Application of reshaped cells to improvement of formaldehyde tolerance and bioavailability of mono-carbon compounds

By manipulating the bacterial cell division system and introducing methanol assimilation pathway, the problem of insufficient formaldehyde tolerance and utilization of one carbon compounds by microbial cells is solved, and the effect of significantly improving formaldehyde tolerance and utilization of one carbon compounds is achieved.

CN120210252APending Publication Date: 2025-06-27SHANGHAI JIAOTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510383176.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the tolerance of microbial cells to formaldehyde and the bioavailability of one-carbon compounds, resulting in the toxicity of formaldehyde hindering the effective assimilation of C1 raw materials.

Method used

By manipulating the cell division system of bacteria, cells with increased hardness can be obtained, formaldehyde tolerance is improved, and methanol assimilation pathway is introduced to improve the utilization ability of a carbon compound. Specific methods include using CRISPR gene editing technology to replace or knock out specific genes, such as mreB, frmA, rpiA, rpiB and cyaA, overexpressing the dynamic cytoskeleton protein mreB (A53R), and introducing the RuMP pathway.

Benefits of technology

The tolerance of recombinant bacteria to formaldehyde and the utilization ability of one-carbon compounds has been significantly improved, and more efficient methanol utilization and product synthesis have been achieved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210252A_ABST
    Figure CN120210252A_ABST
Patent Text Reader

Abstract

The invention discloses an application of a form-remodeled cell in improvement of formaldehyde tolerance and bioavailability of a monocarbon compound. Cells with enhanced cell hardness are obtained by regulating and controlling a cell division system of bacteria, and the regulation and control of the cell division system of the bacteria are realized by overexpressing a dynamic cytoskeleton protein mreB of which the 53rd amino acid is mutated into arginine and a homolog thereof, and / or inhibiting a genome in-situ point mreB and a homolog thereof. The damage caused by formaldehyde is effectively relieved, the tolerance of bacteria to formaldehyde is further improved, and the utilization capacity of all methylotrophic bacteria-carbon compounds capable of taking formaldehyde as a metabolic intermediate is improved based on the tolerance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, relates to the field of microbial synthetic biology, and specifically relates to the application of a cell with morphological remodeling in improving formaldehyde tolerance and the ability to utilize one-carbon compounds. Background Art

[0002] Constructing microbial cell factories to synthesize biological products from inexpensive substrates is a promising alternative to current petroleum-based production methods. In biomanufacturing, single-carbon feedstocks (including CO2, CO, methane, formate, and methanol) have attracted great attention and are considered the next-generation feedstocks due to their low cost and abundance.

[0003] Microbial cell factories should be economical and efficient production platforms. However, formaldehyde, as a metabolic central intermediate of most one-carbon compounds, its toxicity seriously hinders the effective assimilation of these C1 feedstocks. In nature, existing formaldehyde detoxification mechanisms involve oxidizing formaldehyde to non-toxic formate through glutathione-dependent or independent dehydrogenases. However, this detoxification strategy is counterproductive in the methylotrophic pathway where formaldehyde is a pathway substrate, as it leads to the waste of intermediates. Another potential strategy to cope with formaldehyde toxicity involves precise regulation of the enzymes responsible for its production and consumption. However, this complex flux regulation balancing act results in significant steady-state formaldehyde levels and potential peaks in response to a sudden increase in C1 unit availability. Therefore, it is imperative to study alternative mechanisms for cells to tolerate formaldehyde toxicity.

[0004] Morphological engineering has recently been proposed as a new strategy for constructing efficient microbial cell factories. By manipulating cell morphology-related genes, the morphological engineering strategy is applied to control cell division and cell morphology to improve intracellular product production. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides the application of a cell with morphological remodeling in improving formaldehyde tolerance and the ability to utilize one-carbon compounds. The present invention obtains cells with increased hardness by manipulating the bacterial cell division system, thereby improving formaldehyde tolerance. On this basis, by introducing a methanol assimilation pathway, the ability to utilize one-carbon compounds is enhanced.

[0006] Specifically, the present invention uses the CRISPR gene editing technology to replace the gene pta encoding phosphoacetyltransferase in the host bacterium MG1655(DE3) with the gene mreB(A53R) encoding a dynamic cytoskeletal protein with alanine at position 53 mutated to arginine, and uses the artificial promoter strategy to up-regulate the expression of mreB(A53R), wherein the artificial promoter element is M1-93; on the basis of the obtained bacterium, the CRISPR gene editing technology is used to continue knocking out the in-situ locus mreB (NCBI sequence NC_000913.3, gene number b3251) of the MG1655(DE3) genome to obtain a strain with increased cell hardness. On the basis of the increased cell hardness, the CRISPR gene editing technology is used to continue knocking out frmA, rpiA, rpiB, and cyaA to obtain a chassis cell for methanol utilization; the RuMP pathway is introduced into the chassis cell to construct a cell factory, and the formaldehyde tolerance and the ability to utilize one-carbon compounds of the obtained cell factory are significantly improved.

[0007] The object of the present invention is achieved by the following technical solutions:

[0008] <First aspect>:

[0009] Use of a cell with morphological remodeling in improving formaldehyde tolerance and the ability of one-carbon compounds to be biologically utilized; the cell with morphological remodeling is obtained by regulating the dynamic cytoskeletal protein mreB of bacteria.

[0010] The steps of regulating the dynamic cytoskeletal protein mreB of bacteria are to replace the gene pta encoding phosphoacetyltransferase in the host bacterium with the gene mreB(A53R) encoding a dynamic cytoskeletal protein with alanine at position 53 mutated to arginine and its homologs, and to knock out the in-situ locus mreB.

[0011] The nucleotide sequence of the gene encoding the dynamic cytoskeletal protein mreB is shown as any one of the sequences of SEQ ID NO.1-SEQ ID NO.16.

[0012] The nucleotide sequence of mreB(A53R) is shown as SEQ ID NO.17.

[0013] The host bacterium includes MG1655(DE3).

[0014] The nucleotide sequence of the gene pta encoding phosphoacetyltransferase is shown as SEQ ID NO.18.

[0015] <Second aspect>:

[0016] The present invention provides a recombinant Escherichia coli with improved formaldehyde tolerance and one-carbon compound utilization ability. The phosphotransacetylase gene pta in Escherichia coli is replaced with the dynamic cytoskeleton protein-encoding gene mreB(A53R) in which alanine at the 53rd position is mutated to arginine, and the obtained recombinant Escherichia coli is obtained.

[0017] The nucleotide sequence of the gene encoding phosphotransacetylase pta is shown in SEQ ID NO.18.

[0018] The Escherichia coli is E.coli MG1655(DE3).

[0019] The nucleotide sequence of the mreB(A53R) is as shown in SEQ ID NO.17

[0020] Overexpression of the dynamic cytoskeleton protein-encoding gene mreB(A53R) in which alanine at the 53rd position is mutated to arginine is to up-regulate the expression of mreB(A53R) through an artificial promoter element.

[0021] The artificial promoter element is M1-93; the nucleotide sequence of the M1-93 is shown in SEQ ID NO.19.

[0022] The artificial regulatory element M1-93 is operated through the CRISPR gene editing technology.

[0023] <Fourth aspect>:

[0024] The present invention provides a recombinant bacterium with morphological remodeling, which is obtained by knocking out the in-situ point mreB on the basis of the above-mentioned recombinant Escherichia coli.

[0025] The nucleotide sequence of the mreB is shown in any one of the sequences of SEQ ID SEQ ID NO.1-SEQ ID NO.16.

[0026] <Fifth aspect>:

[0027] The present invention provides a chassis cell for improving the utilization ability of one-carbon compounds, which is obtained by knocking out at least one of the frmA gene encoding formaldehyde dehydrogenase and the following genes on the basis of the above-mentioned recombinant bacterium with morphological remodeling:

[0028] The rpiA gene encoding ribose phosphate isomerase A;

[0029] The rpiB gene encoding ribose phosphate isomerase B;

[0030] The cyaA gene encoding adenylate cyclase.

[0031] The nucleotide sequence of the frmA gene encoding formaldehyde dehydrogenase is shown in SEQ ID NO.20; the nucleotide sequence of the rpiA gene encoding ribose phosphate isomerase A is shown in SEQ ID NO.21; the nucleotide sequence of the rpiB gene encoding ribose phosphate isomerase B is shown in SEQ ID NO.22, and the nucleotide sequence of the cyaA gene encoding adenylate cyclase is shown in SEQ ID NO.23.

[0032] As an embodiment of the present invention, the chassis cell is obtained by knocking out the frmA gene encoding formaldehyde dehydrogenase, rpiA encoding ribose phosphate isomerase A, rpiB gene encoding ribose phosphate isomerase B, and cyaA gene encoding adenylate cyclase on the basis of the morphologically remodeled recombinant bacterium.

[0033] Knocking out the relevant genes enables more carbon metabolic flux to flow from methanol to the TCA cycle, thereby further improving the utilization efficiency of methanol.

[0034] <Sixth aspect>:

[0035] The present invention provides a cell factory for improving the formaldehyde tolerance and the ability to utilize one-carbon compounds of recombinant bacteria, which is obtained by introducing the RuMP pathway into the chassis cell, including introducing the mdh gene from Cupriavidus necator, the hps gene and the phi gene from Bacillus methanolicus, and the nudF protein from Escherichia coli.

[0036] The nucleotide sequence of the mdh gene is shown in SEQ ID NO.24; the nucleotide sequence of the hps gene is shown in SEQ ID NO.25; the nucleotide sequence of the phi gene is shown in SEQ ID NO.26; the nucleotide sequence encoding the nudF protein is shown in SEQ ID NO.27.

[0037] The construction method of the cell factory as described above includes the following steps:

[0038] 1), Assemble the mdh gene from Cupriavidus necator, the hps and phi genes from Bacillus methanolicus, and the nudF protein from Escherichia coli into the pCDFduet-1 plasmid (purchased from novagen) to obtain the high-activity methanol utilization pathway plasmid pCDF-mdh-nudF-hps-phi, that is, the pCDF-RuMP plasmid;

[0039] 2), Transfer the pCDF-RuMP plasmid into the above-mentioned chassis cell to construct a cell factory for the utilization of one-carbon compounds.

[0040] As an embodiment of the present invention, a method for constructing a chassis cell for improving the utilization ability of one-carbon compounds comprises the following steps:

[0041] (1) Constructing pEcgRNA plasmid and Donor DNA: According to the gene pta to be replaced and the artificial regulatory elements (such as M1-93-mreB(A53R)) to be integrated, construct the corresponding pEcgRNA plasmid and Donor DNA;

[0042] (2) Using the two-step homologous recombination method to knockout the in-situ site mreB (gene number EG10608) of strain E, and the specific steps are as follows:

[0043] The first step of homologous recombination: Integrate the mreB-cat-sacB fragment into strain E by electrotransformation, and screen out positive clones; specifically as follows:

[0044] Step 1. Preparing electrotransformation competent cells of strain E:

[0045] Pick a single colony of strain E from an LB plate cultured at 37°C for 12 - 16 h, inoculate it into an LB test tube, and culture it overnight at 37°C, 220 rpm; Transfer it with an initial OD = 0.1 into 25 ml of LB liquid medium, and culture it at 37°C, 220 rpm until the OD 550 is about 0.3 or so, immediately ice-bath for 15 min; Transfer it into a sterilized 50 ml centrifuge tube, centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant, and suspend the precipitate with 10 ml of pre-cooled ddH2O; Centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant, and suspend the precipitate with 10 ml of pre-cooled ddH2O; Centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant, and suspend the precipitate with 10 ml of pre-cooled 10% glycerol; Aliquot 50 μl into sterilized EP tubes; Place it on ice for standby.

[0046] Step 2. Transformation of pKD46 plasmid:

[0047] a). Take 50 μl of the electrotransformation competent cells of strain E prepared in Step 1, add 1 μl of pKD46 plasmid, mix well and add it to the electroporation cuvette, ice-bath for 2 min, electroshock at 2.5 KV, immediately add 600 μl of LB medium after electrotransformation and mix well; Culture at 30°C, 220 rpm for 1 h; Take 100 μl and spread it on an LB + Amp plate, and culture it overnight at 30°C;

[0048] b). Add Amp (final concentration 100 μl / ml) and arabinose (final concentration 5%) to 30 ml of LB liquid medium respectively. After mixing and dissolving, filter and reserve. Pick 3 single colonies transformed with plasmid pKD46 from the overnight culture plate in step a) and inoculate them into 25 ml of LB medium (containing 100 μl / ml Amp and 5% filter-sterilized arabinose). Incubate at 37°C and 220 rpm for about 3 hours until OD 550 is about 0.3. Immediately place on ice bath for 15 min. Transfer to a sterilized 50 ml centrifuge tube, centrifuge at 4°C and 5000 rpm for 5 min. Discard the supernatant, add 5 ml of pre-cooled ddH2O to suspend the cells, then add 15 ml of pre-cooled ddH2O, centrifuge at 4°C and 5000 rpm for 5 min. Discard the supernatant, add 10 ml of pre-cooled ddH2O to suspend the cells, centrifuge at 4°C and 5000 rpm for 5 min. Discard the supernatant, add 10 ml of pre-cooled ddH2O to suspend the cells, centrifuge at 4°C and 5000 rpm for 5 min. Discard the supernatant, suspend the cells with the remaining liquid and place on ice;

[0049] c). Amplification of Cat-SacB fragment: Amplify the mreB-cat sacB fragment by PCR method. The template is the peasy-cat-sacB plasmid (purchased from Addgene). The primers are as follows:

[0050] mreB-cat sacB-up:

[0051] TCGTATCAGACCAGGCAGGGTAAACAGACACTTCCCCTGCCTGCATCCGA GCGTTGGCCGATTCATTASEQ ID NO.46

[0052] mreB-cat sacB-down:

[0053] AAGTAAGCGGATTTTCTTTTCCGCCCCAGCTTTCAGGATTATCCCTTAGTGGAGAAAATACCGCATCAGG SEQ ID NO.47

[0054] d). Transformation of the Cat-SacB fragment: Take 50 μl of the competent cells prepared in step b), add 2 μl of the mreB-Cat-SacB fragment, mix well and transfer to an electroporation cuvette. Incubate on ice for 2 min, then perform electroporation at 2.5 kV. Immediately after electroporation, add 1 ml of LB medium, mix well and transfer to a 15-ml test tube. Incubate at 30 °C with shaking at 220 rpm for 2 h. Centrifuge at 6000 rpm for 2 min and spread the cells on an LB plate (Amp Cm). Incubate at 30 °C. Pick monoclonal colonies for PCR identification, and use the correctly identified clones for the next experiment. The mreB-cat-sacB fragment is obtained by PCR amplification using mreB-cat-sacB-up / down as primers and the cat-sacB strain as the template. The cat-sacB strain is a strain into which the cat-sacB fragment has been transferred.

[0055] Second homologous recombination: Integrate the mreB (up + down) fragment into the strain by electroporation, and screen for the successfully knocked-out strain as follows:

[0056] Step 1. Preparation of competent cells

[0057] Add AMP (final concentration 100 μl / ml), Cm (final concentration 30 μl / ml), and arabinose (final concentration 5%) to 30 ml of LB liquid medium respectively. Mix well until dissolved, then filter and reserve. Pick a monoclonal colony transformed with the Cat-SacB fragment from the plate and inoculate it into the prepared medium. Incubate at 30 °C with shaking at 250 rpm for about 3 - 4 h until the OD 550 is about 0.3. Prepare competent cells according to the same operating steps as in the first homologous recombination.

[0058] Step 2. Electroporation of the mreB (up + down) fragment

[0059] Take 50 μl of the competent cells prepared in step 1, add 2 μl of the mreB (up + down) fragment, mix well and transfer to an electroporation cuvette. Incubate on ice for 2 min, then perform electroporation at 2.5 kV. Immediately after electroporation, add 1 ml of LB medium, mix well and transfer to a 15-ml test tube. Incubate at 30 °C with shaking at 220 rpm for 2 - 3 h.

[0060] Transfer the bacterial suspension to a 250-ml Erlenmeyer flask containing 50 ml of LB (salt-free, 10% sucrose) medium, and incubate at 37 °C with shaking (16 - 24 h). Streak on an LB (salt-free) medium plate containing 6% sucrose, and incubate statically at 39 °C. Pick monoclonal colonies and streak them on both LB and LB (Cm) plates for culture. Select the clones that cannot grow on the LB (Cm) plate for PCR verification.

[0061] The mreB(up+down) fragment is the left homologous arm (Left HA) + the right homologous arm (Right HA) of the gene (mreB) to be knocked out. The length of each homologous arm is generally between 400 and 600 bp, and the total is about 800 - 1200 bp. Specifically, the construction method of the mreB(up+down) fragment is as follows:

[0062] The amplification template of the mreB-up fragment is the Escherichia coli K-12 substr. MG1655(DE3) genome; the primers are as follows:

[0063] mreB-up-F: TGGTCAGAAACATTGAGAAGCG (SEQ ID NO.49)

[0064] mreB-up-R: CCCTGCCTGCATCCGAACTAAGGGATAATCCTGAAAGCTG (SEQ ID NO.50)

[0065] The amplification template of the mreB-down fragment is the Escherichia coli K-12 substr. MG1655(DE3) genome; the primers are as follows:

[0066] mreB-down-F: TCAGGATTATCCCTTAGTTCGGATGCAGGCAGGGGAAGTG (SEQ ID NO.51)

[0067] mreB-down-R: CAACAACACCTTTGTCGCTGA (SEQ ID NO.52)

[0068] The amplification primers of the mreB(up+down) fragment are as follows, and the template is the homologous recombination product of mreB-up and mreB-down; the primers are as follows:

[0069] mreB-up-F: TGGTCAGAAACATTGAGAAGCG (SEQ ID NO.49)

[0070] mreB-down-R: CAACAACACCTTTGTCGCTGA (SEQ ID NO.52);

[0071] (3) Transform the pEcgRNA plasmid and Donor DNA: Transform the pEcgRNA plasmid and Donor DNA in step (1) into the competent Escherichia coli containing the pEcCas plasmid by electroporation (other transformation methods in the prior art can also be used, such as chemical transformation); induce the transcription of sgRNA on the pEcCas plasmid, eliminate the pEcgRNA plasmid and screen out the strains with successful gene modification;

[0072] (4) Transform the pKD46 plasmid and the homologous recombination fragment mreB-cat-sacB fragment in step (2) into the strain obtained in step (3), and screen out the strains with successful recombination of the mreB-cat sacB fragment;

[0073] (5) Transform the homologous recombination fragment mreB(up+down) into the strain obtained in step (4), and screen out the strains with successful recombination of the mreB(up+down) fragment;

[0074] (6) Eliminate the pKD46 plasmid;

[0075] (7) Construct the corresponding pEcgRNA plasmid and Donor DNA according to the genes frmA, rpiA, rpiB to be knocked out;

[0076] (8) Transform the pEcgRNA plasmid and Donor DNA required for knocking out frmA in step (7) into the strain obtained in step (6) containing the pEcCas plasmid by electroporation; induce the transcription of sgRNA on the pEcCas plasmid, eliminate the pEcgRNA plasmid and screen out the strains with successful gene modification;

[0077] (9) Transform the pEcgRNA plasmid and Donor DNA required for knocking out rpiA in step (7) into the strain obtained in step (8), induce the transcription of sgRNA on the pEcCas plasmid, eliminate the pEcgRNA plasmid and screen out the strains with successful gene modification;

[0078] (10) Transform the pEcgRNA plasmid and Donor DNA required for knocking out rpiB in step (77) into the strain obtained in step (9), induce the transcription of sgRNA on the pEcCas plasmid, eliminate the pEcgRNA plasmid and screen out the strains with successful gene modification;

[0079] (11) Eliminate the pEcCas plasmid;

[0080] (12) Construct the corresponding FRT-Kan-FRT (FKF) fragment according to the gene cyaA to be knocked out;

[0081] (13) The step of transforming the FKF fragment into the strain obtained in step (11) containing the pKD46 plasmid by electroporation;

[0082] (14) Induce the transcription of the pKD46 plasmid and screen out the strains with successful gene modification;

[0083] (15) Eliminate the pKD46 plasmid to obtain the chassis cells for the utilization of one-carbon compounds.

[0084] As an embodiment of the present invention, in steps (3) and (4), the Escherichia coli competent cells containing the pEcCas plasmid and the pKD46 plasmid are obtained by transforming the plasmids pEcCas plasmid and pKD46 plasmid into Escherichia coli cells to obtain the recipient bacteria containing the pEcCas plasmid and the pKD46 plasmid.

[0085] In step (1), when constructing the Donor DNA, it is constructed by one-step homologous recombination integration according to the upstream and downstream homologous arms of the artificial regulatory element M1-93-mreB to be integrated, respectively with M1-93 and mreB.

[0086] In step (1), when constructing the pEcgRNA plasmid, according to the gene pta to be replaced, based on the Escherichia coli genome sequence published on NCBI, the sequence of phosphoacetyltransferase pta (Accession IDs: EG20173 (EcoCyc)) is found, and the cleavage site N20 (GCTGATTCCGCTGCGGCCTT, SEQ ID NO.98) is selected at the pta locus, and the whole plasmid PCR is carried out using the plasmid pEcgRNA as a template.

[0087] In step (3), the transformed is the pEcgRNA plasmid and Donor DNA according to the artificial regulatory element M1-93-mreB to be integrated as required.

[0088] In step (4), the transformed is the corresponding homologous recombination fragments mreB-cat sacB and mreB(up+down) constructed according to the gene mreB to be knocked out.

[0089] In step (7), when constructing the Donor DNA, it is constructed by one-step homologous recombination integration according to the upstream and downstream homologous arms of the gene to be knocked out.

[0090] In step (8), the transformed is the corresponding pEcgRNA plasmid and DonorDNA constructed according to the gene frmA to be knocked out;

[0091] In step (9), the transformed is the corresponding pEcgRNA plasmid and DonorDNA constructed according to the gene rpiA to be knocked out;

[0092] In step (10), the transformation is to construct the corresponding pEcgRNA plasmid and Donor DNA according to the gene rpiB to be knocked out.

[0093] As an embodiment of the present invention, L - arabinose induction is used in steps (3), (4), (8), (9), (10), and (14).

[0094] As an embodiment of the present invention, in steps (3), (8), (9), and (10), engineering bacteria are obtained by screening on a spectinomycin (final concentration 50 μg / mL) resistance plate and a kanamycin (final concentration 50 μg / mL) resistance plate; in step (14), engineering bacteria are obtained by screening on a carbenicillin (final concentration 50 μg / mL) and kanamycin (final concentration 50 μg / mL) resistance plate; in step (4), engineering bacteria are obtained by screening on a carbenicillin (final concentration 50 μg / mL) and chloramphenicol (final concentration 50 μg / mL) resistance plate; in step (5), engineering bacteria are obtained by screening on a chloramphenicol (final concentration 50 μg / mL) resistance plate.

[0095] As an embodiment of the present invention, in step (6), the strain constructed in step (5) is cultured overnight at 37°C without adding any antibiotics to eliminate the pEcCas plasmid; in steps (6) and (15), the strain constructed in step (14) is cultured overnight at 42°C without adding any antibiotics to eliminate the pKD46 plasmid.

[0096] The construction method of the said strain E includes the following steps:

[0097] 1. Transformation of the basic plasmid:

[0098] The basic plasmid pEcCas is transformed into Escherichia coli E.coli MG1655(DE3) by heat shock transformation to obtain the recipient bacterium E.coli MG1655(DE3) / pEcCas (strain A) containing the pEcCas plasmid.

[0099] 2. Preparation of electro - competent cells of the recipient bacterium:

[0100] Strain A is inoculated into a liquid LB medium containing kanamycin and cultured to the logarithmic phase; when cultured under specific conditions until the OD 550 is 0.2 - 0.3, an L - arabinose inducer is added to induce the expression of the λ - Red recombinase on pEcCas; when cultured until the OD 550 is 0.4 - 0.5, the culture is stopped, and electro - competent cells are prepared through centrifugation and resuspension steps.

[0101] 3. Construction of the plasmid and Donor DNA required for pta knockout:

[0102] Construct the pEcgRNA-pta knockout plasmid, design and synthesize specific primers for the pta gene, and obtain the knockout plasmid by PCR amplification;

[0103] Amplify the upstream and downstream homologous arms of pta knockout by PCR method to construct the Donor DNA-pta (fragment.

[0104] 4. Amplification of the M1-93-mreB(A53R) related fragment:

[0105] Amplify the upstream homologous arm, downstream homologous arm of mreB(A53R) replacement and the artificial regulatory element M1-93;

[0106] Obtain the mreB(A53R) fragment and its upstream and downstream homologous arms, as well as the regulatory sequence containing M1-93 by PCR amplification;

[0107] Perform homologous recombination on the above fragments to construct the Donor DNA-M1-93-mreB(A53R) fragment.

[0108] 5. Transformation of the plasmid and Donor DNA:

[0109] Co-transform the pEcgRNA-pta knockout plasmid and the Donor DNA-M1-93-mreB(A53R) fragment into the competent cells of strain A;

[0110] Use the CRISPR / Cas9 system for gene editing, and introduce the constructed plasmid and Donor DNA into the competent cells by electroporation; after recovery, coat them on the LB plate containing kanamycin and spectinomycin to screen for the gene-edited strain.

[0111] 6. Verification and plasmid elimination:

[0112] Pick the colonies grown on the plate and verify the correctness of gene editing by colony PCR;

[0113] Inoculate the strain with correct verification into the LB medium containing kanamycin, add rhamnose to induce the transcription of sgRNA on the plasmid pEcCas, and then perform plasmid elimination screening;

[0114] Pick the single colonies that grow on the kanamycin plate but not on the double-antibiotic plate to obtain the strain E (E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)) that has eliminated the pEcgRNA plasmid but retained the pEcCas plasmid.

[0115] In the present invention, the dynamic cytoskeletal protein MreB forms membrane-bound, anti-parallel double protofilaments, which are essential for determining the rod shape. Overexpression of MreB makes the cells shorter and wider, increases the integrity of the cell membrane, reduces the fluidity of the cell membrane, and enhances the formaldehyde tolerance of Escherichia coli.

[0116] The present invention also provides an application of the cell factory in using a one-carbon compound methanol.

[0117] Compared with the prior art, the present invention has the following beneficial effects:

[0118] 1. In the present invention, the CRISPR gene editing technology is used to overexpress the point-mutated Escherichia coli dynamic cytoskeletal protein MreB and knock out the in-situ point MreB, obtaining recombinant Escherichia coli with a reduced length-to-width ratio, effectively improving the formaldehyde tolerance of Escherichia coli.

[0119] 2. The strains E and F of the present invention have improved formaldehyde tolerance.

[0120] 3. The strains H, J, L, and N of the present invention have improved the utilization ability of one-carbon compounds. Description of the Drawings

[0121] By reading the following detailed description of the non-limiting embodiments with reference to the accompanying drawings, other features, objects, and advantages of the present invention will become more apparent:

[0122] Figure 1 Cell morphology of strains D and F;

[0123] Figure 2 Cell length, width, and aspect ratio of strains D and F;

[0124] Figure 3 Formaldehyde tolerance of strains D and F;

[0125] Figure 4 Tolerance of strains D and F to methanol, formic acid, and HMF;

[0126] Figure 5 Observation of cell hardness of strains D and F under 0 mM formaldehyde;

[0127] Figure 6 Observation of cell hardness of strains D and F under 6 mM formaldehyde;

[0128] Figure 7 Growth of strains M and N at different concentrations of methanol; where A is strain M and B is strain N;

[0129] Figure 8Growth, methanol consumption, and xylose consumption of strain M and strain N under 450 mM methanol; where A is strain M and B is strain N;

[0130] Figure 9 Growth, methanol consumption, and xylose consumption of strain M and strain N under 900 mM methanol; where A is strain M and B is strain N;

[0131] Figure 10 Growth, methanol consumption, and xylose consumption of strain N under 450 mM and 900 mM methanol in a baffled shake flask; where A is strain M and B is strain N;

[0132] Figure 11 Growth, methanol consumption, xylose consumption, and production of flaviolin of strain M and strain N under 450 mM methanol; where A is strain M and B is strain N;

[0133] Figure 12 Growth, methanol consumption, xylose consumption, and production of phloroglucinol of strain M and strain N under 450 mM methanol; where A is strain M and B is strain N; the left figure in C is strain M and the right figure in C is strain N;

[0134] Figure 13 Growth, methanol consumption, xylose consumption, and production of TAL of strain M and strain N under 450 mM methanol; where A is strain M and B is strain N; the left figure in C is strain M and the right figure in C is strain N,

[0135] Figure 14 Determination of ROS levels in strain D and strain F under different concentrations of formaldehyde;

[0136] Figure 15 Cell membrane integrity of strain D and strain F under 0 mM formaldehyde;

[0137] Figure 16 Cell membrane integrity of strain D and strain F under 6 mM formaldehyde. Detailed implementation manners

[0138] Combined with the embodiments below, the specific implementation manners of the present invention will be further described in detail. The following embodiments are used to illustrate the present invention and will help those skilled in the art to further understand the present invention, but are not used to limit the scope of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several changes and improvements can still be made. These all belong to the protection scope of the present invention.

[0139] The present invention provides an Escherichia coli that improves the formaldehyde tolerance of Escherichia coli and enhances the utilization of one-carbon compounds based on cell morphology remodeling, and its construction method and application; this Escherichia coli overexpresses the dynamic cytoskeletal protein mreB (A53R) in which alanine at the 53rd position is mutated to arginine, and knocks out the in-situ mreB, thereby comprehensively improving the formaldehyde tolerance and one-carbon compound utilization ability of Escherichia coli.

[0140] The recombinant bacterium of the present invention has the following characteristics:

[0141] A. Overexpress the dynamic cytoskeletal protein mreB (A53R) in which alanine at the 53rd position is mutated to arginine;

[0142] B. Knock out the in-situ mreB;

[0143] C. Introduce the RuMP pathway;

[0144] D. Different from previous transformations, this Escherichia coli significantly improves the formaldehyde tolerance and one-carbon compound utilization ability by reducing the cell length-width ratio.

[0145] Specifically, the Escherichia coli CRISPR system consists of two basic plasmids, pEcCas (purchased from addgene) and pEcgRNA (purchased from addgene);

[0146] Plasmid pEcCas: It is an Escherichia coli episomal plasmid, containing an L-arabinose-inducible expression Red recombinase element, the coding gene Cas9 of the Cas9 protein, the sgRNA used to induce the elimination of plasmid pTargetF, the kanamycin resistance gene KanR, etc.;

[0147] Plasmid pEcgRNA: It is an Escherichia coli episomal plasmid, containing the spectinomycin resistance gene aadA and the promoter pJ23119 for transcribing sgRNA.

[0148] According to the sequence of the target editing site, primers containing a 20-base sequence (N20) matching the target site were designed. Using the commercial pEcgRNA plasmid (purchased from addgene) as a template, the pEcgRNA plasmid backbone was obtained by PCR amplification. Then, the pEcgRNA plasmid backbone was self-cyclized using recombinase to obtain the target gene knockout plasmid. Secondly, the plasmid pEcCas was transformed into host cells to induce the expression of the λ-Red recombination system to prepare competent cells. Then, the knockout plasmid pEcgRNA and DonorDNA were transformed into the competent cells for gene editing and recombination, and the transformants were obtained by spreading and culturing, and the genomic recombination was verified by sequencing. Then, the plasmid repair system on the pEcCas plasmid in the strain was induced to work to shear the pEcgRNA knockout plasmid, completing one round of gene modification. By performing the above work in sequence, multiple gene loci in the host genome can be modified to achieve gene deletion or insertion. Finally, it was cultured at 37 °C to eliminate the pEcCas plasmid.

[0149] Table 1 Plasmids used in the present invention

[0150]

[0151]

[0152] Table 2 Strains used in the present invention

[0153]

[0154] Example 1 Construction of the E. coli MG1655(DE3) CRISPR system

[0155] 1. The basic plasmid pEcCas was transformed into Escherichia coli by heat shock transformation

[0156] Competent cells of Escherichia coli E. coli MG1655(DE3) were prepared, and the plasmid pEcCas was transformed into E. coli MG1655(DE3) by heat shock transformation to obtain the recipient bacterium E. coli MG1655(DE3) / pEcCas (strain A) containing the pEcCas plasmid.

[0157] 2. Preparation of electrocompetent recipient bacteria

[0158] a. The E. coli strain A was inoculated into a liquid LB medium (containing kanamycin at a final concentration of 50 μg / mL) and cultured at 37 °C and 220 rpm / min until the logarithmic phase.

[0159] b. Inoculate into a 50 mL Erlenmeyer flask containing 20 mL of LB medium (with a final kanamycin concentration of 50 μg / mL) at an inoculum size of 1% (v / v), and culture at 30 °C and 200 rpm / min until the OD 550 reaches 0.2 - 0.3. Then add an L - arabinose inducer with a final concentration of 10 mmol / L to fully express the λ - Red recombinase on pEcCas. Stop culturing (2 - 3 h) when the OD 550 reaches 0.4 - 0.5.

[0160] c. Transfer the culture broth into a 50 mL sterile centrifuge tube in a laminar flow hood and place it on ice for 15 min.

[0161] d. Centrifuge the bacterial suspension in the centrifuge tube at 4 °C and 6000 rpm for 10 min.

[0162] e. Discard the supernatant, add 20 mL of pre - cooled ddH2O, gently resuspend the cells, and centrifuge at 4 °C and 6000 rpm for 10 min; repeat the operation once again.

[0163] f. Discard the supernatant, add 20 mL of pre - cooled 10% glycerol, gently resuspend the cells, and centrifuge at 4 °C and 6000 rpm for 10 min.

[0164] e. Discard the supernatant, resuspend the cells in 5 mL of pre - cooled 10% glycerol, aliquot 50 - 80 μL of competent cells (competent cells of E. coli strain A) into 1.5 mL centrifuge tubes, and place them on ice for later use.

[0165] 3. Construction and transformation of pEcgRNA - pta plasmid and Donor DNA required for pta knockout

[0166] 3.1 Construction of pEcgRNA - pta knockout plasmid:

[0167] Design primers according to the upstream and downstream sequences of the E. coli pta gene. According to the E. coli genome sequence published on NCBI, find the sequence of phosphoacetyltransferase pta (Accession IDs: EG20173 (EcoCyc)). Select a cleavage site N20 (GCTGATTCCGCTGCGGCCTT, SEQ ID NO 98) at the pta locus, and design two - way amplification primers for pEcgRNA whole - plasmid PCR to obtain the pEcgRNA - pta knockout plasmid. The primers are as follows: pEcgRNA - pta - up:

[0168] GCTGATTCCGCTGCGGCCTTgttttagagctagaaatagcaag SEQ ID NO.30

[0169] pEcgRNA-pta-down:

[0170] AAGGCCGCAGCGGAATCAGCactagtattatacctaggactg SEQ ID NO.31。

[0171] 3.2. Construction of Donor DNA-pta Fragment

[0172] The upstream and downstream homologous arms of pta knockout were amplified by PCR:

[0173] a. Amplification of the upstream homologous arm of pta knockout

[0174] The template was the genome of Escherichia coli K-12 substr. MG1655(DE3) (NCBI accession number: ASM584v2); the primers were:

[0175] pta-L up1: TGAGCGTTGACGCAATCA SEQ ID NO.28

[0176] pta-L-ko down: AGCTGCGGATGATGACGAGAGGTTTATCCTCTTTCGTTACCG SEQ ID NO.32。

[0177] b. Amplification of the downstream homologous arm of pta knockout; the template was the genome of Escherichia coli K-12 substr. MG1655(DE3); the primers were:

[0178] pta-R-up1: TCTCGTCATCATCCGCAG SEQ ID NO.33

[0179] pta-R-down: GATCCTGAGGTTAATCCTTCAAA SEQ ID NO.34。

[0180] c. Amplification of the Donor DNA-pta fragment for pta knockout (SEQ ID NO.35), with the template being the recombinant fragment of the upstream homologous arm of pta knockout in step a and the downstream homologous arm in the above step b; the primers were:

[0181] pta-L-up2: TGACCAAAGAGTCTGGCCT SEQ ID NO.36

[0182] pta-R-down2: GTCGTGAACAGCTGTACGC SEQ ID NO.37。

[0183] 3.3 Transformation of pEcgRNA-pta plasmid and Donor DNA-pta

[0184] a. Add the Donor DNA-pta and pEcgRNA-pta to be transformed into the competent cells of E. coli strain A prepared in the above step 2, mix well, and place on ice for 30 min;

[0185] b. Transfer the mixture into a pre-cooled 2 mm electroporation cuvette, place on ice for at least 2 min, and wait for electroporation;

[0186] c. Turn on the electroporator and set the parameters to 2.5 kV;

[0187] d. Take out the electroporation cuvette from the ice, absorb the moisture on the surface with a tissue, and place it in the sample chamber for electroporation. Immediately after electroporation, add room temperature LB medium to resuspend the cells, recover at 37 °C for 2 h, coat the LB plate containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin, and culture overnight at 37 °C;

[0188] e. Pick the colonies grown on the plate and perform colony PCR verification using the verification primers (for the editing of the pta locus, the verification primers are pta-L-up1: TGAGCGTTGACGCAATCA SEQ ID NO.28; pta-R-down1: GATCCTGAGGTTAATCCTTCAAA SEQ ID NO.29) to obtain the correct gene-edited strain (MG1655(DE3)Δpta / pEcgRNA-pta / pEcCas; knockout gene pta), that is, strain B.

[0189] 4 Elimination of pEcgRNA plasmid

[0190] a. Inoculate strain B into 5 mL LB medium (containing kanamycin at a final concentration of 50 μg / mL), add rhamnose at a final concentration of 10 mM to induce the transcription of sgRNA on the plasmid pEcCas, culture at 37 °C for 12 - 16 hours, and dip an inoculation loop into an appropriate amount of bacterial liquid and streak on the LB plate containing kanamycin at a final concentration of 50 μg / mL;

[0191] b. Pick 20 - 30 isolated single colonies and spot them one by one on the plate containing kanamycin at a final concentration of 50 μg / mL, the plate containing kanamycin at a final concentration of 50 μg / mL, and the double-antibiotic plate containing 50 μg / mL spectinomycin. The plates are cultured at 37 °C. Pick the single colonies that do not grow on the double-antibiotic plate but grow on the kanamycin plate for amplification and preservation. This single colony is strain C (MG1655(DE3)Δpta / pEcCas) that has eliminated the pEcgRNA plasmid but retained the pEcCas plasmid.

[0192] Example 2: Construction of E. coli MG1655(DE3)Δpta (strain D) and E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R) (strain E)

[0193] 1. Construction of pEcgRNA-pta knockout plasmid (see step 3 of Example 1)

[0194] 2. Amplification of pta knockout-related fragments (see step 3 of Example 1)

[0195] 3. Amplification of M1-93-mreB(A53R)-related fragments

[0196] The upstream homologous arm, downstream homologous arm, and artificial regulatory elements M1-93 and mreB(A53R) for M1-93-mreB(A53R) replacement were amplified by PCR as follows:

[0197] a) Amplification of the upstream homologous arm for mreB(A53R) replacement, with the template being the Escherichia coli K-12 substr.

[0198] MG1655(DE3) genome; the primers were:

[0199] pta-L-up1: TGAGCGTTGACGCAATCA SEQ ID NO.28

[0200] pta-L-down: GGTTTATCCTCTTTCGTTACCG SEQ ID NO.34;

[0201] b) Amplification of the artificial regulatory element M1-93, with the template being the synthesized M1-93 sequence (GenScript Biotech Corporation), and the sequence was referenced from the literature (Wenbo Hu et al, 2023); the primers were:

[0202] M1-mreB(A53R)-up: GTAACGAAAGAGGATAAACCTTATCTCTGGCGGTGTTG SEQ ID NO.39

[0203] M1-mreB(A53R)-down: ATGCCACGAAATTTTTTCAAcatAGCTGTTTCCTGGTTTAAAC SEQ IDNO.40; c) Amplification of the mreB(A53R) fragment, with the template being pCDF-mreB(A53R) SEQ ID NO.41; the primers were:

[0204] mreB-up: GTTTAAACCAGGAAACAGCTatgTTGAAAAAATTTCGTGG SEQ ID NO.42

[0205] mreB-down: AGCTGCGGATGATGACGAGAttaCTCTTCGCTGAACAGGT SEQ ID NO.43;

[0206] d) Amplify the downstream homologous arm for mreB(A53R) replacement, with the template being Escherichia coli K-12 substr.

[0207] MG1655(DE3) genome; the primers are:

[0208] pta-R up: TCTCGTCATCATCCGCAG SEQ ID NO.44

[0209] pta-R down1: GATCCTGAGGTTAATCCTTCAAA SEQ ID NO.34;

[0210] h) Amplify the Donor DNA-M1-93-mreB(A53R) (the sequence is SEQ ID NO.54) fragment, with the template being the homologous recombination product of the above fragment (Donor DNA-pta fragment 5-mreB(A53R) replacement of the upstream homologous arm-M1-93-mreB(A53R) fragment-mreB(A53R) replacement of the downstream homologous arm):

[0211] pta-L up2: TGACCAAAGAGTCTGGCCT SEQ ID NO.36

[0212] pta-R down2: GTCGTGAACAGCTGTACGC SEQ ID NO.37;

[0213] Homologous recombination and transformation

[0214] Use the one-step homologous recombination technique to recombine the upstream and downstream homologous arms for pta knockout, as well as the upstream and downstream homologous arms for mreB(A53R) replacement and M1-93; then perform a round of PCR amplification to recover the target fragment, obtaining DonorDNA-pta and DonorDNA-M1-93-mreB(A53R) respectively.

[0215] Subsequently, the pEcgRNA-pta knockout plasmid was co-transformed with the DonorDNA-pta fragment or the pEcgRNA-pta knockout plasmid was co-transformed with the DonorDNA-M1-93-mreB(A53R) fragment into E. coli strain A respectively. The gene knockout or replacement was completed using the CRISPR technology, and the control strain E. coli MG1655(DE3)Δpta that successfully knocked out pta, namely strain D, or the engineered strain E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R) that replaced the artificial element M1-93-mreB(A53R), namely strain E, was screened. The specific transformation steps were the same as those in Example 1.

[0216] Example 3 Construction of E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreB strain (strain F)

[0217] Knock out the expression of the mreB(EG10608(EcoCyc)) gene at the in-situ locus of the E. coli MG1655(DE3) genome by the λ-Red two-step recombination method:

[0218] 1. First-step homologous recombination: Integrate the mreB-cat-sacB fragment into strain E by electroporation and screen for positive clones; specifically as follows:

[0219] Step 1. Prepare electrocompetent cells of strain E:

[0220] Pick a single colony of strain E from an LB plate cultured at 37°C for 12 - 16 h, inoculate it into an LB test tube, and culture it overnight at 37°C, 220 rpm; transfer it with an initial OD 550 = 0.1 into 25 ml of LB liquid medium, and culture it at 37°C, 220 rpm until the OD 550 is about 0.3 or so, and immediately ice-bath for 15 min; transfer it into a sterilized 50 ml centrifuge tube, centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant, suspend the precipitate with 10 ml of pre-cooled ddH2O; centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant, suspend the precipitate with 10 ml of pre-cooled ddH2O; centrifuge at 4°C, 5000 rpm for 5 min, discard the supernatant, suspend the precipitate with 10 ml of pre-cooled 10% glycerol; aliquot 50 μl into sterilized EP tubes; place on ice for standby.

[0221] 2) Transformation of pKD46 plasmid:

[0222] a). Take 50 μl of the competent cells of strain E prepared in step 1, add 1 μl of pKD46 plasmid, mix well, add to an electroporation cuvette, incubate on ice for 2 min, perform electroporation at 2.5 KV, immediately add 600 μl of LB medium after electroporation and mix well; culture at 30 °C and 220 rpm for 1 h; take 100 μl and spread on an LB + Amp plate, culture overnight at 30 °C;

[0223] b). Add Amp (final concentration 100 μl / ml) and arabinose (final concentration 5%) to 30 ml of LB liquid medium respectively, mix and dissolve, then filter and reserve; Pick 3 single colonies transformed with plasmid pKD46 from the plate cultured overnight in step a), inoculate into 25 ml of LB medium (containing 100 μl / ml of Amp and 5% filter-sterilized arabinose), culture at 37 °C and 220 rpm for about 3 hours until OD 550 is about 0.3, immediately incubate on ice for 15 min; Transfer to a sterilized 50 ml centrifuge tube, centrifuge at 4 °C and 5000 rpm for 5 min; Discard the supernatant, add 5 ml of pre-cooled ddH2O to suspend the cells, then add 15 ml of pre-cooled ddH2O, centrifuge at 4 °C and 5000 rpm for 5 min; Discard the supernatant, add 10 ml of pre-cooled ddH2O to suspend the cells, centrifuge at 4 °C and 5000 rpm for 5 min; Discard the supernatant, add 10 ml of pre-cooled ddH2O to suspend the cells, centrifuge at 4 °C and 5000 rpm for 5 min; Discard the supernatant, suspend the cells with the remaining liquid, and place on ice;

[0224] c). Amplification of the Cat-SacB fragment: Amplify the mreB-cat sacB fragment by PCR method, with the peasy-cat-sacB plasmid (purchased from Addgene) as the template, and the primers are as follows:

[0225] mreB-cat sacB-up:

[0226] TCGTATCAGACCAGGCAGGGTAAACAGACACTTCCCCTGCCTGCATCCGA GCGTTGGCCGATTCATTASEQ ID NO.46

[0227] mreB-cat sacB-down:

[0228] AAGTAAGCGGATTTTCTTTTCCGCCCCAGCTTTCAGGATTATCCCTTAGTGGAGAAAATACCGCATCAGG SEQ ID NO.47;

[0229] d). Transformation of the Cat-SacB fragment: Take 50 μl of the competent cells prepared in step b), add 2 μl of the mreB-Cat-SacB fragment, mix well and add to the electroporation cuvette. Incubate on ice for 2 min, then perform electroporation at 2.5 KV. Immediately after electroporation, add 1 ml of LB medium, mix well and transfer to a 15 ml test tube. Incubate at 30 °C and 220 rpm for 2 h. Centrifuge at 6000 rpm for 2 min and spread on an LB plate (Amp Cm). Incubate at 30 °C. Pick monoclonal colonies for PCR identification, and use the correctly identified clones for the next experiment.

[0230] The second homologous recombination: Integrate the mreB(up+down) fragment into the strain E / pKD46 / cat-sacB by electroporation, and screen out the strains with successful knockout, as follows:

[0231] Step 1. Preparation of competent cells of the strain E / pKD46 / cat-sacB

[0232] Add AMP (final concentration 100 μl / ml), Cm (final concentration 30 μl / ml), and arabinose (final concentration 5%) to 30 ml of LB liquid medium respectively. Mix well until dissolved and filter for standby. Pick the monoclonal colonies transformed with the cat-sacB fragment from the plate, i.e., the strain E / pKD46 / cat-sacB, and inoculate it into the prepared medium. Incubate at 30 °C and 250 rpm for about 3 - 4 h until OD 550 is about 0.3; Prepare competent cells according to the same operation steps as in the first homologous recombination.

[0233] Step 2. Obtaining of the recombinant fragment mreB(up+down)

[0234] The mreB(up+down) fragment is the left homologous arm (Left HA) + right homologous arm (Right HA) of the gene to be knocked out (mreB). The length of each homologous arm is generally between 400 and 600 bp, and the total is about 800 - 1200 bp. Specifically, the construction method of the mreB(up+down) fragment is as follows:

[0235] The amplification template of the mreB-up fragment is the genome of Escherichia coli K-12substr.MG1655(DE3); The primers are as follows:

[0236] mreB-up-F: TGGTCAGAAACATTGAGAAGCG (SEQ ID NO.49)

[0237] mreB-up-R: CCCTGCCTGCATCCGAACTAAGGGATAATCCTGAAAGCTG (SEQ ID NO.50);

[0238] The template for amplifying the mreB-down fragment is the genome of Escherichia coli K-12 substr. MG1655(DE3); The primers are as follows:

[0239] mreB-down-F: TCAGGATTATCCCTTAGTTCGGATGCAGGCAGGGGAAGTG (SEQ ID NO.51)

[0240] mreB-down-R: CAACAACACCTTTGTCGCTGA (SEQ ID NO.52);

[0241] The primers for amplifying the mreB(up+down) fragment are as follows, and the template is the homologous recombination product of mreB-up and mreB-down; The primers are as follows:

[0242] mreB-up-F: TGGTCAGAAACATTGAGAAGCG (SEQ ID NO.49)

[0243] mreB-down-R: CAACAACACCTTTGTCGCTGA (SEQ ID NO.52);

[0244] Step 3. Electroporation of the mreB(up+down) fragment

[0245] Take 50 μl of the competent cells prepared in Step 1, add 2 μl of the mreB(up+down) fragment in Step 2, mix well and add it to the electroporation cuvette, ice-bath for 2 min, electroporate at 2.5 KV, immediately add 1 ml of LB medium after electroporation, mix well and transfer it to a 15 ml test tube; Culture at 30 °C and 220 rpm for 2 - 3 h;

[0246] Transfer the bacterial solution to a 250 ml Erlenmeyer flask containing 50 ml of LB (salt-free, 10% sucrose) medium, culture with shaking at 37 °C (16 - 24 h); Streak on an LB (salt-free) medium plate containing 6% sucrose, culture statically at 39 °C; Pick single colonies and streak them on both LB and LB(Cm) plates, select the colonies that cannot grow on the LB(Cm) plate for PCR verification.

[0247] Step 4. Removal of the pKD46 plasmid and screening of positive clones

[0248] Transfer the bacterial solution into a 250 ml Erlenmeyer flask containing 50 ml of LB (salt-free, 10% sucrose) medium and culture it with shaking at 37 °C for (16 - 24 h);

[0249] Streak on an LB (salt-free) medium plate containing 6% sucrose and culture it statically at 39 °C;

[0250] Pick monoclonal colonies and streak them on both LB and LB (Cm) plates for culture. Select the colonies that cannot grow on the LB (Cm) plate for PCR verification.

[0251] Example 4: Construction of E. coli MG1655(DE3)ΔptaΔfrmA (strain G) and E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreBΔfrmA strain (strain H)

[0252] 1. Construction of pEcgRNA-frmA knockout plasmid

[0253] Design primers according to the upstream and downstream sequences of the E. coli frmA gene. According to the E. coli genome sequence published on NCBI, find the formaldehyde dehydrogenase (Accession IDs: EG50010 (EcoCyc) sequence. Select the cleavage site N20 (CGTAGTCGCGGAAGTGTCTC SEQ ID NO.99) in this sequence and design the bidirectional amplification primers for pEcgRNA whole plasmid PCR to obtain the pEcgRNA-frmA knockout plasmid. Among them, the primers are as follows: pEcgRNA-frmA-up:

[0254] CGTAGTCGCGGAAGTGTCTCgttttagagctagaaatagcaa SEQ ID NO.54

[0255] pEcgRNA-frmA-down:

[0256] GAGACACTTCCGCGACTACGactagtattatacctaggactg SEQ ID NO.55;

[0257] 2. Amplify the upstream and downstream homologous arms for frmA knockout by PCR. The primers are as follows:

[0258] a) Primers for amplifying the upstream homologous arm for frmA knockout, with the template being the Escherichia coli K-12 substr. MG1655(DE3) genome:

[0259] frmA-L up: AGCTCGTTGCGGATATAGT SEQ ID NO.56

[0260] frmA-L down: ATATTGAGGAAGAGCGAGAGTTTCCCGCAGGTTTACCCC SEQ ID NO.57

[0261] b) Primers for amplifying the downstream homologous arm of frmA knockout, with the template being the genome of Escherichia coli K-12 substr. MG1655(DE3):

[0262] frmA-R-up: CTCTCGCTCTTCCTCAATATG SEQ ID NO.58 frmA-R-down: CCCTTTCCTCTTTGTTTTCCG SEQ ID NO.59

[0263] c) Amplifying the Donor DNA-frmA fragment for frmA knockout (the sequence is SEQ ID NO.60), with the template being the recombinant fragment of the upstream and downstream homologous arms of frmA knockout

[0264] frmA-L-up: AGCTCGTTGCGGATATAGT SEQ ID NO.56

[0265] frmA-R-down: CCCTTTCCTCTTTGTTTTCCG SEQ ID NO.59

[0266] The pEcgRNA-frmA knockout plasmid and the Donor DNA-frmA (SEQ ID NO.60) fragment were co-transformed into strains D and F respectively. The gene knockout was completed using the CRISPR technology, and the control bacterium MG1655(DE3)ΔptaΔfrmA, namely strain G, and the engineered bacterium E.coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreBΔfrmA, namely strain H, which had successfully knocked out frmA, were screened. The specific transformation steps were the same as in Example 1.

[0267] Example 5: Construction of E.coli MG1655(DE3)ΔptaΔfrmAΔrpiA strain (strain I) and E.coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreBΔfrmAΔrpiA strain (strain J)

[0268] 1. Construction of the pEcgRNA-rpiA knockout plasmid

[0269] Primers were designed according to the upstream and downstream sequences of the rpiA gene in Escherichia coli. Based on the Escherichia coli genomic sequence published on NCBI, the ribose-5-phosphate isomerase A (Accession IDs: EG111443 (EcoCyc) sequence) was found. The cleavage site N20 (CGCGTCAATAAAGTGTGCGG, SEQ ID NO.100) was selected from this sequence, and bidirectional amplification primers for pEcgRNA whole plasmid PCR were designed to obtain the pEcgRNA-rpiA knockout plasmid. The primers are as follows:

[0270] pEcgRNA-rpiA-up:

[0271] CGCGTCAATAAAGTGTGCGGGTTTTAGAGCTAGAAATAGCAAG SEQ ID NO.61pEcgRNA-rpiA-down:

[0272] CCGCACACTTTATTGACGCGACTAGTATTATACCTAGGACTGAG SEQ ID NO.62

[0273] 2. The upstream and downstream homologous arms of the rpiA knockout were amplified by PCR. The primers are as follows:

[0274] a) Primers for amplifying the upstream homologous arm of the rpiA knockout, with the template being the Escherichia coli K-12 substr. MG1655(DE3) genome:

[0275] rpiA-L up:CTGCCCGAACATATTTTCCAG SEQ ID NO.63rpiA-L down:CGGGGGAGGTTCCCCCGTCAGAGATCGTTTCGCCTGTGGTAT SEQ ID NO.64

[0276] b) Primers for amplifying the downstream homologous arm of the rpiA knockout, with the template being the Escherichia coli K-12 substr. MG1655(DE3) genome:

[0277] rpiA-R-up:TCTGACGGGGGAACCTCCCCCGTTA SEQ ID NO.65rpiA-R-down:GCCGATGATACCCAGCTTTTTG SEQ ID NO.66

[0278] c) Amplify the rpiA knockout Donor DNA-rpiA fragment (SEQ ID NO.75) using the recombinant fragment of the upstream and downstream homologous arms of the above rpiA knockout as the template.

[0279] rpiA-L-up: CTGCCCGAACATATTTTCCAG SEQ ID NO.63 rpiA-R-down: GCCGATGATACCCAGCTTTTTG SEQ ID NO.66

[0280] Co-transform the pEcgRNA-rpiA knockout plasmid and the Donor DNA-rpiA (SEQ ID NO.67) fragment into E. coli strains G and H containing the pEcCas plasmid respectively. Use the CRISP technology to complete gene knockout, and screen to obtain the control bacterium MG1655(DE3)ΔptaΔfrmAΔrpiA, namely strain I, and the engineered bacterium E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreBΔfrmAΔrpiA, namely strain J. The specific transformation steps are the same as in Example 1.

[0281] Example 6: Construction of E. coli MG1655(DE3)ΔptaΔfrmAΔrpiAΔrpiB strain (strain K) and E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreBΔfrmAΔrpiAΔrpiB strain (strain L)

[0282] 1. Construction of pEcgRNA-rpiB knockout plasmid

[0283] Design primers according to the upstream and downstream sequences of the E. coli rpiB gene. According to the E. coli genome sequence published on NCBI, find the ribose-5-phosphate isomerase B (Accession IDs: EG11827 (EcoCyc) sequence. Select the cleavage site N20 (AAGTGATTGATAAAGGAACC, SEQ ID NO.101) in this sequence, and design the bidirectional amplification primers for pEcgRNA whole plasmid PCR to obtain the pEcgRNA-rpiB knockout plasmid. Among them, the primers are as follows:

[0284] pEcgRNA-rpiB-up:

[0285] AAGTGATTGATAAAGGAACCGTTTTAGAGCTAGAAATAGCAAGT SEQ ID NO.68 pEcgRNA-rpiB-down:

[0286] GGTTCCTTTATCAATCACTTACTAGTATTATACCTAGGACTGAG SEQ ID NO.69

[0287] 2. The upstream and downstream homologous arms of rpiB knockout were amplified by PCR, and the primers are as follows:

[0288] a) Primers for amplifying the upstream homologous arm of rpiB knockout, with the template being the Escherichia coli K-12 substr. MG1655(DE3) genome:

[0289] rpiB-L up: GGGTGCACAACTCAGGTTAC SEQ ID NO.70

[0290] rpiB-L down: CCGTCCGTGCAAAACTTCAC SEQ ID NO.71

[0291] b) Primers for amplifying the downstream homologous arm of rpiB knockout, with the template being the Escherichia coli K-12 substr. MG1655(DE3) genome:

[0292] rpiB-R-up: GTTTTGCACGGACGGGGAAGATGAGATTCATCCACTACTTGCAT SEQ ID NO.72

[0293] rpiB-R-down: CCTAACCCTCTCCCCAGAGG SEQ ID NO.73

[0294] c) Primers for amplifying the Donor DNA-rpiB fragment of rpiB knockout (the sequence is SEQ ID NO.82), with the template being the recombinant fragment of the upstream and downstream homologous arms of rpiB knockout;

[0295] rpiB-L-up: GGGTGCACAACTCAGGTTAC SEQ ID NO.70 rpiB-R-down: CCTAACCCTCTCCCCAGAGG SEQ ID NO.73

[0296] The pEcgRNA-rpiB knockout plasmid and the Donor DNA-rpiB (SEQ ID NO.74) fragment were co-transformed into strains I and J respectively. The CRISP technology was used to complete gene knockout, and the control strain MG1655(DE3)ΔptaΔfrmAΔrpiAΔrpiB, namely strain K, and the engineered strain E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreBΔfrmAΔrpiAΔrpiB, namely strain L, which had successfully knocked out rpiB, were screened. The specific transformation steps were the same as those in Example 1.

[0297] Example 7: Construction of E. coli MG1655(DE3)ΔptaΔfrmAΔrpiAΔrpiBΔcyaA strain (strain M) and E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreBΔfrmAΔrpiAΔrpiBΔcyaA strain (strain N)

[0298] Knock out the expression of the cyaA gene by the λ-Red one-step recombination method:

[0299] a), First, the pKD46 plasmid was chemically transformed into strains K and L constructed in Example 6 respectively. Single colonies were picked and transferred into liquid LB medium, and cultured at 30 °C and 220 rpm until OD 550 ~0.3. After placing on ice for 30 min, centrifuged at 6000 rpm at 4 °C for 5 min to prepare electrocompetent cells of strains K and L.

[0300] b), Construct the recombinant fragment FKF::cyaA (SEQ ID NO.85);

[0301] The recombinant fragment FKF::cyaA was obtained by PCR amplification and recovery of the target fragment. The template was the pKD4 plasmid (purchased from Beijing Huayueyang Biotechnology), and the primers were as follows:

[0302] cyaA-up: CAGGCGATACGTCTTGTACCTCTATATTGAGACTCTGAAACAGAGACTGGATGCCATAAATCAAGGAACACTTAACGGCTGAC (SEQ ID NO.75)

[0303] cyaA-down: CTTTCCGGCACGTTCATCACGAAAAATATTGCTGTAATAGCGGCGTATCGTGA TCCTGATTGGCAGGTCTTGAGCGATTGTGTAGG (SEQ ID NO.76);

[0304] c) The constructed recombinant fragment FKF::cyaA (SEQ ID NO.77) was electrotransformed into the competent cells of strain K and strain L in step a), and the transformants were obtained by culturing at 30°C; the purpose of knocking out cyaA was achieved by one-step recombination on the chromosome. The temperature-sensitive plasmid pKD46 was eliminated by induction at 37°C to obtain the control strain E. coli MG1655(DE3)ΔptaΔfrmAΔrpiAΔrpiBΔcyaA, namely strain M, and the corresponding engineered strain E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreBΔfrmAΔrpiAΔrpiBΔcyaA, namely strain N.

[0305] Example 8: Cell morphology analysis of strain D and strain F

[0306] The cell morphologies of strain D and strain F were observed by scanning electron microscopy. The specific operation steps are as follows:

[0307] The strains cultured to the stationary phase in the MOPs + 20 g / L glucose medium were centrifuged and collected, washed several times with 0.1 mol / L PBS, fixed overnight with 2.5% glutaraldehyde, washed several times with PBS to remove the residual glutaraldehyde, dehydrated by soaking in ethanol with different concentration gradients (30% - 100%), dried overnight at the critical point, and after sputtering gold on the sample surface, the scanning electron microscopy observation was carried out.

[0308] Among them: The formula of the MOPS medium is:

[0309]

[0310]

[0311] 40X “M”

[0312]

[0313] Among them, the components of the micronutrient solution are:

[0314] Volume 100ml <![CDATA[Fecl2·4H2O]]> 5g <![CDATA[CaCl2·2H2O]]> 184 mg <![CDATA[H3BO3]]> 62 mg <![CDATA[Mncl2·4H2O]]> 40 mg <![CDATA[Cocl2·6H2O]]> 18 mg <![CDATA[Cucl2·2H2O]]> 4 mg

[0315] The components of the ZnCl2 solution, Na2SeO3 solution, and Na2MoO4 solution are:

[0316]

[0317] The formula of the PBS buffer solution is:

[0318] Volume: 1 L NaCl 137 mM KCl 2.7 mM <![CDATA[Na2HPO4]]> 10 mM <![CDATA[KH2PO4]]> 2 mM <![CDATA[ddH2O]]> Up to 1 L

[0319] As Figure 1 and Figure 2 shown, after overexpressing the gene mreB encoding the dynamic cytoskeletal protein with a mutation at the 53rd amino acid in strain F and knocking out the in-situ mreB, the cell length of strain F became smaller compared to strain D ( Figure 2 A in Figure 2 ), the width increased ( Figure 2 B in

[0320] Example 9: Tolerance analysis of strain D and strain F

[0321] Pick the E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreB (strain F) constructed in Example 3 for tolerance testing.

[0322] In addition, for control, the control strain E. coli MG1655(DE3)Δpta (strain D) constructed in Example 2 was tested in the same manner.

[0323] The specific operation steps are as follows:

[0324] Pick a monoclonal colony activated by streaking and inoculate it into 15 mL of MOPS + 20 g / L glucose medium. Incubate overnight at 37°C and 200 rpm until the logarithmic phase (OD 550 ~1.5 - 2.0); measure OD 550 . Dilute the bacterial solution cultured to the logarithmic phase with MOPS medium containing different concentrations of inhibitors to OD 550 ~0.1; take 200 μL and add it to a 96-well plate (in triplicate); use the bacterial solution diluted with MOPS medium without inhibitors as a control to monitor the growth status of the strain. Use a microplate reader to continuously measure the OD 550 value every 10 min for kinetic measurement, and terminate the measurement after 24 h; finally, plot the growth curve and compare the μ values by fitting the exponential trend line in the logarithmic phase to determine the tolerance of the engineered bacteria to the inhibitor.

[0325] Formaldehyde tolerance test results Figure 3 The results show that the tolerance of the engineered strain F (E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreB) was significantly improved after modification. First, strain F showed increased tolerance to formaldehyde. As Figure 3 shown, when there was no formaldehyde in the medium, the specific growth rates of strain D and strain F (μ = 0.38 h -1 ) were the same ( Figure 3 A in -1)The specific growth rate compared to strain D (0.07 h -1 )was increased by 340%( Figure 3 B in

[0326] In addition to formaldehyde, we also characterized the tolerance of strain D and strain F to methanol( Figure 4 A in Figure 4 B in Figure 4 C in Figure 4 formic acid and other aldehydes HMF. As shown

[0327] Example 10: Analysis of cell hardness of strain D and strain F

[0328] Pick the E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreB (strain F) constructed in Example 3 for tolerance testing.

[0329] In addition, for comparison, the control strain E. coli MG1655(DE3)Δpta (strain D) constructed in Example 2 was tested in the same way.

[0330] The cell hardness of strain D and strain F was observed by atomic force microscopy. The specific operation steps are as follows:

[0331] Centrifuge and collect the strains cultured to the stationary phase in MOPs + 20 g / L glucose medium or MOPs + 20 g / L glucose + 1 mM formaldehyde medium, wash them several times with 0.1 mol / L PBS and fix them overnight with 2.5% glutaraldehyde, wash them several times with PBS to remove the residual glutaraldehyde, resuspend the cells with absolute ethanol, pipette 10 μL of the resuspended bacterial solution and drop it vertically on the mica sheet for atomic force microscopy observation.

[0332] As Figure 5 shown, when there is no formaldehyde in the medium, the cell surfaces of both strain D and strain F are flat; while when there is formaldehyde in the medium, as Figure 6 shown, wrinkles and indentations appear on the cell surface of strain D, and the cell surface of strain F remains flat. It shows that after overexpressing the coding gene mreB of the dynamic cytoskeletal protein with the 53rd amino acid mutation and knocking out the original site mreB, the cell hardness of strain F is increased compared to strain D.

[0333] Example 11: Analysis of methanol utilization ability of recombinant strains M and N

[0334] The Escherichia coli N with improved formaldehyde tolerance constructed by the present invention can utilize various one-carbon compounds such as methanol as a chassis cell. Specifically, it includes the following steps:

[0335] 1. Transfer the methanol utilization plasmid pCDF-RuMP into the control strain (strain M) and the engineered strain (strain N).

[0336] 1.1. Construct the methanol assimilation plasmid pCDF-RuMP containing the CT4-1 mdh gene and the hps-phi operon.

[0337] The CT4-1 mdh gene (SEQ ID NO.97): derived from Cupriavidus necator, was optimized and conventionally synthesized by GENEWIZ (Suzhou Genewiz Biotechnology Co., Ltd.) and inserted into

[0338] the MCS1 site of the pCDF-duet (Spectinomycin) plasmid to obtain the pCDF-CT4-1 mdh plasmid.

[0339] The hps-phi operon: derived from Bacillus methanolicus (NCBI accession GCF_000262755.1), was cloned into the MCS2 site of the pCDF-CT4-1 mdh plasmid.

[0340] By designing primers containing homologous sequences on the left and right sides of the insertion site of the pCDF-CT4-1 mdh plasmid, the primer sequences are as follows:

[0341] Vector backbone primers:

[0342] P2-F: GCAGATCTCAATTGGATATCGG SEQ ID NO.78

[0343] P2-R: CCATATGTATATCTCCTTCTTATACTT SEQ ID NO.79

[0344] hps-phi operon:

[0345] HPS-F: GTATAAGAAGGAGATATACATATGGAACTGCAACTGGCTC SEQ ID NO.80PHI-R: GATATCCAATTGAGATCTGCTTATTCCAGGTTAGCGTGACG SEQ ID NO.81

[0346] The vector backbone and gene fragments were separately cloned by PCR. After purifying and recovering the PCR products, seamless cloning of the vector backbone and gene fragments was carried out, and the assembled products were used for heat shock transformation to screen monoclonal clones for sequencing verification to obtain the methanol assimilation plasmid pCDF-RuMP containing

[0347] the CT4-1 mdh gene and the hps-phi operon.

[0348] (1) Testing the growth of recombinant strains M and N under different methanol concentration conditions

[0349] Cultivation was carried out with MOPS + 2% (wt / v) casein acid hydrolysate + 50 mM xylose + different concentrations of methanol, and samples were taken every 24 h to measure the OD 550 reading;

[0350] (2) For the co-utilization of methanol and xylose, cultivation was carried out with MOPS + 2% (wt / v) casein acid hydrolysate + 50 mM xylose + 450 mM or 900 mM methanol; 0.1 mM IPTG was used as the inducer, and cultivation was carried out at 37 °C and 250 rpm, and samples were taken every 24 h. After centrifuging and filtering the culture broth, it was analyzed by high performance liquid chromatography.

[0351] As Figure 7 shown, strain M could hardly grow in the methanol utilization medium ( Figure 7 A in), while strain N grew well. When the methanol concentration in the medium was 1350 mM, strain N could still grow ( Figure 7 B in).

[0352] As Figure 8 shown, when the final concentration of methanol in the medium was 450 mM, strain M reached its highest biomass (OD 550 = 0.56) on the 3rd day, consumed 21.5 mM (0.69 g / L) of methanol and 4.5 mM (0.68 g / L) of xylose during the whole cultivation period ( Figure 8 A in). Strain N grew rapidly, and the biomass (OD 550 = 6.69) was 12 times that of the control strain, consuming 100 mM (3.2 g / L) of methanol and 48 mM (7.2 g / L) of xylose, which were 4.7 times and 10.7 times that of the control strain respectively ( Figure 8 B in). Further, when the final concentration of methanol in the medium was increased to 900 mM, as Figure 9 shown, the engineered strain could still grow normally, and reached its highest biomass (OD 550 = 3.5) by consuming 140 mM (4.48 g / L) of methanol and 42 mM (6.3 g / L) of xylose, which were respectively that of the control strain (43 mM methanol, 0.3 mM xylose, OD 5503.26 times, 140 times, and 8 times that of (0.44). Then, the methanol utilization ability of strain N was further tested by fed-batch fermentation in a 250 mL baffled shake flask, as Figure 10 shown. When the final concentration of methanol in the medium was 450 mM, by supplementing methanol and xylose to the medium, strain N consumed a total of 377 mM (12 g / L) of methanol and 91.5 mM (13.7 g / L) of xylose within 5 days of cultivation, and reached its maximum biomass (OD 550 = 15.66) on the second day. When the final concentration of methanol in the medium was 900 mM, by supplementing xylose to the medium, within 9 days of cultivation, strain N consumed a total of 692 mM (22 g / L) of methanol and 136 mM (20 g / L) of xylose, and reached its maximum biomass (OD 550 = 11) on the fifth day.

[0353] Example 12: Product synthesis analysis of strain M and strain N

[0354] The recombinant Escherichia coli with improved formaldehyde tolerance constructed by the present invention can be used as a chassis cell to utilize various one-carbon compounds such as methanol for the synthesis of high-value products. The specific steps are as follows:

[0355] (1) Transfer the plasmid pCum-rppA for producing flavomyclin, the plasmid pCum-phlD for producing phloroglucinol, and the plasmid pTrc99A-bktB for producing TAL into strain M and strain N containing the plasmid pCDF-RuMP;

[0356] (2) By designing primers containing homologous sequences on the left and right sides of the plasmid insertion site, the vector backbone and gene fragments were respectively cloned by PCR. After purifying and recovering the PCR products, seamless cloning of the vector backbone (the pCum vector sequence is SEQ ID NO.84, and the pTrc99A vector sequence is SEQ ID NO.93) and the gene fragments (the sequence of the gene rppA is SEQ ID NO.87, the gene sequence of phlD is SEQ ID NO.90, and the gene sequence of bktB is SEQ ID NO.96) was carried out. The assembled product was used for heat shock transformation to screen monoclonal colonies for sequencing verification to obtain the target plasmid. The primer sequences are as follows:

[0357] Primers for the pCum vector backbone:

[0358] pCum-F:TGATGATAAGCCAGGCATCAA SEQ ID NO.82

[0359] pCum-R:ACTTACTCCTTAAAAGAATTTAAATCTCTAGTAAAT SEQ ID NO.83

[0360] rppA amplification primers:

[0361] rppA-up:agagatTTAAATTCTTTTAAGGAGTAAGTATGGCGACCCTGTGCCGT SEQ ID NO.85

[0362] rppA-down:ttgatgcctggCTTATCAtcaTTAACCGCTCAGCGCAACACCCG SEQ ID NO.86

[0363] phlD-up:AAATTCTTTTAAGGAGTAAGTATGAGCACCCTGTGCCTG SEQ ID NO.88

[0364] phlD-down:tgatgcctggCTTATCAtcaTTACGCGGTCCATTCGCC SEQ ID NO.89

[0365] pTrc99A-bktB vector backbone primers:

[0366] pTrc99A-F:TACGTGATTGATAAATCCGC SEQ ID NO.91

[0367] pTrc99A-R:GGTCTGTTTCCTGTGTGAAA SEQ ID NO.92

[0368] bktB amplification primers:

[0369] bktB-up:TTTCACACAGGAAACAGACCATGACGCGTGAAGTGGTAGT SEQ ID NO.94

[0370] bktB-down:GCGGATTTATCAATCACGTATCAGATACGCTCGAAGATGG SEQ ID NO.95

[0371] The vector backbone and gene fragments were cloned by PCR respectively. After purifying and recovering the PCR products, seamless cloning of the vector backbone and gene fragments was carried out. The assembled products were used for heat shock transformation to screen monoclonal clones for sequencing verification to obtain the target plasmids pCum-rppA, pCum-phlD, and pTrc99A-bktB.

[0372] Such as Figure 11As shown, in a shake flask containing MOPS minimal medium with 450 mM methanol, 50 mM xylose, and 2% acid hydrolysate, strain M did not grow, did not consume methanol and xylose, and did not produce flaviolin. Strain N consumed 52.3 mM xylose and 195 mM methanol (6.24 g / L) within 4 days, and the A520 reading of the flaviolin A produced was 0.034.

[0373] As Figure 12 shown, strain N produced 102 mg / L phloroglucinol within 5 days, while strain M did not produce phloroglucinol.

[0374] As Figure 13 shown, strain N produced approximately 71 mg / L TAL within 7 days, while strain M did not produce TAL.

[0375] In summary, these results demonstrated the effectiveness of the recombinant Escherichia coli strain with increased cell hardness as a basis for the biosynthesis of valuable chemicals.

[0376] It can be seen that by using genetic engineering techniques, this invention constructs Escherichia coli with a reduced aspect ratio and combines the optimization of the methanol utilization pathway, which can effectively improve the utilization ability of the recombinant engineering bacteria for C1 compounds.

[0377] Example 13: Determination of the intracellular reactive oxygen species (ROS) level of strain D and strain F

[0378] Pick the E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreB (strain F) constructed in Example 3 for the determination of the intracellular ROS level.

[0379] In addition, for comparison, the control strain E. coli MG1655(DE3)Δpta (strain D) constructed in Example 2 was used for the determination of the intracellular ROS level.

[0380] The specific operation steps are as follows:

[0381] Pick the monoclonal activated by streaking and inoculate it into 15 mL of MOPS medium. Incubate overnight at 37 °C and 200 rpm until the logarithmic phase (OD 550 ~1.5 - 2.0); measure OD 550Divide the bacterial solution into two equal parts, and add formaldehyde with a final concentration of 0 mM and 5 mM to them respectively, and treat overnight for 12 - 16 h; collect the treated cells (5000 g, 10 min), wash twice with 0.1 M PBS buffer (pH 7.0) and resuspend with an equal volume. Add DCFDA probe according to the ratio of 5 μL of 25 mM DCFDA probe: 300 μL of bacterial solution. After incubating at 37 °C for 1 h, wash twice with PBS buffer, and measure the readings at an excitation wavelength of 250 nm and an emission wavelength of 480 nm using a microplate reader. Characterize the intracellular reactive oxygen species level of the strain by the microplate reader reading / cell number.

[0382] As Figure 14 shown, the intracellular ROS levels of strain D (E. coli MG1655(DE3)Δpta) and strain F (E. coli MG1655(DE3)Δpta::M1 - 93 - mreB(A53R)ΔmreB) were 89 and 94 respectively when the formaldehyde concentration was 0 mM. After treatment with formaldehyde with a final concentration of 5 mM for 12 - 16 h, the intracellular ROS level of strain F was 176. While the intracellular ROS level of strain D was 222, which indicated that overexpressing the dynamic cytoskeletal protein with the 53rd amino acid mutated to arginine and knocking out the original site mreB could reduce the ROS level generated in cells by formaldehyde treatment.

[0383] Example 14: Analysis of cell membrane integrity of strain D and strain F

[0384] Pick the E. coli MG1655(DE3)Δpta::M1 - 93 - mreB(A53R)ΔmreB (strain F) constructed in Example 3 for the cell membrane integrity test.

[0385] In addition, for comparison, the control strain E. coli MG1655(DE3)Δpta (strain D) constructed in Example 2 was tested in the same way.

[0386] The specific operation steps are as follows:

[0387] Pick a monoclonal colony activated by streaking, inoculate it into 15 mL of MOPS medium, and culture overnight at 37 °C and 200 rpm until the logarithmic phase (OD 550 ~1.5 - 2.0); measure OD 550 ; divide the bacterial solution into two equal parts, add formaldehyde with a final concentration of 0 mM and 5 mM to them respectively, and treat overnight for 12 - 16 h; collect the treated cells (5000 g, 10 min), wash twice with 0.1 M PBS buffer (pH 7.0) and then suspend to OD 550~0.1. Add the nucleic acid dye SYTOX Green at a volume ratio of 1 μL / mL, and measure the ratio of dead cells to live cells by flow cytometry to characterize the cell membrane integrity of strain D and strain F.

[0388] As Figure 15 shown, the cell death rates of strain D (E. coli MG1655(DE3)Δpta) and strain F (E. coli MG1655(DE3)Δpta::M1-93-mreB(A53R)ΔmreB) at a formaldehyde concentration of 0 mM were 12.27% and 22.33% respectively. As Figure 16 shown, after treatment with formaldehyde at a final concentration of 6 mM for 12 - 16 h, the cell death rate of strain F only increased by 7.59%. However, the cell death rate of strain D increased by 26.52% compared with that before treatment, and the increase rate was 3.5 times that of strain F, which indicated that overexpressing the dynamic cytoskeletal protein with the 53rd amino acid mutated to arginine and knocking out the original site mreB could increase the cell membrane integrity during formaldehyde treatment.

[0389] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art can make various changes or modifications within the scope of the claims, which do not affect the essence of the present invention. Without conflict, the embodiments of the present application and the features in the embodiments can be combined arbitrarily with each other.

Claims

1. A method for improving formaldehyde tolerance and one-carbon compound bioutilization capacity by using a morphologically reshaped cell; the morphologically reshaped cell is obtained by regulating the bacterial dynamic cytoskeleton protein mreB.

2. The use according to claim 1, characterized in that: The steps for regulating the bacterial dynamic cytoskeleton protein mreB are to replace the gene pta encoding phosphate acetyltransferase in the host bacteria with the dynamic cytoskeleton protein encoding gene mreB (A53R) and its homologs in which the 53rd alanine is mutated to arginine, and to knock out the original site mreB.

3. The use according to claim 2, characterized in that: The nucleotide sequence of the gene encoding the dynamic cytoskeleton protein mreB is shown in any one of SEQ ID NO.1 to SEQ ID NO.16; The nucleotide sequence of mreB (A53R) is shown in SEQ ID NO.17; And / or, the host bacteria includes MG1655(DE3); And / or, the nucleotide sequence of the gene encoding phosphate acetyltransferase pta is shown in SEQ ID NO.

18.

4. A recombinant Escherichia coli with improved formaldehyde tolerance and one-carbon compound utilization ability, characterized in that: The phosphate acetyltransferase gene pta in Escherichia coli was replaced with the dynamic cytoskeleton protein encoding gene mreB (A53R) in which the 53rd alanine was mutated to arginine, and mreB (A53R) was overexpressed to obtain the recombinant Escherichia coli.

5. The recombinant Escherichia coli according to claim 4, characterized in that The nucleotide sequence of mreB(A53R) is shown in SEQ ID NO.

17.

6. The recombinant Escherichia coli according to claim 5, characterized in that Overexpression of mreB(A53R) is to upregulate the expression of mreB(A53R) through an artificial promoter element.

7. A morphologically remodeled recombinant bacterium, characterized in that: It is obtained by knocking out the original site mreB on the basis of the recombinant Escherichia coli as described in any one of claims 5 or 6.

8. A chassis cell for improving the utilization capacity of one-carbon compounds, characterized in that: The recombinant bacterium according to claim 7 is obtained by knocking out the frmA gene encoding formaldehyde dehydrogenase and at least one of the following genes: the rpiA gene encoding ribose phosphate isomerase A; rpiB gene encoding ribose phosphate isomerase B; The cyaA gene encodes adenylate cyclase.

9. A cell factory for improving the formaldehyde tolerance and one-carbon compound utilization capacity of recombinant bacteria, characterized in that: The RuMP pathway is introduced into the chassis cells as described in claim 8, comprising introducing the mdh gene from Cupriavidus necrotus, the hps gene and the phi gene from Bacillus methanolicus, and the nudF protein from Escherichia coli.

10. A method for constructing a cell factory as claimed in claim 9, characterized in that: Follow these steps: 1) Assemble the mdh gene from Copperobacterium necrotum, the hps and phi genes from Bacillus methanolicus, and the nudF protein from Escherichia coli into the pCDFduet-1 plasmid to obtain the highly active methanol utilization pathway plasmid pCDF-mdh-nudF-hps-phi, i.e., pCDF-RuMP plasmid; 2) The pCDF-RuMP plasmid is transferred into the chassis cells to construct a cell factory for utilizing one-carbon compounds.