Primer probe combination, detection method and kit for identifying bulbus fritillariae cirrhosae through LMTIA technology and application of primer probe combination
Through LMTIA technology, the specific primer probe combination was designed and combined with Proofman-LMTIA technology, the problem of Fritillaria citrus adulteration detection was solved, and fast and accurate detection was achieved, simplifying the process and reducing costs.
Patent Information
- Application Number
- CN202510648278.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-06-27
AI Technical Summary
The prior art is difficult to quickly, easily and accurately identify whether Fritillaria kebayashi and its derivative products are adulterated with other Fritillaria. Especially in the production, processing and circulation links, there are problems such as long detection time, high equipment requirements and high cost.
The specific primer probe combination was designed using LMTIA technology, and combined with Proofman-LMTIA technology, the rapid identification of the components of Fritillaria kebayashi. This method has good specificity and sensitivity, with an absolute sensitivity of up to 100fg/μL, simplifying the detection process and reducing costs.
It realizes rapid and accurate detection of Fritillaria kebayashi and its derivative products, can effectively identify trace adulteration, simplify the detection process, reduce costs, and improve detection speed, which is of great practical significance.
Smart Images

Figure CN120210422A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of nucleic acid detection in molecular biology, and particularly to a primer-probe combination, a detection method, a kit and an application thereof for identifying Fritillaria cirrhosa D. Don. by LMTIA technology. Background Art
[0002] Fritillaria medicinal materials are the bulbs of Fritillaria plants and are traditional Chinese medicinal materials with effects such as relieving cough and asthma. Fritillaria cirrhosa D. Don. is a precious Chinese medicinal material. The first volume of the Chinese Pharmacopoeia (2020 Edition) clearly stipulates its 6 plant sources, namely the dried bulbs of Fritillaria cirrhosa D. Don., Fritillaria unibracteata Hsiao et K.C. Hsia., Fritillaria przewalskii Maxim., Fritillaria delavayi Franch., Fritillaria taipaiensis P.Y. Li or Fritillaria unibracteata Hsiao et K.C. Hsia var. wabuensis (S.Y. Tang et S.C. Yue) Z.D. Liu, S. Wang et S.C. Chen of the genus Fritillaria in the family Liliaceae. Due to the complex sources, scarce resources and large demand of Fritillaria cirrhosa D. Don., there are serious adulteration phenomena in the market and it is difficult to supervise. Common adulterants of Fritillaria cirrhosa D. Don. include Fritillaria thunbergii Miq., Fritillaria thunbergii Miq. var. chekiangensis Hsiao et K.C. Hsia, Fritillaria anhuiensis Hsiao et K.C. Hsia, Fritillaria walujewii Regel and non-Fritillaria medicinal materials (such as Tulipa edulis (Miq.) Baker, Bolbostemma paniculatum (Maxim.) Franquet), etc. Fritillaria thunbergii Miq. and Fritillaria thunbergii Miq. var. chekiangensis Hsiao et K.C. Hsia become the main adulteration targets because of their similar morphology and low price. Some merchants also cover up the characteristics of adulterants by means such as dyeing, weight gain or mixing and doping (such as adding 10%-20% Fritillaria thunbergii Miq.), increasing the difficulty of identification.
[0003] The methods for determining the contents of main pharmacodynamic components provided in the Chinese Pharmacopoeia (2020 Edition) include methods such as character, microscopic identification, thin-layer chromatography and high performance liquid chromatography (HPLC), etc., but all have limitations in practical applications: character identification is highly subjective, microscopic identification requires professional equipment, thin-layer chromatography depends on expensive reference standards, and HPLC requires precision instruments and professional operations. In addition, since Fritillaria thunbergii Miq. var. chekiangensis Hsiao et K.C. Hsia is relatively similar in morphology to Fritillaria cirrhosa D. Don. var. unibracteata Hsiao et K.C. Hsia, and when the original medicinal materials are ground into powder or processed into drugs as raw materials, they cannot be distinguished and identified by the naked eye.
[0004] At present, the molecular identification of Fritillaria cirrhosa mainly relies on DNA barcoding technology and PCR-RFLP methods. Although these methods have improved the accuracy of identification, they still have many limitations. DNA barcoding technology requires PCR amplification and sequencing comparison. The whole process relies on expensive PCR instruments and sequencers, with complex operation procedures and long detection cycles. Although the PCR-RFLP method is included in the 2020 edition of the Chinese Pharmacopoeia to distinguish Fritillaria cirrhosa from common counterfeits, it still requires multiple steps such as PCR amplification, enzyme digestion, and gel electrophoresis. It is not only time-consuming, but also has high requirements for experimental equipment and operating techniques. It is difficult to promote and apply it in grassroots testing and market supervision. Therefore, the development of a detection technology that does not rely on complex instruments, is simple and fast to operate, and can accurately identify trace adulteration is of great practical significance for ensuring the quality of Fritillaria cirrhosa, maintaining market order, and ensuring drug safety. Summary of the invention
[0005] The purpose of the present invention is to provide a primer-probe combination, a detection method, a kit and its application for identifying Fritillaria cirrhosa by LMTIA technology to solve the problems existing in the above-mentioned prior art. The primer-probe combination provided by the present invention has good specificity and sensitivity, an absolute sensitivity of up to 100fg / μL, and a fast detection speed, which can effectively solve the problem of whether Fritillaria cirrhosa and its derivative products are adulterated with other Fritillaria cirrhosa in the production, processing and circulation links, greatly simplifying the detection process, reducing costs, and shortening the detection time. It has important practical significance for ensuring the quality of Fritillaria cirrhosa medicinal materials, maintaining market order and ensuring drug safety.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The invention provides an LMTIA primer-probe combination for detecting components of Fritillaria cirrhosa, comprising a primer set and a probe, wherein the primer set consists of a primer F1 with a sequence as shown in SEQ ID NO.1, a primer B1 with a sequence as shown in SEQ ID NO.2, and a primer LB with a sequence as shown in SEQ ID NO.3; and the sequence of the probe is shown in SEQ ID NO.4.
[0008] Optionally, two ends of the probe are connected to a fluorescence quenching group and a fluorescent group respectively.
[0009] The present invention also provides a kit for detecting components of Fritillaria cirrhosae, comprising the LMTIA primer-probe combination.
[0010] The present invention also provides the application of the LMTIA primer-probe combination or the kit in the detection of components of Fritillaria cirrhosa.
[0011] The present invention also provides a method for detecting Fritillaria cirrhosa based on the Proofman-LMTIA technology, comprising the following steps: obtaining the genomic DNA of a sample to be tested, using the genomic DNA as a template, and performing a Proofman-LMTIA reaction with the primer-probe combination described above to detect whether the sample to be tested is Fritillaria cirrhosa;
[0012] If a fluorescence signal appears in the fluorescence channel and an exponential amplification curve appears, it is determined that the sample to be tested is Fritillaria cirrhosa;
[0013] If no fluorescence signal appears in the fluorescence channel and no exponential amplification curve appears, it is determined that the sample to be tested is not Fritillaria cirrhosa.
[0014] Optionally, the system of the Proofman-LMTIA reaction comprises: 5 μL of 2×Mix premix, 0.4 μL of 2 U / μL ultra-fidelity DNA polymerase, 0.16 μL of 10 μmol / L primer F1, 0.16 μL of 10 μmol / L primer B1, 0.04 μL of 10 μmol / L primer LB, 0.4 μL of 10 μmol / L probe Probe, 2 μL of template DNA, and 1.84 μL of DEPC-treated water.
[0015] Further, the components of the 2×Mix premix include 40 mM Tris-HCl (pH 8.8, 25 °C), 20 mM KCl, 20 mM (NH4)2SO4, 12 mMol MgSO4, 0.2% Triton X-100, and 2.4 mM dNTP.
[0016] Optionally, the program of the LMTIA reaction is: 66 °C, isothermal amplification for 20 minutes.
[0017] Further, during the LMTIA reaction, fluorescence signals are collected once every 30 s, and a total of 40 fluorescence signals are collected.
[0018] The present invention also provides the application of the LMTIA primer-probe combination or the kit described above in the authenticity identification of Fritillaria cirrhosa medicinal materials.
[0019] The present invention discloses the following technical effects:
[0020] In view of the problem of adulteration of Fritillaria cirrhosa medicinal materials, the present invention designs a specific LMTIA primer-probe combination for detecting the components of Fritillaria cirrhosa. This primer-probe combination has good specificity and sensitivity, with an absolute sensitivity of up to 100 fg / μL, and a fast detection speed. It can detect the components of Fritillaria cirrhosa in Fritillaria samples under isothermal conditions.
[0021] The present invention establishes a method for rapidly identifying the components of Fritillaria cirrhosa D. Don through the Proofman-LMTIA technology based on a specific primer-probe combination, which can effectively solve the problem of detecting whether other fritillaria are adulterated in the production, processing, and circulation of Fritillaria cirrhosa D. Don and its derivatives, greatly simplifies the detection process, reduces the cost, and shortens the detection time. It has important practical significance for ensuring the quality of Fritillaria cirrhosa D. Don medicinal materials, maintaining market order, and ensuring medication safety. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0023] Figure 1 It is a diagram of the partial ITS1 sequence alignment analysis results of Fritillaria cirrhosa D. Don, Fritillaria thunbergii Miq., Fritillaria ussuriensis Maxim., Fritillaria walujewii Regel, and Fritillaria pallidiflora Schrenk;
[0024] Figure 2 It is a melting temperature curve diagram of the LMTIA detection target sequence of Fritillaria cirrhosa D. Don;
[0025] Figure 3 It is a diagram of the enzyme digestion detection results of the pUC57-ITS1-5.8S rRNA-ITS2 plasmid of Fritillaria cirrhosa D. Don;
[0026] Figure 4 It is a diagram of the enzyme digestion detection results of the pUC57-ITS1-5.8S rRNA-ITS2 plasmid of Fritillaria thunbergii Miq.;
[0027] Figure 5 It is a diagram of the enzyme digestion detection results of the pUC57-ITS1-5.8S rRNA-ITS2 plasmid of Fritillaria ussuriensis Maxim.;
[0028] Figure 6 It is a diagram of the enzyme digestion detection results of the pUC57-ITS1-5.8S rRNA-ITS2 plasmid of Fritillaria walujewii Regel;
[0029] Figure 7 It is a diagram of the enzyme digestion detection results of the pUC57-ITS1-5.8S rRNA-ITS2 plasmid of Fritillaria pallidiflora Schrenk;
[0030] Figure 8Results of temperature optimization and specificity test for the Proofman-LMTIA detection reaction of Fritillaria cirrhosa D. Don. Among them, A is the amplification curve with different samples as templates at 64 °C; B is the amplification curve with different samples as templates at 66 °C; C is the amplification curve with different samples as templates at 65 °C; D is the amplification curve with different samples as templates at 67 °C;
[0031] Figure 9 It is a graph of the sensitivity test results of the Proofman-LMTIA detection method for Fritillaria cirrhosa D. Don.
[0032] Figure 10 These are the results of detecting Fritillaria samples by the Proofman-LMTIA detection method of the present invention. Detailed implementation manners
[0033] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention.
[0034] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.
[0035] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0036] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are only exemplary.
[0037] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, that is, they are intended to include but not limited to.
[0038] Based on the sequence characteristics of Internal Transcribed Spacer 1 (ITS1), a rapid detection technique was developed for Fritillaria cirrhosa D. Don, a traditional Chinese medicine, and its processed products using the LMTIA molecular identification method. Due to the multi-copy characteristics of the ITS1 sequence in the plant genome, it provides a reliable molecular marker for solving the problem of partial degradation of genomic DNA during the processing of medicinal materials. In this invention, the ITS1 sequence was selected as the detection target, and through the designed specific primers and probes, combined with the Proofman-LMTIA technology, the efficient authenticity identification of Fritillaria cirrhosa D. Don and its processed products was achieved.
[0039] Ladder-shape melting temperature isothermal amplification (LMTIA) is a new isothermal nucleic acid amplification technology developed by Wang Deguo et al. on the basis of the loop-mediated isothermal amplification (LAMP) technology. Using a pair of primers under the action of Bst DNA polymerase, the primers recognize the ladder-shaped melting temperature target region of the target sequence, and stable amplification of nucleic acids can be achieved at a specified temperature. For the technical principle of the LMTIA technology, see Wang Deguo, et al. Ladder-shape melting temperature isothermal amplification of nucleic acids. Biotechniques, 2021, 71(1): 358-369, or Patent CN2020111054053 or PCT / CN2020 / 133584).
[0040] The reagents used in the examples of this invention are all common molecular biology experimental reagents, and the instruments are all standard equipment in a molecular biology laboratory. All primers were synthesized by Shanghai Genry Biotech Co., Ltd. Unless otherwise specified, the methods used in the examples of this invention are all conventional molecular biology methods.
[0041] Example 1 Design of LMTIA Primer Set, Probe and Construction of Template DNA Plasmid
[0042] 1. Design of LMTIA Primer Set and Probe
[0043] Using the ITS1 sequence of the Fritillaria cirrhosa D. Don genome as the target sequence, DNMAN 9 software was used for alignment and analysis to screen the differential sequences between Fritillaria cirrhosa D. Don and Fritillaria thunbergii Miq., Fritillaria ussuriensis Maxim., Fritillaria walujewii Regel, and Fritillaria pallidiflora Schrenk ( Figure 1 ), and through Oligo 7 software, for the characteristic differential sequences in the ITS1 sequence of Fritillaria cirrhosa D. Don, regions with a ladder-shaped or semi-ladder-shaped melting temperature Tm were found ( Figure 2)。The primers of LMTIA and the Proofman probe were designed using Primer 3Plus (http: / / www.primer3plus.com). After extensive screening and optimization, the primer sets and probes with the following sequences were obtained. The specific sequences are shown in Table 1.
[0044] Table 1 Sequences of the primer sets and probe of LMTIA
[0045]
[0046] 2. Extraction and detection of genomic DNA
[0047] Take 50 g of dried Fritillaria cirrhosa D. Don, and grind it into powder using a Chinese herbal medicine grinder. Weigh 100 mg of the sample, and extract genomic DNA using a high-efficiency plant genomic DNA extraction kit (DP350, Tiangen Biochemical Technology (Beijing) Co., Ltd.). After extraction, use a ultra-micro nucleic acid and protein analyzer (Nanodrop One, Thermo Fisher Scientific, USA) to measure the concentration and purity of the genomic DNA, and screen DNA samples with an A 260 / A 280 ratio of 1.6 - 2.0, and store them at -20 °C in the refrigerator for later use.
[0048] 3. Preparation of the Fritillaria cirrhosa D. Don pUC57-ITS1-5.8S rRNA-ITS2 plasmid
[0049] Using the Fritillaria cirrhosa D. Don genomic sequence as a template, amplify the sequence fragment containing ITS1, 5.8S rRNA, and ITS2. The amplification primers are as follows:
[0050] Forward primer: ATGCGATACTTGGTGTGAAT, SEQ ID NO.5;
[0051] Reverse primer: GACGCTTCTCCAGACTACAAT, SEQ ID NO.6.
[0052] Ligate the amplified Fritillaria cirrhosa D. Don ITS1, 5.8S rRNA, and ITS2 sequence fragment (a total of 500 bp) to the pUC57 plasmid, and entrust General Biology (Anhui) Co., Ltd. to prepare and construct the Fritillaria cirrhosa D. Don pUC57-ITS1-5.8S rRNA-ITS2 plasmid. The plasmid digestion results of the plasmid containing the Fritillaria cirrhosa D. Don ITS1, 5.8S rRNA, and ITS2 sequences are as Figure 3 shown. Subsequently, use the plasmid as the DNA template for temperature optimization and the construction of the Proofman-LMTIA method.
[0053] Using the same method, plasmids containing the ITS1, 5.8S rRNA, and ITS2 sequences of Fritillaria thunbergii, Fritillaria ussuriensis, Fritillaria walujewii, and Fritillaria pallidiflora were constructed successively for subsequent specific verification tests. The plasmid digestion results of the ITS1, 5.8S rRNA, and ITS2 sequences of Fritillaria thunbergii, Fritillaria ussuriensis, Fritillaria walujewii, and Fritillaria pallidiflora are shown respectively as Figures 4 - 7 shown.
[0054] Example 2 Temperature Optimization and Specificity Detection of the Proofman-LMTIA Reaction System for Fritillaria cirrhosa
[0055] The temperature optimization experiment of the Proofman-LMTIA reaction system was combined with the specificity test.
[0056] In a laminar flow hood, add the following reaction system to a 100 μL PCR tube:
[0057] 5 μL of 2× Mix premix (40 mM Tris-HCl (pH 8.8, 25 °C), 20 mM KCl, 20 mM (NH4)2SO4, 12 mMol MgSO4, 0.2% Triton X-100, 2.4 mM dNTP), 0.4 μL of GPV8 ultra-high-fidelity DNA polymerase (2 U / μL, Anhui Global Gene Technology Co., Ltd.), 0.16 μL of primer F1 (10 μmol / L), 0.16 μL of primer B1 (10 μmol / L), 0.04 μL of loop primer LB (10 μmol / L), 0.4 μL of Proofman probe Probe (10 μmol / L), 2 μL of 1 ng / μL plasmid template DNA, and 1.84 μL of DEPC-treated water.
[0058] Use the Gentier 96E fully automatic medical PCR analysis system for detection. Use DEPC-treated water and plasmid DNA containing the ITS1, 5.8S rRNA, and ITS2 sequences of Fritillaria ussuriensis, Fritillaria thunbergii, Fritillaria walujewii, and Fritillaria pallidiflora with a size of 500 bp as negative controls, and use the Fritillaria cirrhosa pUC57-ITS1-5.8S rRNA-ITS2 plasmid DNA as a positive control. The reaction temperatures are 66 °C, 67 °C, 68 °C, and 69 °C respectively. Set the number of cycles to 40, collect fluorescence signals once every 30 s, and collect 40 fluorescence signals in total. Two parallel samples are set for the experiment.
[0059] In the sample detection tube after the reaction is completed, if a fluorescence signal can be detected in the green fluorescence channel (FAM), and an exponential amplification curve appears in the amplification result graph, it can be determined that the detected sample is a positive result; if no fluorescence signal can be detected in the green fluorescence channel (FAM), and no exponential amplification curve appears in the amplification result graph, it can be determined that the detected sample is a negative result.
[0060] The temperature optimization test results are as follows Figure 8 As shown, the reaction temperature was 64 - 66°C. For the plasmid DNA containing the target sequences of Fritillaria thunbergii var. ussuriensis, F. thunbergii, F. walujewii, and F. pallidiflora, and DEPC-treated water, there was no amplification. Only for the 2 samples of the plasmid DNA of F. cirrhosa pUC57-ITS1-5.8SrRNA-ITS2, amplification occurred. The amplification efficiency at a reaction temperature of 66°C was higher than that at reaction temperatures of 64°C and 65°C. When the reaction temperature was 67°C, for the plasmid DNA containing the target sequences of F. thunbergii var. ussuriensis, F. walujewii, and F. pallidiflora, and DEPC-treated water, there was no amplification. For the plasmid DNA containing the target sequence of F. thunbergii, one sample showed false positive amplification, and for the 2 samples of the plasmid DNA of F. cirrhosa pUC57-ITS1-5.8S rRNA-ITS2, amplification occurred. When the reaction temperature was 66°C, the amplification efficiency was the highest. Compared with F. thunbergii var. ussuriensis, F. thunbergii, F. walujewii, and F. pallidiflora, the Proofman-LMTIA method established in the present invention has strong specificity for the detection of F. cirrhosa. 66°C was selected as the optimal reaction temperature for the Proofman-LMTIA reaction of F. cirrhosa.
[0061] Example 3 Sensitivity test of the Proofman-LMTIA detection method for F. cirrhosa
[0062] The extracted genomic DNA of F. cirrhosa was diluted to 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, and 100 fg / μL respectively. Using DEPC-treated water as the negative control, it was added to the optimized Proofman-LMTIA reaction system (same as Example 2). Each reaction was set with two parallel samples, the temperature was set at 66°C, and the fluorescence signal was collected once every 30 s for a total of 40 times to determine the best reaction result.
[0063] The sensitivity test results are as follows Figure 9 As shown, the genomic DNA of F. cirrhosa at 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, and 100 fg / μL all had good amplification, while the DEPC-treated water did not amplify. Therefore, the sensitivity of this method is 100 fg / μL of the genomic DNA of F. cirrhosa. Under the Proofman-LMTIA reaction system established in Example 2 of the present invention, the genomic DNA of F. cirrhosa extracted from the sample can be detected when it reaches 100 fg / μL, and the sensitivity is high.
[0064] Example 4 Proofman-LMTIA detection of Fritillaria samples
[0065] The samples of F. cirrhosa, F. thunbergii, F. thunbergii var. ussuriensis, F. walujewii, F. pallidiflora, and F. hupehensis for detection were provided by the Henan Institute for Drug and Medical Device Control.
[0066] Extract genomic DNA according to the method of Example 1 and perform detection according to the method of Example 2. Use the Gentier96E fully automatic medical PCR analysis system for the reaction, set the temperature at 66°C, collect fluorescence signals once every 30 s, and collect 40 fluorescence signals in total. Set 3 parallel samples for each reaction.
[0067] The results are as Figure 10 shown. Amplification curves were obtained for the parallel samples of the 3 samples of Fritillaria cirrhosa D. Don. No amplification occurred for the samples of Fritillaria thunbergii Miq. var. chekiangensis Hsiao et K. C. Hsia, Fritillaria thunbergii Miq., Fritillaria walujewii Regel, Fritillaria pallidiflora Schrenk, and Fritillaria hupehensis Hsiao et K. C. Hsia, as well as the negative control DEPC-treated water, indicating that this method can be used for the rapid detection of the authenticity of Fritillaria cirrhosa D. Don components.
[0068] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. A LMTIA primer-probe combination for detecting components of Fritillaria cirrhosa, characterized in that: It comprises a primer set and a probe, wherein the primer set consists of a primer F1 with a sequence as shown in SEQ ID NO.1, a primer B1 with a sequence as shown in SEQ ID NO.2 and a primer LB with a sequence as shown in SEQ ID NO.3; and the sequence of the probe is shown in SEQ ID NO.
4.
2. The LMTIA primer-probe combination according to claim 1, characterized in that: The two ends of the probe are connected to a fluorescence quenching group and a fluorescent group respectively.
3. A kit for detecting components of Fritillaria cirrhosa, characterized in that: Comprising the LMTIA primer-probe combination of claim 1 or 2.
4. Use of the LMTIA primer-probe combination according to claim 1 or 2 or the kit according to claim 3 in the detection of components of Fritillaria cirrhosa.
5. A method for detecting Fritillaria cirrhosa based on Proofman-LMTIA technology, characterized in that: The following steps are involved: Obtaining genomic DNA of the sample to be tested, using the genomic DNA as a template, and performing a Proofman-LMTIA reaction using the primer-probe combination of claim 1 or 2 to detect whether the sample to be tested is Fritillaria cirrhosa; If a fluorescent signal appears in the fluorescent channel and an exponential amplification curve appears, it is determined that the sample to be tested is Fritillaria cirrhosa; If no fluorescent signal appears in the fluorescent channel and no exponential amplification curve appears, it is determined that the sample to be tested is not Fritillaria cirrhosa.
6. The method according to claim 5, characterized in that The Proofman-LMTIA reaction system includes: 5 μL of 2×Mix premix, 0.4 μL of 2U / μL ultra-fidelity DNA polymerase, 0.16 μL of 10 μmol / L primer F1, 0.16 μL of 10 μmol / L primer B1, 0.04 μL of 10 μmol / L primer LB, 0.4 μL of 10 μmol / L probe Probe, 2 μL of template DNA and 1.84 μL of DEPC-treated water.
7. The method according to claim 5, characterized in that The procedure of the LMTIA reaction is: isothermal amplification at 66°C for 20 minutes.
8. Use of the LMTIA primer-probe combination according to claim 1 or 2 or the kit according to claim 3 in authenticity identification of Fritillaria cirrhosa.