Method for evaluating detection effect of fusion gene detection method

Abstract

The invention discloses a method for evaluating the detection effect of a fusion gene detection method, and belongs to the technical field of evaluation based on the detection effect. According to the invention, a detection reference substance I and a detection reference substance II are constructed, and the detection reference substances are connected with a reference gene segment in equal molecular number proportion, so that the detection condition under the condition of equivalent reference gene expression level can be realized, and whether the sample quality reaches the detection standard or not can be deduced; the measurement of the lowest detection quantity of the fusion gene relative to the expression quantity of the reference gene is realized; the first detection reference is used for detecting sensitivity analysis of the fusion type by the detection method of the fusion gene to be detected, and the second detection reference is used for verifying whether a detection result of the detection method of the fusion gene to be detected is a false negative result or not. And the method has a very good application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of detection effect evaluation, and particularly relates to a method for evaluating the detection effect of a fusion gene detection method. Background Art

[0002] A fusion gene is formed by the re-splicing of two broken genes, which is often caused by chromosomal deletion, inversion, and translocation. It is a complex gene variation with large nucleic acid sequence variations. The fusion gene is a driver gene variation in the occurrence of malignant tumors, and targeted therapy for the fusion gene often achieves good therapeutic effects. Therefore, detecting fusion genes is of great significance for tumor diagnosis and treatment. However, the large variation and multiple fusion types of fusion genes bring great difficulties to detection. There are many types of breakage and splicing of fusion gene partners, which is not only reflected in the large number of fusion partners. For example, the fusion partners of the common ALK fusion gene in lung cancer can be EML4, KLC1, HIP1, KIF5B, STRN, etc.; the same pair of fusion partners can also produce different fusion types due to diverse breakage sites. For example, at least 10 subtypes of the EML4:ALK fusion gene in lung cancer have been reported. In addition, some tumors often have accompanying fusion genes that are not expressed or inactive. Therefore, the detection of driver fusion genes needs to be carried out at the RNA level. RNA is easily degraded, which increases the detection difficulty. Moreover, the mRNA expression levels among individuals are uneven, and the detection results require higher sample quality.

[0003] Currently, common methods for detecting fusion genes at the RNA level include next-generation sequencing (NGS) methods, PCR combined with high-resolution melting curve methods, real-time quantitative PCR methods, etc. These methods all require the amplification and enrichment of the fusion gene fragments to be detected. However, the gene sequences among different fusion types vary greatly, and the GC and AT base distributions are often uneven. The enrichment efficiency of the target fragments is not consistent. Therefore, the detection sensitivities of different fusion types also vary, resulting in false-negative detection results. Due to the complexity of fusion gene changes and the low incidence of some types, it is difficult to obtain a sufficient number of positive clinical samples of different fusion types. Some kits that can detect fusion genes do not provide real positive samples. Therefore, different from the detection of simple variations such as point mutations, when evaluating fusion gene detection methods, it is often a comparison of the consistency between methods, without a real evaluation of the detection effect of fusion genes. Especially for gene variation detection based on mRNA, due to the unstable and easily degradable characteristics of mRNA and the large differences in the expression levels of target genes in samples, it is sometimes unreasonable to simply evaluate the detection limit based on DNA, and the actual results of the samples cannot be given. Summary of the Invention

[0004] For fusion gene nucleic acid sequences, there are large variations and multiple fusion types, making detection very difficult. Although existing technologies can detect fusion genes, there is currently no evaluation method system for the detection effects of these methods, including specificity, sensitivity, accuracy, minimum detection ability, etc. In particular, there is no method to define whether a negative test sample is truly negative, whether the sample quality is too poor for detection, whether the fusion gene expression level is below the detection standard, or whether there are false negatives. The purpose of the present invention is to provide a method for evaluating the detection effect of a fusion gene detection method. The present invention constructs detection reference product 1 (a 1:1 joined fragment of the cDNA fragment of the target fusion gene type and the internal reference fragment) and detection reference product 2 (a 1:1 joined fragment of the wild-type cDNA fragment of the main gene of the fusion gene and the internal reference fragment) for the evaluation of various fusion gene detection methods.

[0005] The purpose of the present invention is achieved in the following manner:

[0006] The present invention provides a method for evaluating the detection effect of a fusion gene detection method, comprising the following steps:

[0007] (1) According to the method to be evaluated and the fusion gene, construct detection reference product 1 of the target type fusion gene and detection reference product 2 of the fusion gene. The detection reference product 1 of the fusion gene is composed of a fusion gene fragment and an internal reference gene fragment connected in a 1:1 ratio, and the detection reference product 2 of the fusion gene is composed of a wild-type fragment of the main gene of the fusion gene and an internal reference gene fragment connected in a 1:1 ratio. Quantify the molecular copy number concentrations of detection reference product 1 of the fusion gene and detection reference product 2 of the fusion gene.

[0008] (2) Dilute detection reference product 1 of the fusion gene in a serial dilution manner to determine the detection limit of the fusion gene type by the fusion gene detection method.

[0009] (3) Detect the internal reference gene and the fusion gene separately according to the detection process in step (2) to obtain the detection limit of the fusion gene relative to the internal reference gene in low-quality and low-concentration samples detected by this detection method.

[0010] (4) Design primer pairs 1, 2, and 3. Primer pair 1 is used to amplify the fragment before the break (which may include the breakpoint) of the fusion gene; primer pair 2 is used to amplify the fragment after the break of the fusion gene; primer pair 3 is used to amplify the internal reference gene fragment.

[0011] (5) Dilute detection reference product 2 of the fusion gene in a serial dilution manner to detect the amplification efficiency of primer pairs 1-3.

[0012] (6) Using the fusion gene detection reference product 2 as the quantitative internal standard fragment, verify whether the samples detected as negative by the fusion gene detection method are true negatives: Using the fusion gene detection reference product 2 as the quantitative calculation internal standard, within the detectable range of relative internal reference expression, calculate the ratio of the template amount of primer pair 2 to the template amount of primer pair 1 of the sample to be tested. If the ratio is 1, it is a wild-type gene, that is, a true negative; if the ratio is significantly greater than 1, there is a fusion gene in the sample to be tested, that is, a false negative; if primer pair 2 has no amplification, the sample to be tested may be a low-abundance wild-type or there is no expression of this gene, that is, a true negative; if there is only low-abundance amplification of primer pair 2 and no amplification of primer pair 1 (beyond the detection limit of primer pair 1), the sample to be tested may be a low-abundance wild-type or a low-abundance fusion type, and the sample quality is poor and cannot be judged.

[0013] Based on the above technical solution, further, the dilution concentrations in step (2) are 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL and 1 copy / μL.

[0014] Based on the above technical solution, further, in step (2), the fusion gene detection method is: Using the serially diluted fusion gene detection reference product 1 as the template, using the fusion gene specific primer, GAPDH internal reference primer, and universal primer as a combined primer, perform a PCR amplification reaction in a reaction system containing Taq enzyme, Mg 2+ , LCGreen Plus 1× dye, dNTP, and PCR buffer, and use the obtained PCR reaction product for high-resolution melting curve analysis, and obtain the LOD of this fusion gene detection method according to the high-resolution melting curve peak shape of the product.

[0015] Based on the above technical solution, further, in step (2), when the fusion gene is the ALK fusion gene, the nucleotide sequence of the fusion gene specific primer is as shown in SEQ ID NO.1-16, the nucleotide sequence of the GAPDH internal reference primer is as shown in SEQ ID NO.17-18, and the nucleotide sequence of the universal primer is as shown in SEQ ID NO.19-20.

[0016] Based on the above technical solution, further, the detection conditions for the PCR amplification reaction in step (2) are as follows: pre-denaturation at 95°C for 5 minutes, the first stage with 3 cycles, 98°C for 10 seconds, 60°C for 10 seconds, 72°C for 20 seconds, the second stage with 14 cycles, 98°C for 10 seconds, 68°C for 10 seconds, 72°C for 10 seconds, the third stage with 25 cycles, 98°C for 10 seconds, 54°C for 10 seconds, 72°C for 10 seconds; the high-resolution melting curve program: 97°C for 60 seconds, 40°C for 60 seconds, 65°C for 1 second, 97°C for 1 second.

[0017] Based on the above technical solution, further, in step (4), when the fusion gene is the ALK fusion gene, the nucleotide sequences of primer pair 1 are as shown in SEQ ID NO.21-22, the nucleotide sequences of primer pair 2 are as shown in SEQ ID NO.23-24, and the nucleotide sequences of primer pair 3 are as shown in SEQ ID NO.25-26.

[0018] Based on the above technical solution, further, in step (5), the dilution concentrations are respectively 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL and 1×10 1 copies / μL.

[0019] Based on the above technical solution, further, the reaction conditions in step (5) are as follows: 98°C for 10 seconds, 60°C for 10 seconds, 72°C for 20 seconds, for 35 cycles; the reaction system includes the fusion gene detection reference product 2 after serial dilution, primer pair 1 or primer pair 2 or primer pair 3, Taq enzyme, EvaGreen 1× dye, dNTP, and PCR buffer.

[0020] The beneficial effects of the present invention compared with the prior art are as follows:

[0021] The present invention constructs Detection Reference Product 1 and Detection Reference Product 2. The detection reference products are both connected with the internal reference gene fragment in an equal molecular number ratio, so as to simultaneously achieve the detection situation under the condition that the expression level is equivalent to that of the internal reference gene, thereby inferring whether the sample quality meets the detection standard, and realizing the determination of the lowest detection amount of the fusion gene relative to the expression amount of the internal reference gene; Detection Reference Product 1 is formed by connecting a specific ALK fusion type fragment with the internal reference gene fragment, and is used for the sensitivity analysis of the detection method of the fusion gene to be detected; Detection Reference Product 2 is formed by connecting an ALK wild-type fragment with the internal reference gene fragment, and is used for verifying whether the detection result of the detection method of the fusion gene to be detected is a false negative result. The method of the present invention provides an effective solution to the current situation that it is difficult to evaluate the fusion gene detection method, and has a very good application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] To more clearly illustrate the embodiments of the present invention, the accompanying drawings related to the embodiments will be briefly introduced below.

[0023] Figure 1 It is a schematic structural diagram of ALK Detection Reference Product 1.

[0024] Figure 2 It is the amplification curve of the simultaneous amplification of the fusion gene and the internal reference gene by ALK Detection Reference Product 1 after 7 consecutive (10×) serial dilutions (1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1 copies / μL).

[0025] Figure 3 It is the high-resolution melting curve of ALK Detection Reference Product 1 after 7 consecutive (10×) serial dilutions (1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1 copies / μL).

[0026] Figure 4 It is the amplification curve of the internal reference gene amplified by ALK Reference Product 1 after 7 consecutive (10×) serial dilutions (1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1 copies / μL).

[0027] Figure 5 For serial 7 - fold (10×) dilutions of ALK reference standard 1 (1×10 6 ,1×10 5 ,1×10 4 ,1×10 3 ,1×10 2 ,1×10 1 ,1 copies / μL), the high - resolution melting curve graph of the reference gene.

[0028] Figure 6 For serial 7 - fold (10×) dilutions of ALK reference standard 1 (1×10 6 ,1×10 5 ,1×10 4 ,1×10 3 ,1×10 2 ,1×10 1 ,1 copies / μL), the amplification curve graph of the fusion gene amplification.

[0029] Figure 7 For serial 7 - fold (10×) dilutions of ALK reference standard 1 (1×10 6 ,1×10 5 ,1×10 4 ,1×10 3 ,1×10 2 ,1×10 1 ,1 copies / μL), the high - resolution melting curve graph of the fusion gene.

[0030] Figure 8 Schematic diagram of wild - type ALK gene detection reference standard 2.

[0031] Figure 9 Schematic diagram of the fusion gene fragment amplified by primer pairs 1, 2, and 3.

[0032] Figure 10 For serial 5 - fold (10×) dilutions of ALK gene reference standard 2 (1×10 5 ,1×10 4 ,1×10 3 ,1×10 2 ,1×10 1 copies / μL), the amplification curve graph of the fusion gene amplification.

[0033] Figure 11 High - resolution melting curve analysis graph of the amplification product of primer pair 1.

[0034] Figure 12 High - resolution melting curve analysis graph of the amplification product of primer pair 2.

[0035] Figure 13 It is the high-resolution melting curve analysis diagram of the amplification product of primer pair 3. Detailed implementation manners

[0036] The present invention will be described in detail below in conjunction with embodiments. However, the implementation manners of the present invention are not limited thereto. Obviously, the embodiments described below are only partial embodiments of the present invention. For those skilled in the art, without creative efforts, obtaining other similar embodiments will fall within the protection scope of the present invention.

[0037] Embodiment 1

[0038] Sensitivity evaluation: Taking the ALK fusion gene detection and typing kit based on sandwich high-resolution melting curve analysis (invention patent: ZL201910125272.7) as an example of the fusion gene detection method, this embodiment illustrates how the present invention realizes the sensitivity evaluation of the fusion gene detection method.

[0039] 1. Evaluate the limit of detection (LOD) of this method for detecting the EML4(13)::ALK(20) fusion subtype, and construct ALK detection reference product 1 ( Figure 1 ); It is composed of the target detection fusion gene fragment and the internal reference gene fragment connected.

[0040] 2. According to the sequence information, use NanoDrop to detect the mass concentration of fusion type reference product 1. According to the known fragment sequence and fragment molecular weight, the mass concentration can be converted into copy number concentration through calculation. The specific calculation is shown in Table 1.

[0041] Table 1 Conversion results of copy number concentration

[0042]

[0043] 3. Dilute ALK detection reference product 1 (1×10 0 , 1×10 1 , 1×10 2 , 1×10 3 , 1×10 4 , 1×10 5 , 1×10 6(copies / μL) was used to measure the detection limit of this fusion gene type, and 4 replicates were used to detect this fusion gene subtype. Detection conditions: pre-denaturation at 95°C for 5 minutes, the first stage with 3 cycles of 98°C for 10 seconds, 60°C for 10 seconds, 72°C for 20 seconds, the second stage with 14 cycles of 98°C for 10 seconds, 68°C for 10 seconds, 72°C for 10 seconds, and the third stage with 25 cycles of 98°C for 10 seconds, 54°C for 10 seconds, 72°C for 10 seconds. High-resolution melting curve (HRM) program: 97°C for 60 seconds, 40°C for 60 seconds, 65°C for 1 second, 97°C for 1 second. The reaction system was 10 uL: The 20 subtype combination primers for the ALK fusion gene included: fusion gene-specific primers (0.1 uM), GAPDH internal reference primers (0.05 uM), universal primers (0.5 uM), Taq enzyme 0.05 u, Mg 2+ 2.5 mM, LCGreen Plus 1× dye, dNTP 0.2 mM, PCR buffer 1×, paraffin oil 15 uL (to prevent the reaction system from volatilizing and not participating in the reaction). Experimental instrument: LightCycler96 (Roche).

[0044] Table 2 Sequences of the subtype combination primers, internal reference primers, and universal primers for the ALK fusion gene

[0045]

[0046]

[0047] The obtained PCR reaction products were used for high-resolution melting curve analysis, and the LOD of this fusion gene detection method was obtained according to the peak shape of the high-resolution melting curve of the products. The LOD detection results of this fusion gene detection method: When there were 100 copies, the fusion gene and the internal reference gene could be stably detected in all 4 replicates. When there were 1 copy and 10 copies, although there was weak amplification, the HRM curve showed instability among replicates for the specific products. Therefore, the detection sensitivity of this method, that is, the LOD for detecting the EML4(13)::ALK(20) fusion, was not lower than 100 copies ( Figure 2 ).

[0048] The ALK detection reference product 1 was serially diluted 7 times (10×) (1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1 copies / μL), and the amplification curves of the simultaneous amplification of the fusion gene and the internal reference gene were as Figure 2 shown, and the colors red, orange, yellow, green, cyan, blue, and purple represented 1×10 6 , 1×105 ,1×10 4 ,1×10 3 ,1×10 2 ,1×10 1 ,Amplification curve of ALK reference product 1 at a concentration of 1 copy / μL.

[0049] ALK reference product 1 was serially diluted 7 times (10×) by fold dilution (1×10 6 ,1×10 5 ,1×10 4 ,1×10 3 ,1×10 2 ,1×10 1 ,1 copy / μL), and the high-resolution melting curve (negative derivative curve) is as Figure 3 shown, showing the fusion gene (high-temperature peak) and the internal reference gene product (low-temperature peak). The colors are red, orange, yellow, green, cyan, blue, and purple, representing 1×10 6 ,1×10 5 ,1×10 4 ,1×10 3 ,1×10 2 ,1×10 1 ,HRM negative derivative curve of the amplification product of ALK reference product 1 at a concentration of 1 copy / μL.

[0050] 4. Using the serially diluted detection reference product 1 as a template, the internal reference (only adding 0.05 uM of GAPDH internal reference primer and 0.5 uM of universal primer) and the fusion gene (the primer is 0.1 uM of 20 subtype combination primers of the ALK fusion gene and 0.5 uM of universal primer) were detected separately by this method. Other reaction components, reaction volume, and conditions were the same as in step 3.

[0051] The LOD detection results of the internal reference gene detected by this method were obtained: when the reference product 1 was 1000 copies, the internal reference fragment could be stably detected in all 4 replicates, and the Ct value was 21.69 ± 0.15; when the reference product 1 was 100 copies, the fusion gene fragment could be stably detected in all 4 replicates, and the Ct value was 20.62 ± 0.54. The copy number ratio of the fusion fragment to the internal reference fragment of the reference product 1 was 1:1. Therefore, the critical concentration for detecting the internal reference gene was approximately 10 times that of the critical concentration for detecting this fusion gene subtype.

[0052] When applying this method (using the ALK fusion gene detection and typing kit based on sandwich high-resolution melting curve analysis) to detect the fusion gene, if the Ct value of the amplification curve is greater than or equal to the detection limit of the internal reference gene, and if the detection of the fusion gene is negative, it should be determined that the sample quality is poor or the amount of the fusion gene is less than 1 / 10 of the amount of the internal reference gene, and it cannot meet the detection requirements, rather than a true negative result.

[0053] The amplification curves of the reference gene during 7 consecutive (10×) serial dilutions (1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1 copies / μL) of ALK reference standard 1 are shown as follows. The colors light red, light orange, light yellow, light green, light cyan, light blue, and light purple represent 1×10 Figure 4 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1 copies / μL concentration of the reference gene amplification curve of ALK reference standard 1.

[0054] The amplification curves of the reference gene during 7 consecutive (10×) serial dilutions (1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1 copies / μL) of ALK reference standard 1 are shown as follows. The colors light red, light orange, light yellow, light green, light cyan, light blue, and light purple represent 1×10 Figure 5 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1 copies / μL concentration of the HRM negative derivative curve of the reference gene amplification product of ALK reference standard 1.

[0055] The amplification curves of the fusion gene during 7 consecutive (10×) serial dilutions (1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1 copies / μL) of ALK reference standard 1 are shown as follows. The colors dark red, dark orange, dark yellow, dark green, dark cyan, dark blue, and dark purple represent 1×10 Figure 6 , 1×10 6 , 1×10 5 , 1×10 4 , 1×103 ,1×10 2 ,1×10 1 ,1 copies / μL concentration ALK reference product 1 fusion gene amplification curve

[0056] ALK reference product 1 was serially diluted 7 times (10×) in a ratio (1×10 6 ,1×10 5 ,1×10 4 ,1×10 3 ,1×10 2 ,1×10 1 ,1 copies / μL), the high-resolution melting curve (negative derivative curve) of the fusion gene is as Figure 7 shown. The colors are dark red, dark orange, dark yellow, dark green, dark cyan, dark blue, and dark purple, representing 1×10 6 ,1×10 5 ,1×10 4 ,1×10 3 ,1×10 2 ,1×10 1 ,1 copies / μL concentration ALK reference product 1 fusion gene amplification product HRM negative derivative curve

[0057] Example 2

[0058] False negative judgment, false negative judgment relative to the internal reference, using detection reference product 2.

[0059] 1. Construct wild-type ALK gene detection reference product 2 ( Figure 8 ), which is composed of the wild-type fragment of the main gene of the fusion gene and the internal reference gene fragment. The wild-type gene fragment includes the breakpoint closest to the 5' end and a partial fragment before the breakpoint (5' end), and the copy number concentration is calculated. The specific calculation is shown in Table 3.

[0060] Table 3 Conversion results of copy number concentration

[0061]

[0062] 2. Design primer pairs 1, 2, and 3. Primer pair 1 is used to amplify the fragment before the breakpoint (including the breakpoint) of the fusion gene; primer pair 2 is used to amplify the fragment after the breakpoint of the fusion gene; primer pair 3 is used to amplify the internal reference gene fragment. The schematic diagram is as Figure 9 shown.

[0063] The nucleotide sequence of primer pair 1 is:

[0064] CTCTCTGTGGTGACCTCTGC (SEQ ID NO.21),

[0065] TTCCGGCGGTACACAATCAT (SEQ ID NO.22);

[0066] The nucleotide sequence of primer pair 2 is:

[0067] GCCCTGAGTACAAGCTGAGC (SEQ ID NO.23),

[0068] AGGTCACTGATGGAGGAGGT (SEQ ID NO.24);

[0069] The nucleotide sequence of primer pair 3 is:

[0070] CAATGACCCCTTCATTGACC (SEQ ID NO.25),

[0071] GGGTGGAATCATATTGGAACA (SEQ ID NO.26).

[0072] 3. Using reference product 2 as the standard product and quantitative internal standard fragment, verify whether the samples detected as negative by this fusion gene detection method are truly negative. The specific process is as follows: Detect the amplification efficiency of primer pairs 1, 2, and 3: serially dilute (10×) ALK reference product 2 five times continuously (1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 copies / μL), and amplify them with primer pairs 1, 2, and 3 respectively. The reaction conditions are 98°C for 10 seconds, 60°C for 10 seconds, 72°C for 20 seconds, for 35 cycles. The reaction system is 10 uL: primer pair 1 or primer pair 2 or primer pair 3 (0.25 uM), Taq enzyme 0.05 u, EvaGreen 1× dye, dNTP 0.2 mM, PCR buffer 1×, paraffin oil 15 uL. Experimental instrument: LightCycler96 (Roche).

[0073] ALK reference product 2 is serially diluted (10×) five times continuously (1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 copies / μL), and the amplification curves of the fusion gene amplification are as Figure 10 shown. The orange, blue, and green curves are the amplification curves of primer pairs 1, 2, and 3 respectively. The lowest detectable copy number of primer pair 1 is 10 3 , and the lowest detectable copy numbers of primer pairs 2 and 3 are 10 2; Parameters such as the standard curve and amplification efficiency are shown in Table 4.

[0074] Table 4 Parameters of the standard curve and amplification efficiency detected by primer pairs 1, 2, and 3

[0075] Primer pair 1 Primer pair 2 Primer pair 3 Slope -4.1033 -3.6863 -3.5357 Amplification efficiency 1.75 1.87 1.92 Error value 0.42 0.38 0.28 <![CDATA[R 2 > 0.99 0.99 1 Intercept 43.51 40.3 40.62

[0076] The high-resolution melting curve analysis results of the amplification products of the above primer pair 1 (orange) are as Figure 11 shown. The high-resolution melting curve analysis results of the amplification products of the above primer pair 2 (blue) are as Figure 12 shown. The high-resolution melting curve analysis results of the amplification products of the above primer pair 3 (green) are as Figure 13 shown. The results show that for primer pair 1, when the amplification concentration is 1×10 5 , 1×10 4 , 1×10 3 copies / μL, there are specific product peaks for ALK reference product 2; for primer pairs 2 and 3, when the amplification concentration is 1×10 5 , 1×10 4 , 1×10 3 copies / μL, there are specific product peaks for reference product 2, and when the concentration is 1×10 2 copies / μL, there are weak specific product peaks for ALK reference product 2. Primer pairs 1, 2, and 3 can specifically detect the Ct values of the template amounts of 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 copies as shown in Table 5.

[0077] Table 5 Ct values of the template amounts of 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 copies specifically detected by primer pairs 1, 2, and 3

[0078]

[0079] (1) If the expression level of the internal reference gene in the sample to be tested is lower than 1×10 3 copies (Ct value ≥ 30.41 ± 0.08), even if ALK gene amplification is detected, it is impossible to distinguish whether there is a fusion, indicating that the sample quality is poor and it is difficult to detect;

[0080] (2) If the expression level of the internal reference gene in the sample to be tested > 1×10 3Copy (Ct value < 30.41 ± 0.08), and the amplification of primer pair 1 (Ct value < 31.2 ± 0.2) and primer pair 2 (Ct value < 29.67 ± 0.14) can be detected simultaneously, and the amplification template amount ratio of the corresponding primer pair 2 to primer pair 1 is about 1:1, indicating the expression of wild-type ALK gene in the sample;

[0081] (3) If the expression level of the internal reference gene in the sample to be tested > 1 × 10 3 Copy (Ct value < 30.41 ± 0.08), and only the specific amplification of primer pair 2 (Ct value < 29.67 ± 0.14) can be detected, but there is no amplification of primer pair 1, or low-abundance amplification far lower than that of primer pair 2, that is, the template amount ratio of the corresponding primer pair 2 to primer pair 1 is significantly greater than 1:1, indicating the expression of ALK fusion gene in the sample;

[0082] (4) If the expression level of the internal reference gene in the sample to be tested > 1 × 10 3 Copy (Ct value < 30.41 ± 0.08), and only the low-abundance specific amplification of primer pair 2 (Ct value > 29.67 ± 0.14) can be detected. Whether the amplification of primer pair 1 is detected (beyond the detection limit of this fragment) or not, the sample may be low-abundance wild-type or fusion-type ALK expression, and it cannot be determined whether there is ALK fusion.

[0083] Example 3

[0084] Evaluate the samples with negative ALK fusion gene detected by immunohistochemistry in clinical application

[0085] Select 27 cDNA samples from paraffin-embedded lung cancer tissues (preservation time > 5 years). All tissues were detected as negative for ALK fusion gene by immunohistochemistry, and determine whether these samples are truly negative for ALK fusion gene.

[0086] Using the 27 cDNA samples to be tested as templates, and using ALK reference product 2 (1 × 10 3 Copies / μL) as a control (to verify that this PCR reaction has a similar amplification efficiency to step 3 of Example 2), and amplify the target fragment with primer pairs 1, 2, and 3 (0.25 μM) respectively using the same reaction system and conditions as in step 3 of Example 2.

[0087] Results showed that: The amplification results of the three primer pairs of the ALK reference product 2 control sample were close to those in Step 3 of Example 2. Calculated using the standard curve in Step 3, the concentration ratio of the three target fragments of this control sample was 1:1:1, indicating that the PCR reaction in this experiment had an amplification efficiency approximately the same as that in Step 3. The amplification Ct values of the 27 samples to be tested are shown in Table 6. Specific internal reference products could be detected in all samples. Among them, for 3 samples, the amplification Ct value of internal reference primer pair 3 was greater than 30.41±0.08, and the sample quality was poor, making it difficult to determine whether ALK fusion existed; for 16 samples, only internal reference primer pair 3 amplified, and the Ct value was less than 30.41±0.08, indicating a negative ALK fusion gene; for 8 samples, internal reference primer pair 3 amplified, and the Ct value was less than 30.41±0.08. At the same time, specific amplification of primer pair 2 was also observed, but the Ct values were all greater than 29.67±0.14, suggesting that the ALK gene content in the samples was too low to determine whether the ALK gene was wild-type expressed or there was a fusion.

[0088] Table 6 Amplification Ct values of 27 samples to be tested

[0089]

[0090]

[0091] Finally, it should be noted that: The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: They can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for evaluating the detection effect of a fusion gene detection method, characterized in that: The steps include: (1) According to the method and fusion gene to be evaluated, construct fusion gene detection reference product 1 and fusion gene detection reference product 2, wherein the fusion gene detection reference product 1 is composed of a fusion gene fragment and an internal reference gene fragment connected in a 1:1 ratio, and the fusion gene detection reference product 2 is composed of a fusion gene main gene wild-type fragment and an internal reference gene fragment connected in a 1:1 ratio, and quantify the molecular copy number concentration of the fusion gene detection reference product 1 and the fusion gene detection reference product 2; (2) diluting the fusion gene detection reference substance 1 in multiple proportions to determine the detection limit of the fusion gene type by the fusion gene detection method; (3) detecting the internal reference gene and the fusion gene separately according to the detection process of step (2) to obtain the detection limit of the fusion gene relative to the internal reference gene in the low-quality and low-concentration sample by the detection method; (4) Designing primer pair 1, primer pair 2, and primer pair 3, wherein primer pair 1 is used to amplify the fragment before the fusion gene is broken (which may include the breakpoint); primer pair 2 is used to amplify the fragment after the fusion gene is broken; and primer pair 3 is used to amplify the internal reference gene fragment; (5) diluting the fusion gene detection reference product 2 in multiple proportions to detect the amplification efficiency of primer pairs 1-3; (6) Using fusion gene detection reference product 2 as the quantitative internal standard fragment, verify whether the sample detected as negative by the fusion gene detection method is a true negative: Using fusion gene detection reference product 2 as the quantitative calculation internal standard, calculate the ratio of the template amount of primer pair 2 of the sample to be tested to the template amount of primer pair 1 within the detectable range of the relative internal reference expression. If the ratio is 1, it is a wild-type gene, that is, a true negative; if the ratio is significantly greater than 1, the sample to be tested contains a fusion gene, that is, a false negative; if primer pair 2 does not amplify, the sample to be tested may be a low-abundance wild type or no expression of the gene, that is, a true negative; if primer pair 2 alone amplifies at a low abundance, while primer pair 1 does not amplify (exceeding the detection limit of primer pair 1), the sample to be tested may be a low-abundance wild type or a low-abundance fusion type, and the sample quality is poor and cannot be determined.

2. The method according to claim 1, characterized in that The dilution concentrations in step (2) were 1×10 6 copies / μL, 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 copies / μL and 1copy / μL.

3. The method according to claim 1, characterized in that The fusion gene detection method in step (2) is as follows: using the diluted fusion gene detection reference product 1 as a template, using the fusion gene specific primer, GAPDH internal reference primer, and universal primer as a combination primer, in a mixture containing Taq enzyme, Mg 2+ PCR amplification reaction was carried out in the reaction system of LCGreen Plus 1× dye, dNTP and PCR buffer, and the obtained PCR reaction products were used for high-resolution melting curve analysis. The LOD of the fusion gene detection method was obtained according to the peak shape of the high-resolution melting curve of the products.

4. The method according to claim 3, characterized in that In step (2), when the fusion gene is the ALK fusion gene, the nucleotide sequence of the fusion gene-specific primer is shown in SEQ ID NO.1-16, the nucleotide sequence of the GAPDH internal reference primer is shown in SEQ ID NO.17-18, and the nucleotide sequence of the universal primer is shown in SEQ ID NO.19-20.

5. The method according to claim 4, characterized in that The detection conditions of the PCR amplification reaction in step (2) are as follows: pre-denaturation at 95°C for 5 minutes, 3 cycles in the first stage, 98°C for 10 seconds, 60°C for 10 seconds, and 72°C for 20 seconds, 14 cycles in the second stage, 98°C for 10 seconds, 68°C for 10 seconds, and 72°C for 10 seconds, and 25 cycles in the third stage, 98°C for 10 seconds, 54°C for 10 seconds, and 72°C for 10 seconds; high-resolution melting curve program: 97°C for 60 seconds, 40°C for 60 seconds, 65°C for 1 second, and 97°C for 1 second.

6. The method according to claim 1, characterized in that In step (4), when the fusion gene is the ALK fusion gene, the nucleotide sequence of primer pair 1 is shown as SEQ ID NO.21-22, the nucleotide sequence of primer pair 2 is shown as SEQ ID NO.23-24, and the nucleotide sequence of primer pair 3 is shown as SEQ ID NO.25-26.

7. The method according to claim 1, characterized in that The dilution concentrations in step (5) were 1×10 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL and 1×10 1 copies / μL.

8. The method according to claim 7, characterized in that The reaction conditions in step (5) are: 98° C. for 10 seconds, 60° C. for 10 seconds, 72° C. for 20 seconds, and 35 cycles; the reaction system includes the fusion gene detection reference material 2 after multiple dilution, primer pair 1 or primer pair 2 or primer pair 3, Taq enzyme, EvaGreen 1× dye, dNTP, and PCR buffer.

Images