Isothermal amplification detection method for nucleic acid
Through a new constant temperature amplification detection method of nucleic acid, the initiator and circular DNA nucleic acid are used to combine with the double-strand restriction enzyme to cut off the double-strand restriction enzyme to solve the problems of non-specific amplification and low detection throughput in NEAR technology, achieving efficient specific amplification and high sensitivity detection, meeting the needs of rapid on-site detection.
Patent Information
- Application Number
- CN202510468881.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-06-27
AI Technical Summary
The existing nucleic acid constant temperature amplification technology, especially NEAR technology, has the problems of severe non-specific amplification and low detection flux, resulting in low sensitivity, limiting its application in actual sample analysis.
A constant temperature amplification detection method of nucleic acid is adopted. This method requires only one initiator sequence and one exogenous circular DNA nucleic acid. The initiator and the nucleic acid to be tested generate a hairpin structure initiator, combine it with a double-strand restriction enzyme to inhibit non-specific amplification, and achieve efficient specific amplification of the target nucleic acid.
This method simplifies the amplification process, improves detection speed and efficiency, significantly improves sensitivity, and meets the needs of rapid on-site inspection.
Smart Images

Figure CN120210337A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of nucleic acid detection, and particularly relates to a method for isothermal nucleic acid amplification detection. Background Art
[0002] Nucleic acid detection has been widely used in many aspects such as environmental monitoring and the prevention and control of infectious diseases. The polymerase chain reaction (PCR) has become the most widely used DNA amplification method due to its high sensitivity. However, the existing conventional PCR technology cannot meet the requirements of on-site rapid detection due to its dependence on instruments and long amplification time. The isothermal nucleic acid amplification technology solves the requirements of PCR technology for instruments, but good specificity and high sensitivity of isothermal amplification are the prerequisites for popularizing isothermal nucleic acid diagnosis technology. Currently developed isothermal nucleic acid amplification technologies mainly include strand displacement amplification reaction technology (SDA), loop-mediated isothermal nucleic acid amplification technology (LAMP), nucleic acid sequence-based amplification technology (NASBA), rolling circle amplification technology (RCA), and nicking endonuclease-mediated amplification reaction (NEAR) similar to SDA technology. NEAR is a very rapid molecular diagnostic method. However, the NEAR technology has problems such as relatively serious non-specific amplification and low detection throughput. The large generation of non-specific products limits the sensitivity of this technology. Therefore, this technology has not been widely used in the analysis of actual samples. It has been found in research that non-specific amplification is mainly caused by the coexistence of Bst polymerase, nicked primers, and dNTP. This highly active nicking endonuclease guides and accelerates non-specific amplification in a manner that is conducive to nicks. In addition, the products of NEAR have reverse complementary relationships, and in the middle and late stages, the two products will combine into a phase chain, resulting in a reduction in effective amplification templates.
[0003] Therefore, there is an urgent need to develop a simple and efficient method for isothermal nucleic acid amplification detection. Summary of the Invention
[0004] The purpose of the present invention is to provide a method for isothermal nucleic acid amplification detection in view of the deficiencies of the prior art. This method can achieve efficient and specific amplification of target nucleic acids with only one initiator sequence and one exogenous circular DNA nucleic acid. The system is simple, and there is no reverse complementary relationship between the products, and it completely undergoes exponential amplification. At the same time, a double-strand cutting restriction endonuclease is used to effectively inhibit non-specific amplification caused by reagents or other pollution sources. The detection speed is faster, the efficiency is higher, and the sensitivity is also greatly improved. At the same time, due to the amplification without temperature change, it well meets the requirements of on-site detection.
[0005] To achieve the above technical objectives, the present invention adopts the following technical solutions:
[0006] A method for isothermal nucleic acid amplification detection, comprising the following steps:
[0007] (1) Design a primer and a single-stranded nucleic acid loop. The primer and the nucleic acid to be detected generate a hairpin-shaped primer complex under the action of DNA polymerase or reverse transcriptase.
[0008] The primer sequentially includes a signal amplification region, an endonuclease recognition region, and a specific primer region from the 5'-end to the 3'-end. The endonuclease recognition region is a restriction endonuclease sequence for cleaving double-stranded DNA or a nick endonuclease sequence for cleaving one of the strands; the specific primer region is a sequence that can synthesize a double-stranded primer complex under the action of DNA polymerase after binding to the nucleic acid to be detected.
[0009] The single-stranded nucleic acid loop is a circular single-stranded DNA containing the signal amplification region and the specific primer region of the primer.
[0010] (2) The primer complex is amplified under the action of an endonuclease and a DNA polymerase with strand displacement ability to generate a single-stranded DNA product I with a reverse complementary sequence of the signal amplification region in the primer, and a single-stranded DNA product II with a reverse complementary sequence of the specific primer region of the primer.
[0011] (3) Using the single-stranded DNA product II as the primer of the primer to synthesize a primer complex II, and the primer complex II is amplified under the action of an endonuclease and a DNA polymerase with strand displacement ability to generate a single-stranded DNA product I and a single-stranded DNA product III. The sequence of the single-stranded DNA product III is reverse complementary to that of the single-stranded DNA product II.
[0012] (4) Using the single-stranded DNA product I as the primer, triggering rolling circle amplification with the single-stranded nucleic acid loop as the template under the action of a DNA polymerase with strand displacement ability. The rolling circle amplification product contains the specific primer binding region on the primer and the single-stranded DNA product III binding region, and is triggered for exponential amplification by the primer or the single-stranded DNA product III to obtain an exponential amplification product.
[0013] (5) Detect the exponential amplification product by fluorescence or electrophoresis.
[0014] In step (4), the method for triggering rolling circle amplification with the single-stranded nucleic acid loop as the template is as follows: First, the single-stranded DNA product I binds to the single-stranded nucleic acid loop to trigger rolling circle amplification; the amplification product is bound by the primer or the single-stranded DNA product II to trigger hyper-branch displacement amplification; the displaced single-stranded products are divided into two categories, one is synthesized from the single-stranded DNA product II, and the other is synthesized from the primer. They can both be bound by the single-stranded DNA product I to cause hyper-branch amplification. Among them, the product synthesized from the primer forms a double-stranded structure and then generates more single-stranded DNA products I.
[0015] Further, in step (1), the primer also includes a folded binding region, which is located between the endonuclease recognition region and the specific primer region and is a sequence that binds in a reverse complementary manner to the sequence after the extension of the specific primer.
[0016] Further, in step (1), different primer synthesis methods are adopted according to different types of nucleic acids to be detected:
[0017] When the nucleic acid to be detected is miRNA, first, miRNA binds to the primer, and under the action of reverse transcriptase polymerase, a complementary strand is synthesized. Subsequently, denaturation and renaturation occur, and a primer is formed under the action of DNA polymerase;
[0018] When the nucleic acid to be detected is RNA, the following two methods are used to synthesize the primer:
[0019] 1) The primer binds to RNA and is transcribed into cDNA. Under the action of RNaseH and DNA polymerase, the second-strand cDNA is synthesized to generate a hairpin structure with a 3'-terminal overhang. Under the action of exonuclease and DNA polymerase, the 3'-overhanging sequence is excised and the gap sequence is filled to form a primer;
[0020] 2) The primer binds to RNA and reverse transcription is carried out under the condition of incomplete dNTP. RNaseH or heat denaturation / renaturation is performed to form a hairpin structure, and a hairpin-shaped primer is synthesized under the action of DNA polymerase;
[0021] When the nucleic acid to be detected is DNA, if it is double-stranded DNA, first, the sample DNA is digested with an endonuclease, heated at 95 °C for 2 minutes, and placed on ice for 2 minutes to prepare multiple single-stranded DNA templates. The sequence near the 5'-end of any single-stranded DNA template of the digested fragment is used as the primer binding region, and a primer is generated at the gap-filling position by DNA polymerase. This method is also applicable to linear single-stranded DNA; optionally, a hairpin-shaped primer can also be formed by non-complete dNTP extension followed by heat denaturation and renaturation. This method is also applicable to linear single-stranded DNA.
[0022] Further, in steps (2) and (3), the endonuclease is TspRI restriction endonuclease, Nt.AlwI nicking enzyme or Nt.BstNBI restriction endonuclease.
[0023] Further, in steps (2), (3) and (4), the DNA polymerase with strand displacement ability is Bst DNA polymerase or phi29 DNA polymerase.
[0024] Compared with the prior art, the beneficial effects of the present invention:
[0025] The present invention discloses a method for isothermal nucleic acid amplification and detection. Compared with the prior art, only one initiator sequence and one exogenous circular DNA nucleic acid are required to trigger hyperbranched rolling circle amplification. Moreover, since the amplification intermediate product contains a restriction endonuclease, new primers and amplification substrates can be generated. Therefore, the amplification method is simpler than the traditional rolling circle amplification process, with rapid reaction, short detection time, high sensitivity, and can be used for nucleic acid detection, including pathogenic organism detection, disease biomarker detection, etc., and has a very wide range of applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 Schematic diagram of the structure of the initiator;
[0027] Figure 2 Schematic diagram of the structure of the primosome;
[0028] Figure 3 Schematic diagram of the synthesis principle of the primosome;
[0029] Figure 4 Amplification principle diagram of the primosome;
[0030] Figure 5 Schematic diagram of the principle of single-stranded DNA product triggering exponential rolling circle amplification;
[0031] Figure 6 Agarose gel electrophoresis detection result of miRNA18a in Example 1;
[0032] Figure 7 Agarose gel electrophoresis detection result of TP53 in 293T cells in Example 2;
[0033] Figure 8 Agarose gel electrophoresis detection result of plasmid DNA in Example 3. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0034] The following will clearly and completely describe the technical principles and solutions in the embodiments of the present invention in conjunction with the drawings and specific examples. The described embodiments are only used to explain the present invention. Obviously, the present invention can be implemented in many different forms and is not intended to limit the scope of the present invention.
[0035] A method for isothermal nucleic acid amplification and detection includes the following steps:
[0036] (1) Design an initiator and a single-stranded nucleic acid loop. The initiator and the nucleic acid to be detected generate a hairpin-structured primosome under the action of DNA polymerase or reverse transcriptase;
[0037] The structure diagram of the initiator is as shown in Figure 1As shown, the primer from the 5'-end to the 3'-end sequentially includes a signal amplification region, an endonuclease recognition region, and a specific primer region. The endonuclease recognition region is a restriction endonuclease sequence that cuts double-stranded DNA or a nicking endonuclease sequence that cuts one of the strands. The specific primer region is a sequence that can synthesize a double-stranded structure primer after binding to the nucleic acid to be detected under the action of DNA polymerase.
[0038] The primer structure is as Figure 2 shown, which is a DNA molecule with a stem-loop structure, containing the same components as the primer, but the specific primer region is located in the loop region.
[0039] The single-stranded nucleic acid loop is a circular single-stranded DNA containing the signal amplification region and the specific primer region of the primer.
[0040] According to the type of nucleic acid to be detected, different primer synthesis methods are adopted, and the synthesis principle diagram is as Figure 3 shown:
[0041] When the nucleic acid to be detected is miRNA, first, miRNA binds to the primer, synthesizes a complementary strand under the action of reverse transcriptase polymerase, then denatures and renatures, and forms a primer under the action of DNA polymerase.
[0042] When the nucleic acid to be detected is RNA, the following two methods are used to synthesize the primer:
[0043] 1) The primer binds to RNA and is transcribed into cDNA. Under the action of RNaseH and DNA polymerase, the second-strand cDNA is synthesized to generate a hairpin structure with a 3'-end overhang. Under the action of exonuclease and DNA polymerase, the 3'-overhang sequence is excised and the gap sequence is filled to form a primer.
[0044] 2) The primer binds to RNA and is reverse-transcribed under the condition of incomplete dNTPs, followed by RNaseH or heat denaturation / renaturation to form a hairpin structure, and a hairpin-shaped primer is synthesized under the action of DNA polymerase.
[0045] When the nucleic acid to be detected is DNA, if it is double-stranded DNA, first digest the sample DNA with the selected nucleic acid endonuclease, heat at 95°C for 2 minutes, and place on ice for 2 minutes to prepare multiple single-stranded DNA templates. Use the sequence near the 5'-end of any single-stranded DNA template of the digested fragment as the primer binding region, and generate a primer at the gap filled by DNA polymerase. This method is also applicable to linear single-stranded DNA. Optionally, a hairpin-shaped primer can also be formed by non-complete dNTP extension followed by heat denaturation and renaturation. This method is also applicable to linear single-stranded DNA.
[0046] (2) The primosome is amplified under the action of an endonuclease and a DNA polymerase with strand displacement ability, generating single-stranded DNA product I with a reverse complementary sequence of the signal amplification region in the initiator, and single-stranded DNA product II with a reverse complementary sequence of the specific primer region of the initiator;
[0047] The endonuclease can be an endonuclease that cuts double-stranded DNA or a nicking endonuclease that cuts single-stranded DNA. However, the product after endonuclease cleavage must form a stable nicked double-stranded product with a 3'-terminal protruding end. TspR1 restriction endonuclease can produce such a structural product, or a single nicking enzyme, but two recognition sites of this nicking enzyme must be introduced on the primosome.
[0048] (3) Using single-stranded DNA product II as the primer of the initiator, primosome II is synthesized. Primosome II is amplified under the action of an endonuclease and a DNA polymerase with strand displacement ability, generating single-stranded DNA product I and single-stranded DNA product III. Single-stranded DNA product III is the reverse complementary sequence of single-stranded DNA product II;
[0049] The amplification principle diagram of the primosome is shown in Figure 4 , as shown in the figure, the primosome composed of two strands generates two nicks under the action of a restriction endonuclease, and the strand displacement DNA polymerase continuously synthesizes single-stranded DNA product I and single-stranded DNA product II; DNA product II synthesizes primosome II using the initiator as a template. Primosome II generates two nicks under the action of a restriction endonuclease, and the strand displacement DNA polymerase continuously synthesizes single-stranded DNA product I and single-stranded DNA product III.
[0050] (4) Single-stranded DNA products trigger rolling circle exponential amplification: Using single-stranded DNA product I as the primer, under the action of a DNA polymerase with strand displacement ability, rolling circle amplification is triggered using a single-stranded nucleic acid ring as a template. The rolling circle amplification product contains the specific primer binding region on the initiator and the binding region of single-stranded DNA product III, and is triggered by the initiator or single-stranded DNA product III for exponential amplification to obtain an exponential amplification product;
[0051] The principle of single-stranded DNA product-triggered rolling circle exponential amplification is shown in Figure 5 , as shown in the figure, first, single-stranded DNA product I binds to the single-stranded nucleic acid ring to trigger rolling circle amplification; the amplification product is bound by the initiator or single-stranded DNA product III to trigger hyper-branch displacement amplification; the displaced single-stranded products are divided into two categories, one is synthesized from single-stranded DNA product III, and the other is synthesized from the initiator. They can both be bound by single-stranded DNA product I to cause hyper-branch amplification. Among them, the product synthesized from the initiator forms a double-strand and then can generate more single-stranded DNA product I, which has higher efficiency and faster speed compared with traditional double-primer rolling circle amplification.
[0052] (5) Detect the exponentially amplified product by fluorescence or electrophoresis.
[0053] Example 1
[0054] Synthesize miRNA18a: UAAGGUGCAUCUAGUGCAGAUAG
[0055] Detect the content of the synthesized miRNA18a:
[0056] Design and synthesize the miRNA18a initiator. The sequence of the miRNA18a initiator is as follows:
[0057]
[0058] In the single-stranded nucleic acid loop sequence, the underlined "-" and the shaded background sequence are the internal primer binding regions for the self-cyclization sequence; the sequence indicated by the underlined "=" is the same as the signal amplification region sequence in the initiator; the bold black sequence is the same as the specific primer sequence of the initiator.
[0059] Synthesis of the single-stranded nucleic acid loop: Add 8 μM for preparing the detection loop template in 1X T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT), add 2 units of T4 polynucleotide kinase, react at 37 °C for 30 minutes, then heat at 90 °C for 1 minute, cool on ice for 2 minutes, and then add 0.2 μL of T4 DNA ligase and incubate at 25 °C for 30 minutes to complete the preparation of the single-stranded nucleic acid loop.
[0060] Detection of miRNA18a:
[0061] Add 0.2 μM of the miRNA18a initiator to a 10 μL reaction system. In 1X NEBuffer TM r3.1 buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml Recombinant Albumin) contains miRNA18a (0.1 fM - 1 nM). Add 0.2 μL of reverse transcriptase, react at 50 °C for 30 minutes, 90 °C for 1 minute, cool on ice for 2 minutes, and then add 0.2 μL of Bst DNA polymerase, 0.1 μM of the single-stranded nucleic acid loop, Nt.BstNBI endonuclease, react at 50 °C for 30 minutes, and then identify by 1.5% agarose gel electrophoresis.
[0062] Figure 6 The agarose gel electrophoresis detection result of miRNA18a in Example 1. The electrophoresis result shows that miRNA18a with a concentration as low as 1 fM can be detected within 30 minutes.
[0063] Example 2
[0064] Detect the expression of TP53 in 293T cells:
[0065] Design and synthesize the TP53 primer. The sequence of the TP53 primer is as follows:
[0066] 5’ATGCAGTACGCCAGGGTTTCGAGACTCGCAGAGTCtgagtgtacattatttcattaacc3’
[0067] Design the single-stranded nucleic acid loop. The sequence is as follows:
[0068] CATTGCTCCATGCAGTACGCCAGGGTTTTGAGCAATGGTGCTACtgtacattatttcattaaccCTAGCAC
[0069] Synthesis of the single-stranded nucleic acid loop: Add 8 μM for preparing the detection loop template into 1X T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT), add 0.4 μL dNTP (10 mM), add 0.2 μL of T4 polynucleotide kinase, react at 37 °C for 30 minutes, then heat at 90 °C for 1 minute, cool on ice for 2 minutes, then add 0.2 μL of T4 DNA ligase, incubate at 25 °C for 30 minutes to complete the preparation of the single-stranded nucleic acid loop.
[0070] Collect the cultured 293T cells and extract the total RNA with Trizol.
[0071] Detection of TP53:
[0072] Add 0.2 μM of the TP53 primer into a 10 μL reaction system, add different amounts of total RNA into 1X NEBuffer TM r3.1 buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL Recombinant Albumin), add 0.2 μL of reverse transcriptase, add dCTP, dATP, dTTP, react at 50 °C for 30 minutes, 90 °C for 1 minute, cool on ice for 2 minutes, then add 0.2 μL of Bst DNA polymerase, 0.1 μM of the single-stranded nucleic acid loop, Nt.BstNBI endonuclease, 0.2 μL of dNTP, react at 50 °C for 30 minutes, and then identify by 1.5% agarose gel electrophoresis.
[0073] Figure 7This is the result of agarose gel electrophoresis of TP53 in 293T cells in Example 2. The electrophoresis result shows that the expression of TP53 mRNA in as low as 1 ng of total RNA can be detected within 30 minutes.
[0074] Example 3
[0075] Detection of plasmid DNA:
[0076] Design and synthesize primers for the pmCherry-C1 plasmid, with the sequence as follows:
[0077] ATGCAGTACGCCAGGGTTTCGAGACTCGCAGAGTCgtcacgAGGACGGCGGCGTGGTGAC
[0078] Design a single-stranded nucleic acid loop, with the sequence as follows:
[0079] CATTGCTCCATGCAGTACGCCAGGGTTTTGAGCAATGGTGCTACcgAGGACGGCGGCGTGGTGACcgCTAGCAC
[0080] Synthesis of the single-stranded nucleic acid loop: Add 8 μM for preparing the detection loop template in 1X T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT), add 0.4 μL of dNTP (10 mM), add 0.2 μL of T4 polynucleotide kinase, react at 37 °C for 30 minutes, then heat at 90 °C for 1 minute, cool on ice for 2 minutes, and then add 0.2 μL of T4 DNA ligase and incubate at 25 °C for 30 minutes to complete the preparation of the single-stranded nucleic acid loop.
[0081] Plasmid treatment: Take 1 μg of plasmid and add Nt.BstNBI endonuclease in 1X NEBuffer TM r3.1 buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL Recombinant Albumin), digest at 55 °C for 30 minutes, then heat at 90 °C for 1 minute, cool on ice for 2 minutes.
[0082] Detection of the PCDH plasmid:
[0083] Add 0.2 μM of the primer to a 10 μL reaction system and add it in 1X NEBuffer TMAdd different amounts of the above digestion products into r3.1 buffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl2, 100 μg / ml Recombinant Albumin), then add 0.2 μL of Bst DNA polymerase, 0.1 μM of single-stranded nucleic acid ring, Nt.BstNBI endonuclease, and 0.2 μL of dNTP, and react at 50 °C for 30 minutes, and then identify by 1.5% agarose electrophoresis.
[0084] Figure 8 It is the agarose gel electrophoresis detection result of plasmid DNA in Example 3. The electrophoresis result shows that the content of plasmid DNA as low as 0.01 pg can be detected within 30 minutes.
Claims
1. A nucleic acid isothermal amplification detection method, characterized in that: The steps include: (1) designing a trigger and a single-stranded nucleic acid loop, wherein the trigger and the nucleic acid to be tested generate a trigger body with a hairpin structure under the action of DNA polymerase or reverse transcriptase; The initiator includes a signal amplification region, an endonuclease recognition region and a specific primer region from the 5' end to the 3' end, wherein the endonuclease recognition region is a restriction endonuclease sequence that cuts a double strand, or a nicking endonuclease sequence that cuts one strand; the specific primer region is a sequence that can synthesize a double-stranded structure initiator under the action of a DNA polymerase after binding to the nucleic acid to be detected; The single-stranded nucleic acid loop is a circular single-stranded DNA containing a signal amplification region of a trigger and a specific primer region; (2) the initiator is amplified under the action of an endonuclease and a DNA polymerase with strand displacement ability to generate a single-stranded DNA product 1 having a reverse complementary sequence to the signal amplification region in the initiator and a single-stranded DNA product 2 having a reverse complementary sequence to the specific primer region of the initiator; (3) using the single-stranded DNA product 2 as a primer to synthesize the initiator 2, and the initiator 2 is amplified under the action of a nuclease and a DNA polymerase with strand displacement ability to generate the single-stranded DNA product 1 and the single-stranded DNA product 3, and the sequence of the single-stranded DNA product 3 is reverse complementary to that of the single-stranded DNA product 2; (4) using the single-stranded DNA product 1 as a primer, and triggering rolling circle amplification with the single-stranded nucleic acid circle as a template under the action of a DNA polymerase with strand displacement ability, the rolling circle amplification product contains the specific primer binding region on the initiator and the single-stranded DNA product 3 binding region, and is triggered by the initiator or the single-stranded DNA product 3 to exponentially amplify, thereby obtaining an exponential amplification product; (5) Detect the exponentially amplified products using fluorescence or electrophoresis.
2. The nucleic acid isothermal amplification detection method according to claim 1, characterized in that: In step (1), the initiator further comprises a reverse fold binding region, which is located between the endonuclease recognition region and the specific primer region and is a sequence that reversely complements the sequence after the specific primer is extended.
3. The nucleic acid isothermal amplification detection method according to claim 1, characterized in that: In step (1), different initiator synthesis methods are used according to the different types of nucleic acids to be detected: When the nucleic acid to be detected is miRNA, miRNA first binds to the initiator, synthesizes a complementary chain under the action of reverse transcriptase polymerase, and then denatures and renatures to form an initiator under the action of DNA polymerase; When the nucleic acid to be detected is RNA, the initiator is synthesized by the following two methods: 1) The initiator binds to RNA and is transcribed into cDNA. Under the action of RNaseH and DNA polymerase, the second-strand cDNA is synthesized to generate a hairpin structure with a protruding 3' end. Under the action of exonuclease and DNA polymerase, the 3' protruding sequence is removed and the gap sequence is filled to form the initiator; 2) The initiator binds to RNA and reverse transcribes under incomplete dNTP conditions, denatures / renatures with RNaseH or heat to form a hairpin structure, and synthesizes a hairpin-shaped initiator under the action of DNA polymerase; When the nucleic acid to be tested is DNA, if it is double-stranded DNA, first digest the sample DNA with nuclease, heat at 95°C for 2 minutes, and place on ice for 2 minutes to prepare multiple single-stranded DNA templates. Use the sequence close to the 5' end of any enzyme-cut single-stranded DNA template as the initiator binding region, and generate a primer at the gap filled by DNA polymerase. This method is also applicable to linear single-stranded DNA. It can also be extended by incomplete dNTP, followed by heating denaturation and renaturation to form a hairpin-shaped primer. This method is also applicable to linear single-stranded DNA.
4. The nucleic acid isothermal amplification detection method according to claim 1, characterized in that: In steps (2) and (3), the endonuclease is TspRI restriction endonuclease, Nt.AlwI nicking enzyme or Nt.BstNBI restriction endonuclease.
5. The nucleic acid isothermal amplification detection method according to claim 1, characterized in that: In steps (2), (3) and (4), the DNA polymerase with strand displacement ability is BstDNA polymerase or phi29DNA polymerase.