A molecular marker related to egg production and peak egg weight and application thereof

Abstract

The application relates to the field of livestock breeding technology, and discloses a molecular marker related to egg weight at the beginning of production and in the peak period and application thereof, the molecular marker being a nucleotide shown in the 251th position of SEQ ID NO:1, which is A or G. The disclosed SNP site is significantly related to egg weight at the beginning of production and in the peak period. Early selection of egg weight at the beginning of production and in the peak period can be realized by detecting the SNP site. In addition, the application also provides a set of specific primers for identifying the above-mentioned SNP molecular marker. With the aid of the molecular marker and the matching primers, the detection work of the SNP site can be rapidly completed. Based on this, the present research establishes a high-efficiency and accurate molecular marker assisted breeding technology system for the egg weight at the beginning of production and in the peak period, which can realize early selection of the egg weight at the beginning of production and in the peak period, accelerate the breeding process, reduce the breeding cost, and has significant application value.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of livestock breeding, in particular to a molecular marker related to egg weight at onset and peak period and application thereof. BACKGROUND

[0002] Chicken is an important agricultural animal, which provides high-quality and reasonably-priced animal products such as chicken and eggs rich in protein. As a key economic trait in the egg industry, egg weight has significant differences in the preferences of consumers in different regions and for different production purposes, for example, liquid egg processing prefers large egg type, and processed eggs such as marinated eggs prefer small egg type. This leads to differences in egg weight selection strategies for different breeds. Traditional selection methods require multiple measurements of egg weight at different growth stages, which is not only time-consuming and labor-intensive, but also has slow genetic progress.

[0003] Genome-wide association study (GWAS) is one of the main means to identify genetic variations associated with complex traits. Finding genomic genetic variation sites associated with egg weight is of great significance for implementing molecular selection to accelerate genetic progress. Using SNP and other molecular markers for genetic variation selection can achieve early and accurate selection of traits, thereby further improving the efficiency of breeding target traits at the genetic level. SUMMARY

[0004] Based on the deficiencies of conventional breeding techniques, the present application screens a SNP molecular marker at position 76007941 from the 5' end of chromosome 4 associated with egg weight at onset and peak period, and establishes a detection method for the SNP molecular marker. In view of this, the present application provides a molecular marker related to egg weight at onset and peak period and application thereof, aiming to provide a more efficient and accurate method for breeding hens.

[0005] The present application provides a SNP molecular marker related to egg weight at onset and peak period in chickens, which is the nucleotide at position 251 in SEQ ID NO: 1, which is A or G.

[0006] The present application also provides an application of a substance for detecting polymorphism or genotype of the SNP molecular marker, which at least includes one of the following:

[0007] A1) application in identifying or assisting in identifying egg weight at onset and peak period in chickens;

[0008] A2) application in chicken breeding;

[0009] A3) application in preparing chicken breeding products;

[0010] The SNP molecular marker is a nucleotide at position 251 in SEQ ID NO: 1, which is A or G.

[0011] The SNP molecular marker is a nucleotide at position 251 in SEQ ID NO: 1, which is A or G.

[0012] Preferably, when the SNP molecular marker is AA type, the genotype is the dominant genotype of large egg weight in the laying and peak period; when the SNP molecular marker is GG type, the genotype is the dominant genotype of small egg weight in the laying and peak period.

[0013] The application further provides a primer pair for identifying individuals with high or low egg weight in the laying and peak period, wherein the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 2, and the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO: 3.

[0014] The application further provides an application of the primer pair for identifying individuals with high or low egg weight in the laying and peak period, and the application at least comprises one of the following:

[0015] B1) application in identifying or assisting in identifying the egg weight trait of chickens in the laying and peak period;

[0016] B2) application in chicken breeding;

[0017] B3) application in preparing a chicken breeding product.

[0018] The application further provides a method for identifying or assisting in identifying the egg weight in the laying and peak period, comprising:

[0019] detecting the genotype of the SNP in the chicken to be tested, wherein when the SNP molecular marker is AA type, the genotype is the dominant genotype of large egg weight in the laying and peak period; and when the SNP molecular marker is GG type, the genotype is the dominant genotype of small egg weight in the laying and peak period.

[0020] The SNP molecular marker is a nucleotide at position 251 in SEQ ID NO: 1, which is A or G.

[0021] The application further provides a method for chicken breeding, comprising:

[0022] detecting the genotype of the SNP in the chicken to be tested, selecting the parent with AA genotype for large egg weight line breeding, and selecting the parent with GG genotype for small egg weight line breeding.

[0023] The application further provides a product containing a substance for detecting the polymorphism or genotype of the SNP molecular marker.

[0024] Preferably, the product is any one of the following:

[0025] C1) products for detecting single nucleotide polymorphisms or genotypes of the loci associated with onset egg weight and peak egg weight;

[0026] C2) products for identifying or assisting in identifying onset egg weight and peak egg weight;

[0027] C3) products for chicken breeding.

[0028] Compared with the prior art, the beneficial effects of the present application are:

[0029] A more efficient and accurate method for breeding laying hens is provided, which can realize early and accurate selection of onset egg weight and peak egg weight traits, thereby significantly improving the efficiency of breeding laying hens. By using the SNP molecular marker proposed in the present application, breeding of onset egg weight and peak egg weight traits can be carried out at the genetic level, avoiding the shortcomings of time-consuming, labor-intensive and slow genetic progress in traditional breeding methods. At the same time, the primer pair and its application proposed in the present application further facilitate the detection of SNP molecular markers and the identification of genotypes, providing a powerful tool for breeding of laying hens. In addition, the product proposed in the present application contains substances for detecting the polymorphism or genotype of the SNP molecular marker, which can be widely used in the practice of breeding of laying hens and promote the development of the egg industry. BRIEF DESCRIPTION OF DRAWINGS

[0030] Various other advantages and benefits will become apparent to those of ordinary skill in the art upon reading the following detailed description of the preferred embodiments. The accompanying drawings are intended to further aid the full and complete understanding of the present application. The same reference numerals are used throughout the drawings to represent the same components. In the drawings:

[0031] Figure 1 Manhattan plot for onset egg weight;

[0032] Figure 2 Manhattan plot for peak egg weight at 44 weeks of age. DETAILED DESCRIPTION

[0033] Exemplary embodiments of the present disclosure will be described in detail with reference to the accompanying drawings. Although exemplary embodiments of the present disclosure are shown in the drawings, it should be understood that the present disclosure can be implemented in various forms and should not be limited by the embodiments set forth herein. Rather, these embodiments are provided so that the present disclosure can be more thoroughly and completely understood, and so that the scope of the present disclosure can be accurately conveyed to those skilled in the art. It should be noted that the embodiments in the present application and the features in the embodiments can be combined with each other without conflict. The present application will be described in detail below with reference to the accompanying drawings and in conjunction with the embodiments. The test methods used in the following embodiments are conventional methods unless otherwise specified. Consumables, reagents, etc. used are conventional commercially available products unless otherwise specified.

[0034] Example 1 Identification of SNP molecular markers associated with egg weight of chickens at onset of lay and peak egg production

[0035] 1. Experimental animals

[0036] In this study, 203 Laiyang chickens were used, and free access to feed and water was provided during the feeding period. The feeding standards followed the relevant regulations of the industry standard (NY / T 33-2004).

[0037] 2. Phenotype determination

[0038] The egg weight of the first three eggs at onset of lay and the egg weight at 44 weeks of age during peak egg production were determined.

[0039] 3. Extraction of genomic DNA

[0040] 0.5 mL of blood was collected from the wing vein of all test chickens using an anticoagulant vacuum blood collection tube. Whole genome DNA was extracted using the phenol-chloroform extraction method. The concentration and purity of the DNA samples were detected, and agarose gel electrophoresis was performed to further detect the purity and integrity of the DNA samples. The sample concentration was required to be greater than 50 ng / μL, the purity OD260 / 280 was 1.8-2.0, and the integrity was good. The DNA samples were stored at -20℃ for later use.

[0041] 4. Genome resequencing

[0042] All DNA samples of the test chickens were subjected to individual whole genome resequencing using the DNBSEQ sequencing platform according to the standard operating procedure, with a sequencing depth of about 15x. BWA and GATK software were used for sequence alignment and genotype extraction. After further quality control using SNPcall rate and MAF, 7,498,204 SNPs and 203 individuals were obtained for subsequent analysis.

[0043] 5. Whole genome association analysis

[0044] After the pedigree data, phenotype data, and genomic SNP site data were sorted out, whole genome association analysis was performed using GCTA software. The single variable mixed linear model was:

[0045] y = Xb + jα + u + e;

[0046] y is the phenotype value; b is the fixed effect (including population effect and cage position effect), X is the corresponding relationship matrix; j is the additive genotype of the SNP site to be detected, α is the additive SNP effect; u is the random animal effect, which is subject to where G is the genomic additive relationship matrix, is the additive genetic variance; e is the residual effect subject to where I is the identity matrix, is the residual variance. The whole genome range FDR value was calculated using R package qvalue, and the significant threshold was FDR < 0.01 (P = 1.66E-05 for egg weight at first laying, P = 1.87E-05 for egg weight at 44 weeks of age). The results of GWAS analysis are shown in Figure 1 and Figure 2 The egg weight was significantly associated with a 1.33 Mb region on chromosome 4 (Chr4:75236136-76566458), and further validation of all loci in the genome-wide association region was performed, and the chr4:76007941 locus was locked as a candidate locus. Table 1 shows the genetic markers affecting the egg weight at first laying and at 44 weeks of age.

[0047] Table 1

[0048]

[0049] Example 2 Correlation between different genotypes of the chr4:76007941 locus and egg weight of chicken

[0050] 1. Experimental animals

[0051] Refer to Example 1.

[0052] 2. Phenotype determination

[0053] Refer to Example 1.

[0054] 3. Extraction of genomic DNA

[0055] Refer to Example 1.

[0056] 4. Genotyping of the chr4:76007941 locus

[0057] Refer to Example 1.

[0058] 5. Determination of the advantageous genotype of the phenotype

[0059] At the chr4:76007941 locus, the egg weight at first laying of the individual chicken with GG genotype was 44.42 g, the egg weight at first laying of the individual chicken with GA genotype was 46.06 g, and the egg weight at first laying of the individual chicken with AA genotype was 49.11 g; at 44 weeks of age, the egg weight of the individual chicken with GG genotype was 59.14 g, the egg weight of the individual chicken with GA genotype was 60.85 g, and the egg weight of the individual chicken with AA genotype was 62.47 g. The data show that the AA genotype is associated with a larger egg weight advantage, and the GG genotype is associated with a smaller egg weight advantage. Table 2 shows the egg weight performance of individuals with different genotypes at the chr4:76007941 SNP locus of chicken.

[0060] Table 2

[0061]

[0062] ab: means in the same column, different letters represent significant difference between groups (P <0.05).

[0063] Example 3: Establishment of a molecular marker detection method for the site chr4:76007941 and its application in breeding

[0064] 1. Construction of a molecular marker detection method

[0065] Based on the DNA sequence information adjacent to the site chr4:76007941 published in the Ensembl database, specific primers were designed and synthesized for PCR amplification. The nucleotide sequence of SEQ ID NO: 1 corresponds to the region of 250 bases adjacent to the 76007941th nucleotide from the 5' end on chromosome 4 and its adjacent upstream and downstream. SEQ ID NO: 1:

[0066] CCCAAGGAGGTTGTGGATGCCCCATCCCTGGACGCATTCAAGGCCAGGCTGGATTTTGCTCTGAGCAGCCTGGTCTAGTGATTGGCAACCCTGCACATAGCAGGGGGGTTGAAACTCGATGATCATTATGGTCCTTTTCAACCCAGGCCGTTCTATGATTCTATGATCAGCTTGCTTCCTTCAGAAAGGTGCTGCAATCACACGTTGGCACAAGGAAATGGCGTTTCTTAAGGGCATACAAATGATGGAGG / ATGTTGGAAGAG ATAAATGAAAACCTGACTCAGGATAACTTTGAAGGGACTGGGTTTTGATCCAGAAAACATAAGAACAGAGGAAGGACATGGTAACATGCTCCAGTACGTTCCAGTATTTTGAACAGTGCTATAAAAACAGTGACAATCAATTATTCTCCGTGTCCACTGGGGGTAGGATAAGAAGAACTGAACCCAATTTGCAGAAAAGAGTATTTAGGTTAGATATTAGGAAATGTTTCTAATTACGA.

[0067] The primer sequences are shown in Table 3, and the PCR amplification system and conditions are shown in Tables 4 and 5, respectively. The amplified products were analyzed by one-generation sequencing technology to determine the genotype of the site chr4:76007941. The genotype results include AA, AG, and GG types.

[0068] Table 3

[0069] Primer Name Sequence Corresponding Number in Sequence Listing Upstream Primer TGAGCAGCCTGGTCTAGTGA SEQ ID NO: 2 Downstream Primer TCTGGATCAAAACCCAGTCC SEQ ID NO: 3

[0070] Table 4

[0071] Reagent Volume (pL) ddH2O 8.0 2x Taq Plus Master Mix 10.0 Upstream Primer (10 pM) 0.5 Downstream Primer (10 pM) 0.5 Genomic DNA 1.0 Total 20.0

[0072] Table 5

[0073]

[0074] 2. Selective breeding of egg weight using the chr4:76007941 site molecular marker

[0075] Beijing oil chicken 229 individuals were used as the research object. Beijing oil chicken is a local breed, and the eggshell is pink. Consumers prefer the "grass chicken eggs" characterized by pink shell and small egg weight. Therefore, the breeding of Beijing oil chicken aims to select small egg weight individuals for breeding small egg weight new breeds and varieties. At 3 weeks of age, blood samples were collected from the research object, and genomic DNA was extracted according to the procedure of Example 1(3). The sequence of the target site was amplified using specific primers, and genotyping was performed by first-generation sequencing technology. Among the obtained genotypes, the number of GG genotype individuals was 188, the number of GA genotype individuals was 41, and no AA genotype individual was detected. Based on the advantage genotype of small egg weight, GG type individuals were preferentially selected. Subsequently, these chickens were raised to the laying period, and the egg weight at the onset of laying and at 44 weeks of age were determined. The experimental results are shown in the table, the average egg weight at the onset of laying of GG genotype individuals is 40.04 grams, and the egg weight at 44 weeks of age is 51.09 grams; while the average egg weight at the onset of laying of GA genotype individuals is 41.90 grams, and the egg weight at 44 weeks of age is 53.40 grams. Table 6 is the correlation between different genotypes of chicken chr4:76007941 SNP site and egg weight.

[0076] Table 6

[0077]

[0078] ab: Different letters in the same column indicate significant differences (P < 0.05) between groups.

[0079] 3. Conclusion

[0080] The present application successfully identifies a single nucleotide polymorphism (SNP) molecular marker chr4:76007941 associated with chicken egg weight at onset of lay and egg weight at 44 weeks of age, and constructs a corresponding molecular marker detection technology. By measuring the egg weight of individuals with different genotypes, the research results show that the AA genotype is significantly associated with larger egg weight advantage, and the GG genotype is associated with smaller egg weight advantage. This finding provides a key genetic marker for chicken genetic breeding, and helps to breed chicken varieties that meet market demand in terms of egg weight characteristics. At the same time, the present application also demonstrates the application potential of genomics technology in the field of animal breeding, and provides a new perspective and methodology for the future development of genetic improvement and breed selection. Specifically, using the molecular marker of chr4:76007941 site for selection significantly improves the selection efficiency, enabling breeding experts to quickly identify and breed chicken with target egg weight characteristics. This method not only shortens the breeding cycle, but also improves the accuracy of selection, introducing a new technical means for chicken breeding. In addition, the molecular marker detection method constructed by the present application has the advantages of simple operation, accurate and reliable results, and is suitable for large-scale breeding practice.

[0081] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, but not to limit it, although the present application has been described in detail with reference to the above examples, those skilled in the art should understand that: the specific embodiments of the present application can still be modified or replaced by the equivalent, without departing from the spirit and scope of the present application. Any modification or equivalent replacement without departing from the spirit and scope of the present application should be covered within the protection scope of the claims of the present application.

Claims

1. An application of a substance for detecting the genotype of SNP molecular markers, characterized in that, The application includes at least one of the following: A1) Application in identifying or assisting in the identification of egg weight traits at the onset of egg production and at 44 weeks of age in chickens; A2) Application in chicken breeding; A3) Application in the preparation of chicken breeding products; The SNP molecular marker is a single nucleotide polymorphism in the chicken genome; the SNP molecular marker is the nucleotide shown at position 251 in SEQ ID NO: 1, which is either A or G; When the genotype of the SNP molecular marker is AA, this genotype is the dominant genotype for the onset of egg production and large egg weight at 44 weeks of age; when the genotype of the SNP molecular marker is GG, this genotype is the dominant genotype for the onset of egg production and small egg weight at 44 weeks of age. The chicken breeding specifically involves using the genotype of the SNP molecular marker to breed chickens that start laying eggs and have target egg weight characteristics at 44 weeks of age.

2. An application of a primer pair for detecting the genotype of an SNP molecular marker, characterized in that, The application includes at least one of the following: B1) Application in identifying or assisting in the identification of egg weight traits at the onset of egg production and at 44 weeks of age in chickens; B2) Application in chicken breeding; B3) Application in the preparation of chicken breeding products; The nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 2; the nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO: 3; The SNP molecular marker is a single nucleotide polymorphism in the chicken genome; the SNP molecular marker is the nucleotide shown at position 251 of SEQ ID NO: 1, which is either A or G; When the genotype of the SNP molecular marker is AA, this genotype is the dominant genotype for the onset of egg production and large egg weight at 44 weeks of age; when the genotype of the SNP molecular marker is GG, this genotype is the dominant genotype for the onset of egg production and small egg weight at 44 weeks of age. The chicken breeding specifically involves using the genotype of the SNP molecular marker to breed chickens that start laying eggs and have target egg weight characteristics at 44 weeks of age.

3. A method for identifying or assisting in the identification of the start of egg production and egg weight at 44 weeks of age in chickens, characterized in that, include: The genotype of SNP molecular markers in the test chickens was detected. When the genotype of SNP molecular markers in the test chickens was AA, this genotype was the dominant genotype for laying eggs at the start of production and for large egg weight at 44 weeks of age; when the genotype of SNP molecular markers in the test chickens was GG, this genotype was the dominant genotype for laying eggs at the start of production and for small egg weight at 44 weeks of age. The SNP molecular marker is the nucleotide shown at position 251 of SEQ ID NO: 1, which is either A or G.

4. A method for breeding chicken strains with different egg weights at the onset of egg production and at 44 weeks of age, characterized in that, include: The genotypes of SNP molecular markers in the chickens to be tested were detected. Parents with genotype AA were selected for breeding large-egg-weight lines, and parents with genotype GG were selected for breeding small-egg-weight lines. The SNP molecular marker is the nucleotide shown at position 251 of SEQ ID NO: 1, which is either A or G.

5. An application of a product, characterized in that, The product contains a substance for detecting genotypes of SNP molecular markers; The application of the product includes at least one of the following: C1) Identification or auxiliary identification of chickens at the onset of egg production and egg weight at 44 weeks of age; C2) is used for chicken breeding; The SNP molecular marker is the nucleotide shown at position 251 of SEQ ID NO: 1, which is either A or G; The chicken breeding specifically involves using the genotype of the SNP molecular marker to breed chickens that start laying eggs and have target egg weight characteristics at 44 weeks of age.

Images