to predict core regulatory genes. The specific steps are as follows:

[0086] (1) Total RNA was extracted from cells and purified, and then biotin-labeled circPDE5A probes were generated by in vitro transcription. Cell lysate was incubated with the labeled probes to capture protein complexes that bind to circPDE5A.

[0087] (2) By using pretreated streptavidin magnetic beads to bind biotin-labeled probes, non-specifically bound components are removed through multiple washes, and finally high-purity protein complexes are obtained.

[0088] (3) After extracting proteins from the complex, mass spectrometry (MS) was used to identify and quantify the proteins, and differentially expressed proteins binding to circPDE5A were screened. By integrating the functional information and molecular pathways of the differentially expressed proteins, combined with Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis, potential core regulatory genes and related signaling pathways were further predicted.

[0089] Test results as follows Figure 7 As shown in the figure. The results indicate that the biological processes most closely associated with these differentially expressed proteins are: macrophage activation involved in the immune response, cytokine response, and metabolic process. Among the differentially expressed proteins that bind to circPDE5A, LACC1 is a potential core regulatory gene in the macrophage inflammatory response activated by abrasive particles, and is closely related to immune response, inflammation, and cytokine expression.

[0090] Furthermore, qPCR and Western blotting were used to detect the expression of LACC1 after targeted overexpression / knockdown of circPDE5A. The specific steps of qPCR detection are as follows:

[0091] (1) A plasmid targeting mouse circPDE5A overexpression and a siRNA plasmid targeting mouse circPDE5A knockdown (si-circPDE5A#1) were constructed respectively, and a mock vector (Mock) and a negative control siRNA (NC) were used as controls respectively.

[0092] (2) Total RNA was extracted from Ti particle-stimulated macrophages using the RNAiso Plus kit and the RNA concentration was measured.

[0093] (3) RNA was reverse transcribed into cDNA using the TaKaRa reverse transcription kit, and LACC1 expression in Ti particle-stimulated mouse bone marrow-derived macrophages was detected by qPCR at various time points using GAPDH as an internal control.

[0094] The specific steps for WB detection are as follows:

[0095] (1) Add 5×10 to the 6-well plate 5 One BMDM cell was cultured for 24 hours and then RIPA buffer lysis buffer (containing 1% PMSF protease inhibitor and 1% phosphatase inhibitor) was added.

[0096] (2) Scrape off the cells with a cell scraper and transfer them to a 1.5 mL EP tube. Use the BCA protein quantification kit to detect the protein concentration. Take 75 μL of protein supernatant for Western blot analysis.

[0097] (3) Prepare stacking and separating gels. Add the sample to be tested to a 12-well polyacrylamide gel, adding 30 μg of sample to each well. After electrophoresis and transfer, block the PVDF membrane with 5% BSA solution and incubate with primary antibody overnight on a slow shaker at 4°C. After washing, incubate with secondary antibody solution on a slow shaker at room temperature for 1 hour. Finally, add ECL chemiluminescence reagent and set appropriate exposure conditions to detect protein expression.

[0098] Test results as follows Figure 8 As shown in the figure. The results showed that there was no significant change in the mRNA level of LACC1 in macrophages after targeting overexpression / knockdown of circPDE5A. However, compared with the control group, targeting overexpression / knockdown of circPDE5A negatively regulated the protein level of LACC1, indicating that it can directly act on the LACC1 protein.

[0099] Finally, ELISA technology was used to detect the downstream polyamine metabolism and inflammatory factor secretion levels after targeted overexpression / knockdown of LACC1. The specific steps are as follows:

[0100] (1) A plasmid targeting mouse circPDE5A overexpression and a siRNA plasmid targeting mouse circPDE5A knockdown (si-circPDE5A#1) were constructed respectively, and a mock vector (Mock) and a negative control siRNA (NC) were used as controls respectively.

[0101] (2) 5×10 5Mouse bone marrow-derived macrophages were seeded into six-well plates and cultured for 24 hours, and then cultured sequentially in Opti-MEMI reduced serum medium for 12 hours.

[0102] (3) Add 7.5 μl of Lipofectamine RNAiMAX transfection reagent to each well and transfect 200 pmol siRNA. Collect the culture supernatant of mouse bone marrow-derived macrophages that have been transfected with each group of plasmids after Ti particle stimulation, centrifuge and discard the fragments.

[0103] (4) The expression of polyamine metabolites spermidine (Spd) and spermine (Spm) and inflammatory factors TNF-α and IL-1β was determined using an instant enzyme-linked immunosorbent assay (ELISA) kit.

[0104] Test results as follows Figure 9 As shown in the figure. The results showed that overexpression / knockdown of LACC1 positively regulated the secretion levels of downstream spermidine (Spd) and spermine (Spm) induced by Ti particles in macrophages. Furthermore, targeted knockdown of LACC1 reversed the inhibitory effect of ornithine decarboxylase 1 (ODC1) overexpression on the secretion levels of pro-inflammatory factors TNF-α and IL-1β.

[0105] These results collectively demonstrate that targeted knockdown of circPDE5A can increase the expression of LACC1 protein, thereby increasing the level of ODC1-mediated polyamine metabolism, promoting the production of polyamine products, and thus alleviating the inflammatory response of macrophages.

[0106] Example 4

[0107] A mouse model of cranial osteolysis was constructed in vivo, and the alleviating effect of circPDE5A inhibition on Ti particle-induced osteolysis was analyzed using Micro-CT scanning and 3D reconstruction. The specific methods for constructing the mouse model of cranial osteolysis are as follows:

[0108] (1) Eight-week-old male mice were anesthetized with 10% chloral hydrate via intraperitoneal injection. After successful anesthesia, a 15 mm sagittal incision was made along the midline of the top of the skull to expose the skull. The periosteum of the top of the skull was then scraped with a nerve dissector, and a 0.5 × 0.5 × 0.3 cm... 3A gelatin sponge of the appropriate size was placed on the skull for the next specific injection. The Control group received a single injection of 100 μL PBS; the Ti group received a local injection of 3 mg titanium particles suspended in 100 μL PBS; the NC group received a local injection of 30 μL PBS, 3 mg titanium particles, and 70 μL of lentivirus as a negative control; and the si-circPDE5A group received a local injection of 30 μL PBS, 3 mg titanium particles, and 70 μL of si-circPDE5A (si-circPDE5A#1) lentivirus.

[0109] (2) No mice died or developed complications during the first 7 days after surgery. The mice were euthanized after 7 days, and their skulls were removed and all soft tissues were cleared for further analysis.

[0110] Mouse skulls were collected and thoroughly fixed with 4% paraformaldehyde for 48 hours, then scanned and analyzed using high-resolution small animal micro-CT and related software (ZZKS-MicroCT4.1). The micro-CT instrument parameters were set to 60kV and 667μA, and 3D image reconstruction was performed using reconstruction software.

[0111] Analysis results as follows Figure 10 As shown, the results indicated that titanium particles induced significant craniolysis in mice after micro-CT scanning and 3D reconstruction, and compared with the control group, lentiviral injection targeting circPDE5A significantly inhibited the titanium particle-induced craniolysis effect.

[0112] As can be clearly seen from the above, this invention performed high-throughput sequencing of circRNA in mouse bone marrow-derived macrophages stimulated by Ti particles, discovering and identifying significantly high expression of circPDE5A, and verifying its high expression around prostheses in patients with aseptic loosening, while also verifying its circulation effect. By detecting its expression in Ti particle-induced macrophages and around prostheses in patients with aseptic loosening, it was demonstrated that it is positively correlated with the occurrence of aseptic loosening. Furthermore, differentially expressed proteins binding to circPDE5A were screened using RNA pull-down assays and protein mass spectrometry (MS) analysis, predicting that LACC1 is a potential core regulatory gene in the macrophage inflammatory response activated by wear particles. circPDE5A can influence the regulation of the LACC1 signaling pathway through interaction with LACC1, thereby affecting the macrophage inflammatory response. Detection of its expression in Ti particle-induced macrophages and around prostheses in patients with aseptic loosening demonstrated its positive correlation with the occurrence of aseptic loosening. Furthermore, in vivo animal experiments using a mouse skull osteolysis model showed that lentiviral injection knocking down circPDE5A could alleviate Ti particle-induced osteolysis. In summary, this invention provides new ideas and a theoretical basis for drug development to treat aseptic loosening of artificial joints, and has significant clinical value and social significance.

[0113] The above detailed embodiments provide a specific description of the analytical methods involved in this invention. It should be noted that the above description is only intended to help those skilled in the art better understand the methods and ideas of this invention, and is not intended to limit the scope of the invention. Without departing from the principles of this invention, those skilled in the art can make appropriate adjustments or modifications to this invention, and such adjustments and modifications should also fall within the protection scope of this invention.

Claims

1. The application of circPDE5A inhibitors in the preparation of drugs for treating aseptic loosening of artificial joints, characterized in that, The circPDE5A inhibitor is selected from siRNA designed based on the circPDE5A gene; the sequence of the siRNA is shown in SEQ ID NO: 1.

Images