Method for regulating blood coagulation and / or platelet function
By regulating the formation and function of migratory bodies derived from neutrophils, the unknown role of migratory bodies in the regulation of coagulation and platelet function is solved, and effective regulation of coagulation and repair of platelet function is achieved.
Patent Information
- Application Number
- CN202280101254.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-25
- Publication Date
- 2025-06-27
AI Technical Summary
The role and regulation of migratory bodies in regulating coagulation and/or platelet function is not known in the prior art.
A migratory body is provided as a method for regulating coagulation by regulating the formation and/or function of migratory bodies derived from neutrophils.
Effective regulation of coagulation and platelet functions has been achieved, showing that migratory bodies play an important role in the coagulation process, and that excessive bleeding caused by neutrophil removal can be rescued through exogenous migratory bodies.
Smart Images

Figure CN120225660A_ABST
Abstract
Description
Background Art
[0001] Migrasomes are recently discovered organelles of migrating cells. During migration, the trailing edge of a cell pulls out contractile fibers, and migrasomes grow at the branch points or ends of these contractile fibers. Eventually, when the cell migrates away, the contractile fibers break, and the migrasomes are left behind. Migrasomes play important roles in various biological processes; for example, during zebrafish embryonic development, migrasomes rich in chemokine CXCL12 are concentrated in the embryonic shield cavity, and CXCL12 acts as a chemokine to guide the migration of dorsal leading cells. Therefore, migrasomes play important roles in organ morphogenesis. In addition, migrasomes have been shown to mediate the horizontal transfer of mRNA between cells.
[0002] Migrasomes have been observed in various biological settings and have been shown to play important physiological roles in vivo. However, the role and regulation of migrasomes in modulating blood coagulation and / or platelet function are unclear. Summary of the Invention
[0003] The present disclosure provides a method for modulating blood coagulation and / or platelet function, the method comprising modulating the formation and / or function of migrasomes derived from neutrophils.
[0004] The present disclosure provides a method for modulating blood coagulation, the method comprising providing a migrasome derived from neutrophils.
[0005] The present disclosure provides a migrasome derived from neutrophils.
[0006] The present disclosure provides a reagent for modulating the formation and / or function of migrasomes derived from neutrophils.
[0007] The present disclosure provides an engineered cell that has an altered ability to modulate blood coagulation and / or platelet function compared to a corresponding unmodified cell, and the engineered cell has been modified to alter its migrasome generation ability.
[0008] The present disclosure provides a composition comprising the migrasome, reagent, and / or engineered cell described above in this application.
[0009] The present disclosure provides a kit comprising the migrasome, reagent, engineered cell, and / or composition described above in this application.
[0010] The present disclosure provides a method for monitoring blood coagulation and / or platelet function, the method comprising analyzing the presence, quantity, and / or function of migrasomes obtained from a biological sample.
[0011] The present disclosure provides a method for modulating blood coagulation and / or platelet function, the method comprising: (i) monitoring blood coagulation according to the method described above in the present application; and (ii) administering a modulator according to the result of step (i).
[0012] The present disclosure provides a method for monitoring migrasomes derived from neutrophils, the method comprising analyzing the presence and / or amount of a marker molecule of the migrasomes.
[0013] The present disclosure provides a method for isolating platelets, the method comprising excluding migrasomes derived from neutrophils from a sample.
[0014] The present disclosure provides a composition comprising platelets isolated by the isolation method described above in the present application.
[0015] The present disclosure provides a kit comprising the platelets and / or composition isolated as described above in the present application.
[0016] From the following detailed description, other aspects and advantages of the present disclosure will be apparent to those skilled in the art, in which only exemplary embodiments of the present disclosure are shown and described. It should be realized that the present disclosure is capable of other and different embodiments, and several details thereof can be modified in various obvious aspects, all of which do not depart from the scope of the present disclosure. Therefore, the drawings and description should be regarded as illustrative rather than restrictive. Incorporation by reference
[0017] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference with the same effect as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. Description of the Drawings
[0018] The novel features of the invention are set forth in detail in the appended claims. The features and advantages of the invention will be better understood by reference to the following detailed description, which shows and describes exemplary embodiments of the invention and is accompanied by drawings (hereinafter also referred to as "FIG." and "FIG.").
[0019] Figures 1a - 1q show that circulating neutrophils generate a large number of neutrophil migrasomes in blood vessels. a. Schematic diagram of the in vivo imaging process of the mouse liver. b. In vivo imaging of neutrophils in the mouse liver. Neutrophils were labeled with PE anti - mouse Ly6G (green). AF647 - WGA labeled blood vessels (purple). Scale bar 30 μm (top image), 10 μm (magnified image). Arrows indicate migrasomes. c. Schematic diagram of the process for preparing samples for ImageStream imaging flow cytometry analysis. d. Whole blood was diluted and stained with PE anti - mouse Ly6G and APC anti - mouse CD41 for imaging flow cytometry analysis. Neutrophil migrasomes (R3: Ly6G + ) and platelets (R4: CD41 + ) were screened from the small particle population (R2). e. Images of neutrophil migrasomes (R3: Ly6G TMSchematic illustration of the positive (top) and negative (bottom) separation processes of neutrophil migrasomes in mouse blood using the Mouse Neutrophil Enrichment Kit. psNeuMig: positively selected neutrophil migrasomes; nsNeuMig: negatively selected neutrophil migrasomes. l. SEM image of anti-Ly6G conjugated magnetic beads and positively selected neutrophil migrasomes. Scale bar 1 μm. m. Flow cytometry analysis of negatively selected neutrophil migrasomes (nsNeuMig, see subsequent figures for reference) stained with PE anti-mouse Ly6G. Particles positively selected using the kit magnetic beads were used as a control (Ctrl, see subsequent figures for reference). Samples from 20 mice were pooled and analyzed together. n. SEM image of negatively selected neutrophil migrasomes incubated with anti-Ly6G conjugated magnetic beads. Scale bar 1 μm. o. Percentages of positively selected (ps-NeuMig, positively selected neutrophil migrasomes, see subsequent figures for reference) and negatively selected (ns-NeuMig, negatively selected neutrophil migrasomes, see subsequent figures for reference) migrasomes with or without fiber. Ps-NeuMig group, n = 43; ns-NeuMig group, n = 54. p. Western blot analysis of purified extracellular structures and NETs using NETs and migrasome marker (Mig). q. Flow cytometry analysis of negatively selected neutrophil migrasomes stained with PE anti-mouse Ly6G and Annexin-V. Normal bone marrow cells (BM-ctrl) and UV-irradiated bone marrow cells (BM-UV) were used as negative and positive staining controls for PS exposure, respectively.
[0020] Figures 2a - 2j show that coagulation factors are enriched in neutrophil migrasomes. a. Volcano plot showing the differential abundance of proteins in positively selected neutrophil migrasomes and platelets. Migrasomes and platelets were isolated and subjected to label - free quantitative mass spectrometry analysis. Yellow dots represent migrasome / platelet abundance ratio ≥2, P < 0.05; cyan dots represent migrasome / cell abundance ratio < 0.5, P < 0.05. n = 3 independent biological experiments. b. Heat map showing the distribution of coagulation factors in platelets and neutrophil migrasomes. c. Western blot analysis of coagulation factors in platelets, positively selected neutrophil migrasomes (psNeuMig), and s - plasma. s - plasma is the supernatant after centrifuging plasma at 20000g for 1 hour (plasma supernatant). d. Western blot analysis of coagulation factors (plasma supernatant) in platelets, negatively selected neutrophil migrasomes (nsNeuMig), and s - plasma. e. Western blot analysis of coagulation factors in neutrophils, platelets, and positively selected neutrophil migrasomes (psNeuMig). f. Schematic diagram of the process of incubating purified migrasomes with plasma after digestion with proteinase K (PK). g. Western blot analysis of coagulation factors in crude extracellular structures (C - ES) (Ctrl), proteinase K - digested C - ES (PK), proteinase K - digested then incubated with s - plasma C - migrasomes (PK - s - Pla), and s - plasma (s - Pla). h. Western blot analysis of coagulation factors in platelets (Ctrl), proteinase K - digested platelets (PK), proteinase K - digested then incubated with s - plasma platelets (PK - s - Pla), and s - plasma (S - plasma). i. Western blot analysis of coagulation factors in negatively selected neutrophil migrasomes (nsNeuMig) (Ctrl), proteinase K - digested nsNeuMig (PK), and proteinase K - digested then incubated with s - plasma nsNeuMig (PK - s - Pla). j. Western blot analysis of coagulation factors in positively selected neutrophil migrasomes (psNeuMig) (Ctrl), proteinase K - digested psNeuMig (PK), and proteinase K - digested then incubated with s - plasma psNeuMig (PK - s - Pla).
[0021] Figures 3a - 3g show neutrophil migrasomes activating platelets in vitro. a. Detection of thrombin activity using an internally quenched 5-FAM / QXL-520 fluorescence resonance energy transfer (FRET) substrate. Migrasomes or platelets were isolated and mixed with the thrombin substrate for fluorescence detection with an Enspire microplate reader. b. Flow cytometry analysis of platelet activation. Platelets were isolated from mouse blood and stimulated with PBS, thrombin, or nsNeuMig, respectively. CD62P indicates platelet activation. c. Flow cytometry analysis of platelet activation. Platelets were isolated from mouse blood and stimulated with PBS, thrombin, or nsNeuMig, respectively. SSC and FSC indicate platelet morphology. d. Platelets activated by thrombin or neutrophil migrasomes stained with the indicated antibodies and imaged with three-dimensional (3D) confocal microscopy. Scale bar 20 μm. e. Measurement of the diameter and size of platelet (Ctrl) and thrombin- and nsNeuMig-induced platelet aggregates. Control (Ctrl): n = 104 platelets; Thrombin: n = 106 platelet aggregates; nsNeuMig: n = 138 platelet aggregates. Data are presented as mean ± standard error of the mean (s.e.m.). ****P < 0.0001. P values were calculated using a two-tailed unpaired t-test. f. SEM images of platelets activated in vitro with thrombin or nsNeuMig. Yellow arrows indicate migrasomes labeled with anti-Ly6G-conjugated beads. Cyan arrows indicate platelets. Scale bar for the three left panels is 2 μm. The magnified migrasomes and platelets are within the dashed box on the right. Scale bar 1 μm. g. Measurement of platelet protrusion length. Control group: n = 61 platelets; Thrombin: n = 64 platelets; nsNeuMig: n = 62 platelets. Data are presented as mean ± standard error of the mean (s.e.m.). Control vs Thrombin P = 0.1673. Control vs nsNeuMig P < 0.0001. P values were calculated using a two-tailed unpaired t-test.
[0022] Figures 4a - 4o demonstrate the necessity of neutrophil migrasomes in blood clotting. a. Schematic diagram of the process of mouse liver injury and in vivo imaging. b. Imaging of the injured liver. WGA - AF488 labels blood vessels; PE anti - Ly6G labels neutrophils and migrasomes; APC anti - CD41 labels platelets. Scale bar: 50 μm. The white dashed line indicates the wound boundary. c. Schematic diagram of the mouse tail tip bleeding assay. d. Results of the mouse tail tip bleeding assay in mice with neutrophils removed or platelets removed. e. Statistical analysis of the bleeding volume from the results in d; n = 5 mice per group. Data are presented as mean ± standard error of the mean (s.e.m.). Control vs Anti - Ly6G P = 0.0175. Control vs Anti - CD41 P = 0.0105. P - values were calculated using a two - tailed unpaired t - test. f. Results of the mouse tail tip bleeding assay in mice with neutrophils removed by intravenous injection of or without nsNeuMig. g. Statistical analysis of the bleeding volume from the results in f; n = 5 mice per group. Data are presented as mean ± standard error of the mean (s.e.m.). Control vs Anti - Ly6G P = 0.0107. Anti - Ly6G vs Anti - Ly6G+nsNeuMig P = 0.0024. P - values were calculated using a two - tailed unpaired t - test. h. Imaging of the liver injury in control mice (Ctrl) and mice with neutrophils removed. WGA - AF488 labels blood vessels; PE anti - Ly6G / 6C labels neutrophils and migrasomes; APC anti - CD41 labels platelets. Scale bar: 200 μm. The white dashed line indicates the wound boundary. i. Statistical analysis of the relative fluorescence intensity of CD41 (platelets) enriched near the wound boundary in h; n = 8 mice per group. Data are presented as mean ± standard error of the mean (s.e.m.). Control vs Anti - Ly6G P = 0.0038. Anti - Ly6G vs Anti - Ly6G+nsNeuMig P = 0.0029. P - values were calculated using a two - tailed unpaired t - test. j. Quantitative analysis of neutrophil migrasomes in the blood of Tspan9flox / flox; LysM - CreWT / WT (T9f / f; CreW / W) and Tspan9flox / flox; LysM - CreT / T (T9f / f; CreT / T) mice by ImageStream analysis. For the T9f / f; CreW / W group, n = 13 mice; for the T9f / f; CreT / T group, n = 16 mice. T9f / f; CreW / W group vs T9f / f; CreT / T group, P = 0.0020. Data are presented as mean ± standard error of the mean (s.e.m.). P - values were calculated using a two - tailed unpaired t - test.k. Western blot analysis of Ly6G and integrin α5 in the crude extracellular structures from the blood of T9f / f; CreW / W and T9f / f; CreT / T mice. l. In vivo imaging of neutrophils in the livers of T9f / f; CreW / W and T9f / f; CreT / T mice. PE anti-mouse Ly-6G / 6C labels neutrophils and migrasomes; AF647-WGA labels blood vessels. Scale bar, 20 μm. m. Quantitative analysis of neutrophil migrasomes in Fig. l. T9f / f; CreW / W group, n = 306 cells from 3 mice. T9f / f; CreT / T group, n = 348 cells from 3 mice. P < 0.0001. Data are presented as mean ± standard error of the mean (s.e.m.). P values were calculated using two-tailed unpaired t-tests. n. Tail-tip bleeding assay in T9f / f; CreW / W and T9f / f; CreT / T mice. n = 5 mice per group. Scale bar, 1 cm. o. Statistical analysis of bleeding volume. Ctrl group, n = 18 mice; T9f / f; CreT / T and T9f / f; CreT / T + nsNeuMig groups, n = 17 mice. T9f / f; CreW / W vs T9f / f; CreT / T, P = 0.0049. T9f / f; CreT / T vs T9f / f; CreT / T + nsNeuMig, P = 0.0740. Data are presented as mean ± standard error of the mean (s.e.m.). P values were calculated using two-tailed unpaired t-tests.
[0023] Figures 5a - 5i show the isolation and characterization of neutrophil migrasomes. a. Blood cells were lysed with ACK buffer and centrifuged at 1000 g for 5 minutes to remove red blood cells. The remaining cells were stained with PE anti - mouse Ly6G and APC anti - mouse CD41. Flow cytometry analysis was performed by CytoFLEX. b. Blood cells were lysed with ACK buffer and centrifuged at 1000 g for 5 minutes to remove red blood cells. The remaining cells were stained with PE anti - mouse Ly6G and APC anti - mouse CD41. Cell sorting was performed using MoFlo Astrios EQ and imaged with a Dragonfly spinning - disk confocal microscope. Scale bar 20 μm. c. Isolated platelets were stained with PE anti - mouse Ly6G and APC anti - mouse CD41 and imaged with a Dragonfly spinning - disk confocal microscope. Scale bar 10 μm. d. Flow cytometry analysis of whole blood cells from control mice (left panel), neutrophil - depleted mice (middle panel), and platelet - depleted mice (right panel). Samples from five mice were pooled and analyzed together. e. Flow cytometry analysis of purified platelets (PLT) and crude extracellular structures (C - ES). PLT and C - ES were stained with PE anti - mouse Ly6G and APC anti - mouse CD41. Samples from five mice were pooled and analyzed together. f. Scanning electron microscope (SEM) image of crude extracellular structures (C - ES) from the blood of platelet - depleted mice. Scale bar 10 μm. g. SEM image of purified platelets from the blood of neutrophil - depleted mice. Scale bar 10 μm. h. SEM image of negatively selected neutrophil migrasomes (nsNeuMig) incubated with anti - Ly6G - conjugated magnetic beads. Scale bar 10 μm. The magnified image of the migrasome within the dashed box is shown on the right. Scale bar 1 μm. i. Three - dimensional (3D) confocal microscope image of crudely isolated neutrophil migrasomes stained with FITC - Annexin - V and PE anti - Ly6G / 6C. Scale bar 10 μm.
[0024] Figures 6a - 6i show the enrichment of neutrophil migrasomes in wounds and their involvement in blood clotting. a. Imaging of the liver in the uninjured area. Neutrophil migrasomes are labeled with PE anti - Ly6G / 6C; platelets are labeled with APC anti - CD41. Scale bar: 20 μm. b. Imaging of the injured liver after injection of exogenous neutrophil migrasomes. Blood vessels are labeled with WGA - AF488; neutrophil migrasomes are labeled with PE anti - Ly6G / 6C. Scale bar: 20 μm. The white dashed line indicates the wound boundary. c. Flow cytometry analysis of blood cells from control mice (left panel), neutrophil - depleted mice (middle panel), and platelet - depleted mice (right panel). Samples from five mice were pooled and analyzed together. d. Quantitative analysis of neutrophil migrasomes in the blood of wild - type mice (WT) and Tspan9− / − mice by ImageStream analysis; n = 12 WT mice, n = 11 Tspan9− / − mice. WT vs Tspan9− / − P = 0.0011. Data are presented as mean ± standard error of the mean (s.e.m.). P - values were calculated using two - tailed unpaired t - tests. e. Western blot analysis of Ly6G and integrin α5 in crude extracellular structures from the blood of WT and Tspan9− / − mice. f. Tail - tip bleeding assay in wild - type mice (WT) and Tspan9− / − mice after injection of PBS or migrasomes; n = 5 mice per group. g. Statistical analysis of the bleeding volume from the results of f. Wild - type mice (WT) vs Tspan9− / − P = 0.0308. Tspan9− / − vs Tspan9− / −+nsNeuMig P = 0.0060. Data are presented as mean ± standard error of the mean (s.e.m.). P - values were calculated using two - tailed unpaired t - tests. h. Suture imaging of liver wounds in WT and Tspan9− / − mice. Blood vessels are labeled with WGA - AF488; neutrophils and migrasomes are labeled with PE anti - Ly6G / 6C; platelets are labeled with APC anti - CD41. Scale bar: 200 μm. The white dashed line indicates the wound boundary. i. Statistical analysis of relative fluorescence intensity representing CD41 (platelets) enriched near the wound boundary. n = 6 mice in the wild - type mice (WT) group; n = 7 mice in the Tspan9− / − and Tspan9− / −+nsNeuMig groups. Data are presented as mean ± standard error of the mean (s.e.m.). WT vs Tspan9− / − P = 0.0164. Tspan9− / − vs Tspan9− / −+nsNeuMig P = 0.0138. P - values were calculated using two - tailed unpaired t - tests. DETAILED DESCRIPTION OF THE INVENTION
[0025] While various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. Numerous variations, changes, and substitutions can be made without departing from the present invention. It should be understood that various alternatives to the embodiments of the present invention described in this application can be employed.
[0026] As used herein, the term "antibody" generally refers to a polypeptide molecule capable of specifically recognizing and / or neutralizing a particular antigen. For example, an antibody can include an immunoglobulin of at least one or more heavy chains (H) and / or one or more light chains (L), and includes any molecule containing its antigen-binding portion. The term "antibody" includes monoclonal antibodies, antibody fragments, or antibody derivatives, including but not limited to human antibodies, humanized antibodies, chimeric antibodies, single-chain antibodies (such as scFv), and antigen-binding fragments of antibodies (such as Fab, Fab’, VHH, and (Fab)2 fragments).
[0027] As used herein, the term "antigen-binding fragment" generally refers to one or more fragments of an antibody for specifically binding an antigen. The antigen-binding function of an antibody can be achieved by the full-length fragment of the antibody. The antigen-binding function of an antibody can also be achieved by the following fragments: heavy-chain fragments including Fv, ScFv, dsFv, VHH, Fab, Fab’, or F(ab’)2, or light-chain fragments including Fv, ScFv, dsFv, Fab, Fab’, or F(ab’)2. It includes (1) Fab fragment, which is a monovalent fragment including VL, VH, CL, and CH domains; (2) F(ab’)2 fragment, which is a bivalent fragment composed of two Fab fragments linked by a hinge-region disulfide bond; (3) Fd fragment, which includes VH and CH domains; (4) Fv fragment, which includes VL and VH domains on one antibody arm; (5) dAb fragment, which includes the VH domain (Ward et al. (1989) Nature 341:544-546); (6) isolated complementarity-determining regions (CDRs); and (7) two or more isolated CDRs optionally linked by a linker. In addition, it can also include single-chain molecule Fv (scFv) formed by pairing VL and VH (see Bird et al. (1988) Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. 85:5879-5883).
[0028] As used herein, the term "engineered" generally refers to the modification of one or more nucleic acids (such as nucleic acids in an organism's genome), polypeptides, or other components. The term "engineered" can refer to the modification, addition, and / or deletion of genes, polypeptides, or other components. The term "engineered cell" generally refers to a modified cell of human or non-human origin. For example, an engineered cell can refer to a cell in which genes, polypeptides, or other components have been added, deleted, and / or modified.
[0029] As used herein, the term "ex vivo method" generally refers to a method in which substantially all steps are performed outside of an organism (such as an animal or a human). For example, an ex vivo method can be performed in an external environment or on tissue extracted from an organism with minimal alteration of natural conditions. The tissue can be removed in a variety of ways, including in part, as an entire organ, or as a larger organ system. For example, in an ex vivo method, a sample to be tested can be extracted from an organism. For example, the use of live cells or tissues from the same organism can also be considered an ex vivo method. One widely performed ex vivo study is the chicken embryo chorioallantoic membrane (CAM) assay. In this assay, angiogenesis is performed on the CAM membrane outside of the chicken embryo.
[0030] As used herein, the term "in vivo method" generally refers to a method of testing the effects of various biological entities on a whole organism or cell (usually an animal, including humans and plants), rather than on tissue extracts or dead organisms. For example, an in vivo method can be performed in a whole organism, rather than in its isolated cells.
[0031] As used herein, the term "in vitro method" generally refers to an experimental method for microorganisms, cells, or biomolecules outside of their normal biological environment. For example, an in vitro method can be performed in laboratory equipment such as test tubes, flasks, culture dishes, and microplates. An in vitro method can use components of an organism that have been isolated from their normal biological environment. For example, microorganisms or cells can be studied in a culture medium, and proteins can be examined in solution.
[0032] As used herein, the term "functional fragment" generally refers to a fragment that has a region of a full-length protein or nucleic acid but retains or partially retains the biological activity or function of the full-length protein or nucleic acid.
[0033] As used herein, the term "functional variant" generally refers to a nucleic acid molecule or polypeptide that has an amino acid or nucleic acid sequence similar to the parent sequence and retains one or more properties of the parent sequence.
[0034] As used herein, the term "gene knockdown" generally refers to a measurable decrease in the expression level of a target mRNA or the corresponding protein in a genetically modified cell or organism relative to that in a control cell or organism that does not contain such genetic modification. Those skilled in the art will readily understand how to knockdown a target polynucleotide sequence using various genetic methods such as siRNA, shRNA, microRNA, antisense RNA, or other RNA-mediated inhibitory techniques.
[0035] As used herein, the term "gene knockout" generally includes deleting all or part of a target polynucleotide sequence in a manner that interferes with the function of the target polynucleotide sequence. For example, gene knockout can be achieved by inducing a deletion in the functional region of the target polynucleotide sequence. Based on the detailed information described in this application, those skilled in the art will readily understand how to knockout a target polynucleotide sequence or a part thereof using various genetic methods such as the CRISPR / Cas system, ZFN, TALEN, TgAgo.
[0036] As used herein, the term "migrasome" generally refers to a membrane-bound cellular structure that is derived from or generated by migrating cells. The term "migrasome" includes organelles (also referred to as "pomegranate-like structure" or PLS) attached to the contractile fibers generated by migrating cells. In some cases, the term "migrasome" also refers to vesicles (such as extracellular vesicles) that have detached from the generating cells. In the present disclosure, the term "migrasome" also refers to vesicles (such as artificial vesicles) having similar functions and / or compositions to vesicles or organelles derived from and / or generated by migrating cells.
[0037] As used herein, the terms "migrating cell" and "circulating cell" are used interchangeably and generally refer to a cell that moves from one location to another. In some cases, a migrating cell is a cell whose relative position, space, and / or contour have changed or are changing. Circulating cells include cells that circulate in the body fluids (such as blood or lymph) of an organism.
[0038] As used herein, the term "pharmaceutically acceptable excipient" generally refers to any material that is not therapeutically and / or prophylactically active in nature. The addition of such excipients is intended to confer acceptable technical properties to a pharmaceutical composition.
[0039] As used herein, the term "tetraspanin" generally refers to a membrane protein, also known as a transmembrane 4 superfamily (TM4SF) protein, which may have four transmembrane α-helices and two extracellular domains. For example, the term "tetraspanin" can include various isoforms of tetraspanin, as well as naturally occurring alleles and processed forms.
[0040] As used herein, the term "tetraspanin 4 (TSPAN4)" generally refers to the TSPAN4 gene and / or the protein encoded by the TSPAN4 gene. For example, the TSPAN4 gene number in NCBI Entrez Gene may be 7106. For example, the UniProtKB / Swiss-Prot number of Tetraspanin 4 may be O14817. For example, the term "tetraspanin 4" may include various isoforms, naturally occurring alleles, and processed forms of Tetraspanin 4. The term also includes TSPAN4 or fragments thereof, such as TSPAN4 conjugated to a tag (such as a histidine tag), murine or human Fc, or a signal sequence. The term TSPAN4 includes functional variants and / or fragments, as well as homologs and orthologs thereof. The term TSPAN4 includes the TSPAN4 gene or protein from any species, such as humans or non-human animals (such as dogs, mice, rats, pigs, monkeys (such as rhesus monkeys), cows, cats, chickens, zebrafish, etc.).
[0041] As used herein, the term "tetraspanin 9 (TSPAN9)" generally refers to the TSPAN9 gene and / or the protein encoded by the TSPAN9 gene. For example, the TSPAN9 gene number in NCBI Entrez Gene may be 10867. For example, the UniProtKB / Swiss-Prot number of Tetraspanin 9 may be O75954. For example, the term "tetraspanin 9" may include various isoforms, naturally occurring alleles, and processed forms of Tetraspanin 9. The term also includes TSPAN9 or fragments thereof, such as TSPAN9 conjugated to a tag (such as a histidine tag), murine or human Fc, or a signal sequence. The term TSPAN9 includes functional variants and / or fragments, as well as homologs and orthologs thereof. The term TSPAN9 includes the TSPAN9 gene or protein from any species, such as humans or non-human animals (such as dogs, mice, rats, pigs, monkeys (such as rhesus monkeys), cows, cats, chickens, zebrafish, etc.).
[0042] In the present disclosure, the term "comprising" also encompasses "is", "has", and "consisting of". For example, a "composition comprising X and Y" can be understood as a composition comprising at least X and Y. It should also be understood as disclosing a composition consisting only of X and Y (i.e., a composition consisting of X and Y).
[0043] Migrasomes are newly discovered organelles generated by migrating cells. The key role of neutrophil migrasomes in hemostasis is shown here. This application shows that a large number of neutrophil migrasomes are present in mouse blood. Compared with platelets, neutrophil migrasomes have a similar morphology but are rich in coagulation factors such as factor VIII, prothrombin, and thrombin. Neutrophil migrasomes accumulate at the site of injury and can effectively activate platelets in vitro. Removal of neutrophils or genetically reducing the number of neutrophil migrasomes significantly reduces platelet plug formation and impairs coagulation. These defects can be completely remedied by intravenous injection of purified neutrophil migrasomes. This application reveals neutrophil migrasomes as a previously unrecognized essential component of the hemostatic system, which may provide new insights into the causes of various coagulation disorders and open up new therapeutic possibilities.
[0044] The hemostatic system is a complex interconnected system that maintains the fluidity of blood while allowing rapid repair of damaged blood vessels. Components of the hemostatic system include platelets, the blood vessel wall, and coagulation factors. Vascular injury exposes the subendothelial matrix, which initiates platelet adhesion by binding to various surface receptors on platelets. Subsequently, platelet activation and aggregation are triggered, forming a platelet plug. At the same time, activation of the coagulation cascade leads to the generation of thrombin, which cleaves fibrinogen into insoluble fibrin. Fibrin forms a cross-linked network, greatly enhancing the platelet plug and producing a hemostatic plug to stop bleeding. In addition to these established components, it is unclear whether there are other essential components of the hemostatic system.
[0045] Migrasomes are newly discovered organelles of migrating cells. During cell migration, long membrane-bound fibers called retraction fibers remain at the trailing edge of the cell, and large vesicular structures called migrasomes grow out of the retraction fibers. As the cell moves, migrasomes are released from the cell. The formation of migrasomes is driven by the aggregation of large regions rich in tetraspanins; thus, molecules associated with small regions rich in tetraspanins, such as integrins, are highly enriched in migrasomes. Knockdown or knockout of tetraspanins that promote migrasome formation impairs migrasome formation. Migrasome formation has been observed in various in vivo settings, and migrasomes have been shown to regulate important processes in zebrafish organogenesis in surrounding cells by releasing signaling molecules, by performing mitochondrial quality control through the shedding of damaged mitochondria, and by the lateral transfer of mRNA.
[0046] Neutrophil migrasomes have a size and morphology similar to platelets. In addition, migrasomes are rich in integrins. These factors endow neutrophil migrasomes with flow kinetics and adhesion properties similar to platelets, meaning they can adhere to the site of injury with kinetics similar to platelets. By maintaining active thrombin on their surface, neutrophil migrasomes can be considered a "catalyst" for the coagulation cascade. Thus, neutrophil migrasomes / platelets can be considered a binary system that separates the catalyst from the substrate in two independent compartments. The beauty of this binary system is that it separates the catalyst from the substrate under normal conditions to avoid accidental activation of the coagulation cascade, while ensuring rapid activation of coagulation upon injury.
[0047] Detailed description
[0048] In one aspect, the present disclosure provides a method of modulating coagulation and / or platelet function, the method comprising modulating the formation and / or function of migrasomes derived from neutrophils.
[0049] In another aspect, the present disclosure provides a reagent capable of modulating the formation and / or function of migrasomes derived from neutrophils for modulating coagulation and / or platelet function.
[0050] In another aspect, the present disclosure provides the use of a reagent capable of modulating the formation and / or function of migrasomes derived from neutrophils in the preparation of a modulator for modulating coagulation and / or platelet function.
[0051] In one aspect, the present disclosure provides a method of modulating coagulation, the method comprising providing a migrasome derived from neutrophils.
[0052] In another aspect, the present disclosure provides a migrasome derived from neutrophils for modulating coagulation.
[0053] In another aspect, the present disclosure provides the use of a migrasome derived from neutrophils in the preparation of a modulator for modulating coagulation.
[0054] In one aspect, the present disclosure provides a migrasome derived from neutrophils.
[0055] In one aspect, the present disclosure provides a reagent for modulating the formation and / or function of migrasomes derived from neutrophils.
[0056] In one aspect, the present disclosure provides an engineered cell that has an altered ability to modulate coagulation and / or platelet function compared to a corresponding unmodified cell, the engineered cell having been modified to alter its migrasome-generating ability.
[0057] In one aspect, the present disclosure provides a composition comprising the migrasome as described above in the present application, a reagent, and / or an engineered cell.
[0058] In one aspect, the present disclosure provides a kit comprising the migrasome as described above in the present application, a reagent, an engineered cell, and / or a composition.
[0059] For example, a neutrophil-derived migrasome may include a migrasome isolated from a neutrophil. For example, a neutrophil-derived migrasome may include a migrasome derived from any stage of a neutrophil. For example, the migrasome may be Ly6G positive. For example, the migrasome may be MPO positive.
[0060] According to any of the above aspects of the present disclosure, blood coagulation and / or platelet function can be promoted or inhibited.
[0061] The formation and / or function of the migrasome can be regulated by any applicable method (i.e., promoted or inhibited as needed). For example, the formation and / or function of the migrasome can be regulated by regulating the migration of the cells that generate the migrasome. For example, the formation and / or function of the migrasome can be regulated by regulating the formation of the contractile fibers of the cells that generate the migrasome. For example, the formation and / or function of the migrasome can be regulated by regulating the quantity and / or function of tetraspanins (including their functional fragments and / or their functional variants). For example, the formation and / or function of the migrasome can be regulated by regulating the quantity and / or function of cholesterol in the cells that generate the migrasome or in the migrasome.
[0062] In certain cases, promoting the formation and / or function of the migrasome includes increasing the quantity and / or function of the cells that generate the migrasome in neutrophils and / or tetraspanins, their functional fragments, and / or their functional variants in the migrasome. For example, this can be achieved by overexpressing tetraspanins, their functional fragments, and / or their functional variants in neutrophils. For example, the tetraspanins may include TSPAN1, TSPAN2, TSPAN4, TSPAN6, TSPAN7, TSPAN9, TSPAN18, CD82, CD81, TSPAN13, CD53, TSPAN3, TSPAN5, and / or CD37.
[0063] Overexpression can be achieved by introducing an exogenous protein or an exogenous nucleic acid molecule encoding the protein, or by causing an increase in the expression of an endogenous protein or an endogenous gene encoding the protein. For example, such overexpression can be caused by a mutation in the gene regulatory region. In certain cases, overexpression can be achieved by altering the function of one or more components of the transcription and / or translation machinery.
[0064] In some cases, promoting the formation and / or function of migrasomes involves altering the amount and / or function of sphingomyelin. For example, altering the production of sphingomyelin in the cell. For example, altering the expression and / or function of sphingomyelin synthase. For example, altering sphingomyelin phosphodiesterase 2 (SGMS2), its functional fragments, and / or its functional variants in neutrophils. For example, altering the process of sphingomyelin degradation to ceramides in neutrophils. For example, altering the expression and / or function of sphingomyelinase (SMase) in neutrophils.
[0065] In some cases, promoting the formation and / or function of migrasomes involves altering the amount and / or function of PIP2, PIP5K1, and / or Rab35. For example, PIP2 includes PI(4,5)P2. For example, altering the conversion of PI4P to PIP2. For example, altering the amount and / or function of PI4P kinase. For example, altering the expression and / or function of PIP5K1, its functional fragments, and / or its functional variants. For example, PIP5K1 includes PIP5K1α and / or PIP5K1γ. For example, altering the process of PIP2 degradation to PI4P in neutrophils. For example, altering the expression and / or function of PLCD3 in neutrophils. For example, altering the expression and / or function of Rab35.
[0066] In some cases, promoting the formation and / or function of migrasomes involves altering the amount and / or function of cholesterol in the cells that generate neutrophils. For example, altering the amount of cholesterol by altering its synthesis and / or uptake. For example, altering cholesterol uptake includes culturing neutrophils in a cholesterol-enriched and / or cholesterol-deficient environment.
[0067] In some cases, promoting the formation and / or function of migrasomes involves altering the amount and / or function of integrin proteins and / or extracellular matrix (ECM) proteins. For example, integrin proteins include integrin α1, integrin α2, integrin α3, integrin α5, and / or integrin α6. For example, ECM proteins include fibronectin, laminin, and / or collagen.
[0068] In some cases, promoting the formation and / or function of migrasomes involves altering the amount and / or function of coagulation factors, their functional fragments, and / or their functional variants on migrasomes. For example, coagulation factors include prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII, and / or vWF.
[0069] In the present disclosure, knocking down a target (e.g., tetraspanin 4, tetraspanin 9) refers to reducing the expression of the gene encoding the target by a certain process. The reduction can be achieved by gene modification or by treatment with a reagent that is a short DNA or RNA oligonucleotide complementary to the gene or its mRNA transcript.
[0070] Knockdown can be achieved through genetic modification or can be transient. If the DNA of an organism or cell is genetically modified, the resulting organism or cell can be referred to as a "knockdown organism" or "knockdown cell". If the change in gene expression is caused by the binding of an oligonucleotide to mRNA or temporarily to the gene, which results in a temporary change in gene expression without modifying chromosomal DNA, the resulting effect can be referred to as "transient knockdown".
[0071] In transient knockdown, the binding of an oligonucleotide to an active gene or its transcript results in reduced expression through multiple processes. The binding can be achieved by blocking transcription (in the case of gene binding), degrading the mRNA transcript (e.g., by small interfering RNA (siRNA)) or RNase-H-dependent antisense, or by blocking mRNA translation, pre-mRNA splicing sites, or nuclease cleavage sites for the maturation of other functional RNAs (including miRNA) (e.g., by morpholino oligomers or other RNase-H-independent antisense techniques).
[0072] RNA interference (RNAi) is a means of silencing genes through mRNA degradation. Gene knockdown by this method is achieved by introducing small double-stranded interfering RNA (siRNA) into the cytoplasm. Small interfering RNA can be from within the cell or introduced exogenously into the cell. Once inside the cell, exogenous siRNA is processed by the RNA-induced silencing complex (RISC). The siRNA is complementary to the target mRNA to be silenced, and RISC uses the siRNA as a template to localize the target mRNA. After RISC localizes to the target mRNA, the RNA is cleaved by ribonuclease.
[0073] In some cases, for example, the knockdown target can use shRNA. shRNA can be introduced into cells through viral constructs. In some cases, the viral construct is a lentiviral construct.
[0074] Knocking out a target (e.g., tetraspanin 4, tetraspanin 9) is a genetic process that causes the gene encoding the target to lose its function ("knockout"). When the gene encoding the target is knocked out, it can be a heterozygous knockout or a homozygous knockout. In a heterozygous knockout, only one of the two gene copies (alleles) is knocked out; in a homozygous knockout, both copies are knocked out.
[0075] Knockout can be achieved through a variety of techniques. In some cases, the knockout may be a naturally occurring mutation that is screened for or identified (e.g., by DNA sequencing or other methods).
[0076] In some cases, knockouts are generated by homologous recombination. For example, it may involve creating a nucleic acid (e.g., DNA) construct containing the desired mutation. The construct may also contain a drug resistance marker in place of the gene to be knocked out. The construct may further contain a minimum length (e.g., 2 kb or more) that is homologous to the target sequence. The construct can be delivered to the target cells by microinjection, electroporation, or other methods (e.g., transfection via a viral or non-viral system). Then, the method relies on the cell's own repair mechanism to recombine the nucleic acid construct into the existing DNA (e.g., the cell's genome). This may result in the gene sequence being altered, and in most cases, if the gene is translated, the protein will be non-functional. The drug selection marker on the construct can be used to select the cells in which the recombination event has occurred. In a diploid organism containing two alleles of most genes and possibly several related genes that cooperate in the same function, additional rounds of transformation and selection may be carried out until each target gene has been knocked out. Selective breeding may be required to produce homozygous knockout animals.
[0077] In some cases, knockouts are generated using site-specific nucleases. Various methods can be used to precisely target a DNA sequence to introduce a double-strand break. Once this occurs, the cell's repair mechanism will attempt to repair this double-strand break, usually by non-homologous end joining (NHEJ), which involves directly ligating the two broken ends together. This may not be perfect, so sometimes it can lead to insertions or deletions of base pairs, causing a frameshift mutation. These mutations can render the gene non-functional, thus creating a knockout of the gene.
[0078] For example, zinc-finger nucleases can be used to generate such knockouts. Zinc-finger nucleases contain a DNA-binding domain that can precisely target a DNA sequence. Each zinc finger can recognize a codon of the desired DNA sequence and can thus be assembled modularly to bind to a specific sequence. These binding domains are coupled to a restriction endonuclease that can cause a double-stranded break (DSB) in the DNA. The repair process may introduce mutations that disrupt gene function.
[0079] Another example is that transcription activator-like effector nucleases (TALENs) can be used to generate such knockouts. TALENs contain a DNA-binding domain and a nuclease that can cut DNA. The DNA-binding region can contain amino acid repeats that each recognize a single base pair of the target DNA sequence. If such cleavage targets the gene coding region and NHEJ-mediated repair introduces insertions and deletions, it usually results in frameshift mutations, thus disrupting gene function.
[0080] A further example is that the Clustered regularly interspaced short palindromic repeats (CRISPR) system can be used to generate such knockouts. The CRISPR / Cas9 method is a genome editing method that involves a guide RNA complexed with the Cas9 protein. By simple complementary base pairing, the guide RNA can be engineered to match the desired DNA sequence. The coupled Cas9 can cause double-strand breaks in the DNA. Following the same principle as zinc fingers and TALENs, attempts to repair these double-strand breaks usually result in frameshift mutations, rendering the gene non-functional.
[0081] Knockouts can also include conditional gene knockouts. Conditional gene knockouts allow gene deletion in tissues or cells when specific conditions are met, such as in a tissue-specific manner. This can be achieved by introducing short sequences called loxP sites around the gene. These sequences will be introduced into the germline by the same mechanism as the knockout. Then the said germline can be crossed with another germline containing Cre recombinase, a viral enzyme that can recognize these sequences, recombine them, and delete the gene flanked by these sites.
[0082] The present disclosure also provides an engineered cell. Compared with the corresponding unmodified cell, the engineered cell may have an altered ability to regulate blood coagulation and / or platelet function. For example, the engineered cell has been modified to alter its migrasome-generating ability.
[0083] In some cases, the engineered cell has been modified to increase the ability to generate migrasomes. In some cases, the engineered cell has been modified to decrease the ability to generate migrasomes.
[0084] Cells can be modified by any method suitable for the purposes of the present disclosure. For example, the modification can be a genetic modification. In some cases, the modification may include treating the cells with one or more reagents that cause the desired change or effect. The modification can be temporary, transient, stable, or permanent. In some cases, the engineered cells can be descendants of the parental cells that have been modified.
[0085] The present disclosure also provides the use of the above-mentioned reagents of the present disclosure in the preparation of the engineered cells of the present disclosure.
[0086] According to any aspect of the present disclosure, the method may include administering to a subject in need an effective amount of migrasomes (e.g., the isolated migrasomes of the present disclosure).
[0087] In one aspect, the present disclosure provides a method for monitoring blood coagulation and / or platelet function, the method may include analyzing the presence, quantity, and / or function of migrasomes obtained from a biological sample.
[0088] The present disclosure provides a method for regulating blood coagulation and / or platelet function, the method may include: (i) monitoring blood coagulation according to the present application; and (ii) administering a regulator according to the result of step (i).
[0089] The present disclosure provides a method for monitoring migrasomes derived from neutrophils, the method may include analyzing the presence and / or quantity of marker molecules of the migrasomes.
[0090] In one aspect, the present disclosure provides a method for monitoring migrasomes in a subject. The method may include analyzing the presence, quantity, and / or function of migrasomes obtained from a biological sample of the subject. The subject can be a mammal, such as a human subject.
[0091] An increase in the number of migrasomes may indicate an increase in the coagulation response. In some cases, an increase in the number of migrasomes indicates the progression of a biological process mediated by the coagulation response. A decrease in the number of migrasomes may indicate a decrease in the coagulation response. In some cases, a decrease in the number of migrasomes indicates a decrease in a biological process mediated by the coagulation response.
[0092] Analyzing the presence, quantity, and / or function of migrasomes may include analyzing the presence and / or quantity of migrasome marker molecules. For example, analyzing the presence, quantity, and / or function of migrasomes may include determining the presence and / or quantity of Tspan4+ and Integrin+ in a biological sample. In some cases, analyzing the presence, quantity, and / or function of migrasomes may include staining a biological sample with wheat germ agglutinin (WGA). In some cases, analyzing the presence, quantity, and / or function of migrasomes may include staining a biological sample with myeloperoxidase (MPO).
[0093] Thus, the methods, reagents, compositions, or uses of the present disclosure may also involve detecting or analyzing other markers of migrasomes. According to any aspect of the present disclosure, a detectable label may be attached to an analyte (such as a reagent of the present disclosure) to make the reaction of the analyte detectable. For example, the detectable label may generate a signal detectable by visual and / or instrumental methods. For example, the detectable label may include a moiety that generates light and / or a moiety that generates fluorescence. For example, the detectable label may include a fluorescent label, a luminescent label, and / or a non-optically detectable label (e.g., detected according to its specific mass, weight, shape, and / or size).
[0094] According to the present disclosure, characterizing (e.g., monitoring, detecting, tracking, revealing, etc.) migrasomes may include determining the presence and / or quantity of Ly6G in migrasomes. Migrasomes may be present in or derived from a biological sample (such as a body fluid sample, such as a blood sample).
[0095] According to any aspect of the present disclosure, a biological sample may be collected and / or analyzed. For example, the biological sample may include, but is not limited to, body fluids such as sputum, blood, serum, plasma, or urine. For example, the biological sample may include a blood sample. For example, the blood sample may include whole blood, plasma, and / or serum.
[0096] For example, the biological sample may be from a human and / or an animal. For example, the biological sample may be analyzed in vivo, such as without being removed from a human or an animal, or the biological sample may be tested in vitro. For example, the biological sample may be analyzed after being processed, such as by separation processing. For example, the biological sample may be freshly taken from a human or an animal, or may be processed or stored.
[0097] For example, analyzing the biological sample may include evaluating the change in the migrasome level in the biological sample relative to a reference sample. For example, the quantity and / or function of migrasomes in the biological sample may be lower than that of the reference sample, which may indicate a reduced coagulation response in the subject. For example, the quantity and / or function of migrasomes in the biological sample may be higher than that of the reference sample, which may indicate an increased coagulation response in the subject (e.g., increased blood clotting). For example, the reference sample may be from the same subject, sampled at different time points or from other parts of the body, and / or from other individuals.
[0098] In one aspect, the present disclosure provides a method for separating platelets, which may include excluding migrasomes derived from neutrophils from a sample.
[0099] The present disclosure provides a composition comprising platelets separated according to the present application.
[0100] The present disclosure provides a kit comprising platelets separated according to the present application and / or the composition of the present application.
[0101] Separation can be carried out by methods known to those skilled in the art. Separation procedures may include magnetic separation, using antibody-coated magnetic beads or immunomagnetic beads, affinity chromatography, an affinity agent conjugated with a monoclonal antibody or an affinity agent used together with a monoclonal antibody, and a solid matrix with an antibody (e.g., a plate) for the "plate method" or other convenient techniques. Techniques providing precise separation include fluorescence-activated cell sorters, which can have varying degrees of complexity, such as multiple color channels, low-angle and obtuse-angle light scatter detection channels, impedance channels, etc., and magnetic-activated cell sorters. An antibody (e.g., an anti-Ly6G antibody or an antigen-binding fragment thereof) can be conjugated with a marker, such as a magnetic bead for direct separation, biotin, which can be removed with avidin or streptavidin conjugated to a scaffold, a fluorescent dye, such as FITC, which can be used with a fluorescence-activated cell sorter, or a similar method for easy separation of a specific target (e.g., monocyte-derived migrasomes). Other techniques include, but are not limited to, dense particles for density centrifugation, adsorption columns, adsorption membranes, etc.
[0102] The modulator can be any reagent suitable for the desired purpose, e.g., a reagent capable of specifically modulating the functions of monocytes, migrasomes, and / or monocyte-derived migrasomes. The modulator can be a protein, polypeptide, small molecule compound, nucleic acid, cell, or any combination thereof (e.g., a conjugate).
[0103] In the present disclosure, the reagent can be a small molecule compound, an antibody, a nucleic acid molecule, a polypeptide, or a fragment thereof. In some cases, the reagent can contain one or more active ingredients, present in a single molecule or as separate molecules.
[0104] The reagent can be provided in an inactive form and converted to an active form in vitro or in vivo before, during, or after administration.
[0105] The reagent can be a pharmaceutical reagent or a reagent for non-pharmaceutical use.
[0106] The reagent can exert the desired function directly or indirectly through the functions of other reagents, compositions, or cells.
[0107] The compositions of the present disclosure can be pharmaceutical compositions. The pharmaceutical compositions can contain pharmaceutically acceptable excipients.
[0108] The composition can contain an effective amount of the reagent of the present disclosure. The effective amount can be a dose that is capable of achieving the desired effect (e.g., modulating a platelet-mediated biological function) when administered to cells, tissues, or a subject alone or in combination with other reagents.
[0109] The kits of the present disclosure can contain the reagents, engineered cells, and / or compositions of the present disclosure. Example
[0111] The following examples are intended to provide a complete disclosure and description to those of ordinary skill in the art on how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent that the following experiments are all or the only experiments conducted. Every effort has been made to ensure the accuracy of the data used (e.g., amounts, temperatures, etc.), but some experimental errors and deviations should be taken into account. Unless otherwise indicated, all parts are parts by weight, the molecular weight is the weight-average molecular weight, the temperature is in degrees Celsius, and the pressure is atmospheric or near atmospheric pressure. Standard abbreviations can be used, e.g., bp, base pair; kb, kilobase; pl, picoliter; s or sec, second; min, minute; h or hr, hour; aa, amino acid; nt, nucleotide; i.m., intramuscular injection; i.p., intraperitoneal injection; s.c., subcutaneous (injection); and so on.
[0112] Method
[0113] Mouse
[0114] All animal experiments were approved by the Institutional Animal Care and Use Committee and were conducted in accordance with the animal welfare guidelines of the government and Tsinghua University (Protocol 18-YL2). When relevant and applicable, age- and sex-matched mice were randomly selected from the same cage as the experimental and control groups. All C57BL / 6J mice used in this study were obtained from the Tsinghua University Animal Center. The mice were housed in ventilated cages in a specific pathogen-free animal facility with a 12-hour light / 12-hour dark cycle.
[0115] Tspan9- / - mice were generated on a C57BL / 6J background by CRISPR / Cas9 technology. The sgRNA sequence used for CRISPR / Cas9 was 5’-GAAGGTGGCGAAGTTGCCTT-3’ (SEQ ID NO:1). The mice were genotyped by PCR using the following primers. Tspan9-KO-F: GCTGCCTCGTCCCATTTACT (SEQ ID NO:2), Tspan9-KO-R: ACGCTGAGAAGCAGACACTT (SEQ ID NO:3).
[0116] Tspan9flox / flox mice were generated. Age- and sex-matched mice at 6 to 12 weeks of age were used. After crossing with LysM-Cre mice, cell-specific deletion of the Tspan9 allele by Cre-mediated recombination was obtained. Mice were genotyped by PCR using the following primers. 5’-arm Tspan9-F: TGTCGGTACTCAATACATATTGGCTGA (SEQ ID NO:4), 5’-arm Tspan9-R: ATCCATAGAACGAGTGGGCCTGTAAA (SEQ ID NO:5); 3’-arm Tspan9-F: AAACAGCATGGCACCCAGAGACA (SEQ ID NO:6), 3’-arm Tspan9-R: CACAGCTTGACCCACAAAGCCAT (SEQ ID NO:7).
[0117] LysM-Cre mice were generated. LysM-Cre primer 1: CCCAGAAATGCCAGATTACG (SEQ ID NO:8), LysM-Cre primer 2: CTTGGGCTGCCAGAATTTCTC (SEQ ID NO:9), LysM-Cre primer 3: TTACAGTCGGCCAGGCTGAC (SEQ ID NO:10).
[0118] In vivo imaging
[0119] For neutrophil imaging, AF647-WGA (5 μg, Thermo Fisher, W32466) and PE-Ly6G / Ly6C (1 μg, eBioscience, 12-5931-82) were injected intravenously (i.v.) into C57BL6 / J mice (male, 8 - 12 weeks old). Then, the mice were anesthetized by intraperitoneal injection (i.p.) of avertin (375 mg / kg). Subsequently, the mice were dissected and the liver was exposed on a plate with a coverslip in the center for spinning disk imaging.
[0120] For liver wound imaging, C57BL6 / J mice (male, 8 - 12 weeks old) were injected intravenously (i.v.) with AF488 - WGA (5 μg, ThermoFisher, W11261), APC anti - CD41 (1 μg, Biolegend, 133914), and PE anti - Ly6G / Ly6C (1 μg, eBioscience, 12 - 5931 - 82). Then, the mice were anesthetized by intraperitoneal injection (i.p.) of avertin (375 mg / kg). Subsequently, the mice were dissected to expose the liver, and a small wound was made on the liver with scissors. The mice were placed on a plate with a coverslip in the center for Dragonfly spinning disk imaging.
[0121] Imaging flow cytometry analysis
[0122] Sample preparation: After anesthesia by intraperitoneal injection (i.p.) of avertin (375 mg / kg), mouse blood was collected from the orbital venous plexus. The blood was diluted 4 - fold with PBS containing EDTA and stained with PE anti - Ly6G and APC anti - CD41. After 15 minutes, twice the volume of PBS was added for imaging flow analysis.
[0123] Acquisition: Imaging flow cytometry analysis was performed using an ImageStream MKII flow cytometer (Luminex), and data acquisition was carried out using Inspire software. 300,000 Ly6G+ or CD41+ events were obtained. During acquisition, leukocytes and adherent cells were removed using the area and aspect ratio (the ratio of the horizontal axis to the vertical axis of the event) of the bright - field image.
[0124] Analysis: Data analysis was performed using IDEAS software (Luminex). First, well - focused events were gated based on the Gradient RMS of the particles in the bright - field image: the higher the Gradient RMS value, the clearer the focus. Second, small particles were gated based on the particle area of the bright - field image. Third, migrasomes and platelets were gated based on the intensities of Ly6G - PE (Ch03) and CD41 - APC (Ch11), and the number of migrasomes and / or platelets was analyzed.
[0125] Isolation of crude extracellular structures from mouse blood
[0126] Mice were anesthetized by intraperitoneal (i.p.) injection of avertin (375 mg / kg). Blood was collected from the ophthalmic venous plexus of mice and placed into tubes containing blood collection buffer (phosphate-buffered saline (PBS) with 20 mM EDTA on ice; 1 mL of collection buffer was used per mouse). The blood mixture was then centrifuged at 800 g for 5 minutes at 4 °C, then at 1000 g for 15 minutes at 4 °C to remove blood cells, and finally at 20000 g for 40 minutes at 4 °C. The pellet was the crude extracellular structure fraction.
[0127] For platelet-depleted mice, 1 mg / kg of anti-CD41 antibody (BD-Pharmingen, 553847) was prepared in 200 μL PBS for intraperitoneal (i.p.) injection. After 12 - 18 hours, the mice were anesthetized by intraperitoneal injection of avertin (375 mg / kg, i.p.). Blood was collected from the ophthalmic venous plexus, and the blood mixture was centrifuged at 800 g for 10 minutes at 4 °C to remove blood cells, and finally at 20000 g for 40 minutes at 4 °C. The pellet was the crude extracellular structure fraction.
[0128] Positive selection of neutrophil migrators from mouse blood
[0129] To positively select neutrophil migrators, the crude extracellular structure purified from platelet-depleted mice was resuspended in PBS (supplemented with 2% s-plasma) and incubated with anti-Ly6G UltraPure MicroBeads (Miltenyi Biotec, 130 - 120 - 337) at 4 °C for 60 minutes. Then the microbead-treated migrators were positively selected using DynaMag TM -Spin (Invitrogen TM , 12320D) for over 12 hours. The supernatant was removed and gently washed three times with PBS (supplemented with 2% s-plasma). Then the PBS was removed to obtain the psNeuMig preparation.
[0130] Negative selection of neutrophil migrators from mouse blood
[0131] To negatively select neutrophil migrators, the crude extracellular structure purified from platelet-depleted mice was resuspended in PBS (supplemented with 2% s-plasma) and EasySep TMNegative selection was performed using a Mouse Neutrophil Enrichment Kit. Briefly, 5% rat serum and Enrichment Cocktail (50 μl / ml) were added and incubated at 4 °C for 15 minutes. The sample was centrifuged at 20,000 g for 30 minutes at 4 °C, and the supernatant was removed. The pellet was resuspended in PBS and incubated with Biotin Selection Cocktail (50 μl / ml) at 4 °C for 15 minutes. Then, magnetic particles (150 μl / ml) were added and incubated at 4 °C for 60 minutes. The tube was placed in a DynaMag TM -Spin (Invitrogen TM , 12320D) and incubated at 4 °C for 10 minutes. The suspension was transferred to a new tube and centrifuged at 20,000 g for 30 minutes at 4 °C to obtain the nsNeuMig preparation.
[0132] Purification of platelets from mouse blood
[0133] Platelets were purified from mouse blood according to a known protocol. Briefly, mouse blood was collected into a tube containing 3.2% sodium citrate (pH 7.2) and gently mixed. 3 mL of iohexol gradient medium (12% iohexol powder in 0.85% sodium chloride, 5 mM Tricine, pH 7.2) was added to a 15 mL tube, and then 1 mL of the collected mouse blood sample was slowly loaded on top of the gradient medium. The tube containing the sample was centrifuged at 400 g for 20 minutes at 20 °C in a swinging bucket rotor with slow acceleration and deceleration. Most of the platelet-rich layer and a small amount of the platelet-poor layer (about 2 mL) were collected using a wide-bore pipette tip without disturbing the red blood cell and white blood cell layers. The platelet sample was transferred to a new tube, 6 mL of PBS was added, and the mixture was mixed by inverting. The sample was centrifuged at 800 g for 10 minutes at 20 °C in a swinging bucket rotor. The supernatant was discarded, and the platelet pellet was retained.
[0134] Scanning electron microscopy
[0135] Purified migrasomes or platelets were placed on a poly-L-lysine-coated wafer for 2 hours and then fixed with 2.5% glutaraldehyde for 1 hour. The sample was washed with PB buffer, then washed in PB for 10 minutes and incubated with 1% osmium tetroxide / 1.5% potassium ferrocyanide for 30 minutes. After washing with distilled water, the sample was dehydrated in an ethanol series (50%, 70%, 80%, 90%, 100%, 100%, 100%; 2 minutes each). The sample was dried in a critical point dryer (Leica EM CPD300). A 10-nanometer layer of gold was sputtered onto the sample surface, and then it was observed under a FEI Helios NanoLab G3UC SEM.
[0136] Flow cytometry sorting and analysis
[0137] For blood cell analysis and sorting, mouse blood was collected from the orbital venous plexus and placed into tubes containing blood collection buffer (PBS supplemented with 10 mM EDTA on ice). The blood mixture was centrifuged at 800 g for 5 minutes at 4 °C, and the cell pellet was resuspended in ammonium chloride-potassium chloride (ACK) lysis buffer for 2 minutes to lyse red blood cells. The lysate was centrifuged at 1000 g for 5 minutes at 4 °C, and the supernatant was removed. The pellet was resuspended in PBS and stained with PE anti-Ly6G and APC anti-CD41 for 15 minutes at room temperature, and then centrifuged at 1000 g for 5 minutes at 4 °C to obtain a blood cell mixture. The cell mixture was resuspended in PBS, sorted by a MoFlo Astrios EQ (Beckman Coulter) or MoFlo XDP (Beckman Coulter) flow cytometer, and imaged by a Dragonfly spinning disk microscope (Andor).
[0138] For blood migrasome analysis, blood migrasomes were purified from mouse blood and stained with AF647 anti-Ly-6G for 15 minutes at room temperature. AF647 rat IgG2a was used as a staining control. The migrasome mixture was centrifuged at 20000 g for 30 minutes at 4 °C. The migrasome pellet was resuspended in PBS and analyzed by a CytoFlex LX (Beckman Coulter) flow cytometer.
[0139] Quantitative proteomics analysis
[0140] For quantitative proteomics analysis, the protein concentration was determined by a BCA kit, and 30 μg of each sample was used for proteomics analysis. After reduction with 10 mM TCEP and alkylation with 40 mM chloroacetamide, the protein samples were digested overnight at 37 °C with trypsin and LysC at a protein:enzyme ratio of 100:1. The peptides were desalted by a C18 solid-phase extraction column, dried by a rapid evaporator, and then resuspended in 0.1% formic acid H2O for mass spectrometry analysis.
[0141] The LC-MS / MS instrument used was an UltiMateTM 3000 RSLC nano system directly interfaced to a ThermoFisher Scientific Orbitrap Fusion LUMOS Tribrid mass spectrometer. The peptides were loaded onto a trapping column (75 μm × 20 mm, 3 μm C18, On an Ultimate 3000 RSLCnano system (Thermo Fisher Scientific), the maximum pressure was 620 bar, using mobile phase A (0.1% formic acid in H2O), and then a 6 - 55% gradient of mobile phase B (80% acetonitrile and 0.08% formic acid) on an analytical column (inner diameter 100 μm, packed with ReproSil-Pur C18-AQ 1.9 μm resin from Dr. Maisch GmbH) at a flow rate of 250 nL / min for 120 minutes. Peptide separation was also performed using a FAIMS device. It was placed between the nanoelectrospray source and the mass spectrometer. The FAIMS separation settings were as follows: the mode was standard resolution, the carrier gas flow rate was 4 L / min, and the total carrier gas flow was static. The CV voltages of FAIMS were -45 V and -60 V. MS data were acquired in the data-independent acquisition (DIA) mode. A single full-scan mass spectrum (350 - 1650 m / z, resolution = 120,000 at 200 m / z) was performed in the Orbitrap with an AGC target value of 2e6, and then multiple MS / MS spectra were acquired within a 3-second cycle time. Fragmentation was performed with 35% normalized collision energy, AGC was 5e5, and the maximum injection time was 100 ms. Precursor peptides were isolated by 33 variable windows from 300 to 1500 m / z at 30,000 resolution. DIA-MS data were analyzed using Spectronaut 15.6 software with default settings. Quantification was based on MS2 area, and the data filtering was set to Q-value sparsity. The database was Uniprot mouse (downloaded on 20210104, 17,056 sequences).
[0142] Migrasome and platelet digestion assays
[0143] Migrasomes and platelets isolated from mouse blood were divided into three equal parts for each sample. The first part served as a control. The second and third parts were digested with proteinase K (Amresco, 0706, 100 μg / ml) at 37 °C for 30 minutes, then washed with five volumes of PBS and centrifuged at 2000 g at 4 °C for 5 minutes (platelets) or 20,000 g at 4 °C for 40 minutes (migrasomes) to obtain digested pellets. The third part was resuspended and incubated with 500 μl of plasma at 37 °C for 60 minutes. The mixture was centrifuged at 2000 g at 4 °C for 5 minutes (platelets) or 20,000 g at 4 °C for 40 minutes (migrasomes). The supernatant was removed, and the pellet was washed once with PBS and centrifuged at 2000 g at 4 °C for 5 minutes (platelets) or 20,000 g at 4 °C for 40 minutes (migrasomes) to obtain proteinase K-digested and plasma-incubated platelets or migrasomes. The platelets, migrasomes, and plasma from the three parts were lysed with 8 M urea and normalized according to the total protein level for Western blot analysis.
[0144] Platelet activation in vitro
[0145] Purified platelets were resuspended in PBS supplemented with 5% fetal bovine serum at a concentration of 1 million per microliter. Ten million purified platelets were placed in three tubes with a maximum of 80 μL of reaction buffer (Biolegend, 422201). PBS, purified migrasomes, and thrombin (Sigma-Aldrich, T4648, 2 units / mL) were added respectively and mixed with the platelets at room temperature for 30 minutes. After 30 minutes, PE anti-CD62P, APC anti-CD41, and AF488 anti-Ly6G were added, and the samples were incubated in the dark at room temperature for 15 minutes. 100 μL of PBS was added to the tubes, and the samples were divided into three parts. The first part was used for flow cytometry analysis. The second and third parts were fixed with 2.5% glutaraldehyde and 2% paraformaldehyde for Dragonfly spinning disk confocal microscopy imaging and scanning electron microscopy imaging.
[0146] Removal of platelets and neutrophils
[0147] To remove platelets, mice were intraperitoneally injected (i.p.) with 1 mg / kg anti-CD41 antibody (clone MWReg 30 (RUO); BD Biosciences, 553847) dissolved in 200 μL of PBS 12 - 18 hours before the experiment. To remove neutrophils, mice were intraperitoneally injected with 200 μg of InVivoPlus anti-Ly6G antibody (clone 1A8; BioXCell, BP0075-1), and then injected with 100 μg three times a week. InVivoPlus rat IgG2a (clone 2A3; BioXCell, BP0089) was used as a control.
[0148] Tail tip bleeding test
[0149] Mice were anesthetized by intraperitoneal injection (i.p.) of avertin (375 mg / kg), and the distal 6 mm of the tail was cut off. Then the severed tail was immersed in warm PBS (100 μL) supplemented with 20 mM EDTA and allowed to bleed for 15 minutes. The blood was thoroughly mixed with PBS, and 100 μL was taken out from the tube. The remaining blood was dropped on a transparent plastic film and photographed.
[0150] Isolation of neutrophil extracellular traps (NETs)
[0151] Using (Sigma-Aldrich, 10771) and Neutrophils were isolated from mouse bone marrow by gradient centrifugation (Sigma-Aldrich, 11191). Neutrophils were seeded into tissue culture dishes with RPMI medium supplemented with 10% fetal bovine serum and cultured at 37 °C with 5% CO2. After 30 minutes, neutrophils were stimulated with 500 nM PMA and incubated at 37 °C with 5% CO2 for 4 hours. After 4 hours of stimulation, the medium was removed, and the adherent materials were collected by pipetting with cold PBS. The collected solution was centrifuged at 450 g for 10 minutes at 4 °C. The supernatant rich in NETs was collected and centrifuged at 18,000 g for 10 minutes at 4 °C. The supernatant was discarded, and the pellet containing NETs was retained.
[0152] Example 1
[0153] Neutrophils in circulation generate a large number of neutrophil migrasomes in the blood.
[0154] Results showed that neutrophils in circulation generate neutrophil-derived migrasomes (neu-migrasomes) in the circulatory system, which is confirmed here. In vivo labeling of neutrophils with Ly6G antibody revealed extensive formation of neu-migrasomes in the blood vessels of the mouse liver ( Figure 1a -b). To confirm the presence of neu-migrasomes in the blood, imaging flow cytometry of mouse blood was performed. After dilution, whole blood was stained with Ly6G antibody to label neutrophils and neutrophil-derived structures, and then imaging flow cytometry was performed ( Figure 1c ). Results showed that the blood contained a large number of structures significantly smaller than cells, and among these small structures, there was a Ly6G-positive subset ( Figure 1d ). Imaging analysis showed that these Ly6G-positive structures were small vesicles of approximately 1 micron, similar to the neu-migrasomes observed in vivo ( Figure 1e ). As a positive control for imaging flow cytometry, platelets were detected by treating the blood with anti-CD41 antibody ( Figure 1e ). In addition, adding platelets as a control also enabled us to evaluate the relative abundance of Ly6G-positive vesicles. Results showed that the number of Ly6G-positive vesicles was approximately 1 / 300 of the number of platelets ( Figure 1f ). Given the very large number of platelets in the blood, the number of Ly6G-positive vesicles can be as high as 1.8 × 10^6 per milliliter of blood.
[0155] To isolate Ly6G-positive vesicles from blood, whole blood was centrifuged at 1000 g for 15 minutes, a procedure known to remove platelets. To examine whether the resulting pellet contained platelets, flow cytometry analysis was performed using anti-CD41 antibody. The pellet was also stained with anti-Ly6G to monitor potential loss of Ly6G-positive structures during 1000 g centrifugation. Notably, at such low speed, structures the size of platelets and neu-migrasomes should not sediment by centrifugation. It is generally thought that platelet aggregation during this process results in sedimentation at such low centrifugation speeds. Surprisingly, a density region of CD41+ and Ly6G+ was found on the graph ( Figure 5a ). To examine the nature of this CD41+ and Ly6G+ density, this population was sorted and confocal microscopy analysis was performed. The results showed that this double-positive population was an aggregation of CD41-positive platelets and Ly6G-positive vesicles ( Figure 5b ). The fact that platelets and Ly6G-positive structures are of similar size and easily aggregate together prompted us to examine whether standard platelet isolation procedures produce platelets contaminated with Ly6G-positive vesicles. Indeed, the results of the present application showed that standard platelet collection procedures widely used in hospitals produce platelets contaminated with a significant amount of Ly6G+ vesicles ( Figure 5c ).
[0156] Ly6G-positive vesicles can form aggregates with platelets, making it difficult to purify pure platelets and Ly6G-positive vesicles. To facilitate purification, platelets or neutrophils were removed from mice by injecting anti-CD41 or anti-Ly6G antibodies respectively ( Figure 1g ). Fourteen hours (for platelets) or five days (for neutrophils) after antibody injection, the results showed that platelets or neutrophils were removed ( Figure 5d ). Next, crude extracellular structures (C-ES) were isolated from platelet-depleted mice: Briefly, blood cells were removed by low-speed centrifugation, and then the extracellular structures were centrifuged at 20000 g ( Figure 1g , left). Flow cytometry analysis showed little platelet contamination ( Figure 5e ). In addition, most of the extracellular structures isolated from this procedure were Ly6G-positive ( Figure 5e ), indicating that they were derived from neutrophils. Using a similar removal method, platelets were also collected from neutrophil-depleted mice ( Figure 1g , right). Next, the isolated extracellular structures and platelets were subjected to scanning electron microscopy (SEM) analysis ( Figure 1h -i, Figure 5f -g), and SEM showed that most of the extracellular structures had the morphological characteristics of migrasomes ( Figure 1h , Figure 5f), i.e., a circular body with attached contractile fibers. The fact that most extracellular structures are Ly6G-positive and have the morphological characteristics of migrasomes suggests that these extracellular structures may be neu-migrasomes. Interestingly, neu-migrasomes and platelets have a certain morphological similarity: both have a circular body with long protrusions ( Figure 1h -i, Figure 5f -g). The average diameter of platelets is 1.6 micrometers, while the average diameter of migrasomes is 1.2 micrometers ( Figure 1j ). To further purify neu-migrasomes from the crude extracellular structure preparation described above, an immunoisolation operation was performed. After isolating the crude extracellular structures, the preparation was incubated with magnetic beads conjugated to anti-Ly6G, and then magnetic sorting was carried out ( Figure 1k , upper panel). SEM analysis showed that the resulting structures were neu-migrasomes densely coated with magnetic beads ( Figure 1l ). Neutrophils were also immunopurified using a negative selection kit. Briefly, the crude preparation was incubated with magnetic beads in the kit, which were conjugated to antibodies against all known types of neutrophils. After incubation, the magnetic beads were removed by a magnet, thus removing structures from other types of blood cells ( Figure 1k , lower panel). Flow cytometry analysis showed that the result of the negative selection process was that more than 80% of the extracellular structures were Ly6G-positive ( Figure 1m ). For the structures obtained by positive and negative selection, SEM showed that most of them had attached contractile fibers, which is a defining feature of migrasomes ( Figure 1l , Figure 1n , Figure 1o , Figure 5h ). Neutrophils are known to release neutrophil extracellular traps (NETs) and neutrophil-derived microparticles (NMPs). To examine the nature of the isolated extracellular structures and to check whether our preparation was contaminated with NETs, western blot analysis of migrasome and NET markers was performed. The results showed that migrasome markers including integrin α5, CPQ, NDST, and Ly6G were enriched in the preparation, indicating that the purified structures were neu-migrasomes. In addition, the results showed that the mitochondrial marker Tim23 was also enriched in the preparation ( Figure 1p ), which is consistent with the result that neu-migrasomes contain damaged mitochondria. In contrast, citrullinated histone H3 (CitH3), a marker for NETs, was not detected in the isolated structures ( Figure 1p ). This indicates that our preparation was not significantly contaminated with NETs. In addition, flow cytometry analysis and confocal imaging showed that the vast majority of these structures did not expose phosphatidylserine (PS) on the outer leaflet ( Figure 1q ,Figure 5i ), which is a defining feature of neutrophil-derived microparticles. These observations further suggest that these structures are not NETs or neutrophil-derived microparticles, but neutrophil-derived migrasomes.
[0157] Example 2
[0158] Neutrophil migrasomes are enriched in coagulation factors
[0159] To gain a deeper understanding of the possible functions of neutrophil migrasomes (neu-migrasomes), the present application performed quantitative mass spectrometry (MS) analysis on neu-migrasomes and platelets isolated separately from platelet-depleted and neutrophil-depleted mice. Since the positive selection procedure provided the highest purity, the present application used neu-migrasomes purified by the positive selection procedure. Quantitative MS showed that, compared with platelets, neu-migrasomes were enriched in the neutrophil marker myeloperoxidase (MPO), which is a major component of neutrophil azurophilic granules ( Figure 2a -b). Surprisingly, MS analysis showed that, compared with platelets, neu-migrasomes were highly enriched in coagulation factors, including prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII, and vWF ( Figure 2a -b). In addition, thrombin was also present in neu-migrasomes. To verify the enrichment of coagulation factors in neu-migrasomes, the present application performed Western blot analysis on platelets from neutrophil-depleted mice and on positively and negatively selected immunopurified migrasomes from platelet-depleted mice. Surprisingly, CD41-positive platelets contained very low levels of coagulation factors ( Figure 2c ). In contrast, Ly6G-positive neu-migrasomes purified by positive or negative selection were enriched in prothrombin, thrombin, factor XIII, factor VIII, and factor X ( Figure 2c -d).
[0160] Paradoxically, these coagulation factors that are enriched in neu-migrasomes were not detected in neutrophil bodies ( Figure 2e ). This observation, along with the fact that these coagulation factors are known to be secreted by the liver and present in serum, raises an interesting possibility that neu-migrasomes adsorb and enrich coagulation factors from serum on their surface. To directly test this possibility, the present application treated crude neu-migrasomes with proteinase K and then incubated the treated neu-migrasomes with plasma ( Figure 2f)。The results showed that after treatment with proteinase K, the coagulation factors on the crude neu-migrasomes were completely removed. If the treated crude neu-migrasomes were incubated with plasma, these factors could be re-adsorbed by the neu-migrasomes( Figure 2g )。In contrast, the treated platelets could not adsorb the coagulation factors( Figure 2h )。This indicates that the intrinsic membrane properties of neu-migrasomes may underlie their ability to adsorb coagulation factors. This application also conducted a proteinase K digestion test on negatively and positively selected purified neu-migrasomes. Similar to the crude neu-migrasomes, the negatively selected purified neu-migrasomes could adsorb coagulation factors from plasma( Figure 2i )。However, the positively selected purified neu-migrasomes could not adsorb coagulation factors( Figure 2j )。This may be because the positively selected purified neu-migrasomes are densely decorated with magnetic beads( Figure 1l ), which may interfere with the adsorption of coagulation factors. The abundance of neu-migrasomes, the morphological similarity between neu-migrasomes and platelets, and the enrichment of coagulation factors on neu-migrasomes prompted us to hypothesize that neu-migrasomes may play a role in blood coagulation.
[0161] Example 3
[0162] Neu-migrasomes Activate Platelets In Vitro
[0163] Next, this application verified whether the thrombin enriched in neu-migrasomes was active. To answer this question, this application conducted a thrombin activity assay using a 5-FAM / QXL-520 fluorescence resonance energy transfer (FRET) substrate. The results showed that platelets had little thrombin activity; however, the purified neu-migrasomes contained a considerable amount of thrombin activity( Figure 3a ), which was consistent with our Western blot analysis. To directly test the role of neu-migrasomes in blood coagulation, this application conducted an in vitro platelet activation assay. As a positive control, this application added thrombin to activate platelets. The results showed that both thrombin and neu-migrasomes strongly activated platelets, as manifested by the upregulation of CD62P on the platelet surface( Figure 3b)。Interestingly, neu-migrasomes significantly increased the side scatter (SSC) and forward scatter (FSC) of platelets, while thrombin only caused slight changes in SSC and FSC( Figure 3c )。
[0164] Next, the present application observed platelets by confocal microscopy. To avoid contact activation of platelets, the reaction mixture was fixed before adding the coverslip. The results showed that neu-migrasomes induced platelet activation, manifested as the transfer of CD62P to the platelet surface( Figure 3d )。In addition, the present application showed that neu-migrasomes aggregated with platelets, and the platelet aggregates induced by neu-migrasomes were significantly larger than those induced by thrombin( Figure 3d -e). The formation of aggregates and the morphological changes of platelets activated by neu-migrasomes were consistent with the enhanced FSC and SSC detected by flow cytometry( Figure 3c )。Scanning electron microscopy (SEM) analysis further confirmed the observation that neu-migrasomes induced larger platelet aggregates; in addition, the filopodia on platelets activated by neu-migrasomes were significantly longer and more numerous( Figure 3f -g). The addition of anti-Ly6G-binding magnetic beads showed that the neu-migrasomes of positive beads aggregated with platelets to form large aggregates( Figure 3f )。Collectively, these data indicate that neu-migrasomes can activate and aggregate platelets in vitro.
[0165] Example 4
[0166] Neu-migrasomes rapidly accumulate at the injury site
[0167] Neu-migrasomes can activate and aggregate platelets in vitro. Then, do they also have the same function in vivo? To study the role of neu-migrasomes in in vivo coagulation, the present application first examined whether circulating neu-migrasomes could be deposited at the injury site like platelets. For this purpose, the present application first made a shallow wound on the mouse liver and then imaged the wound and the uninjured area around it( Figure 4a )。To label neu-migrasomes, the present application injected anti-Ly6G antibody conjugated with a fluorescent dye into the blood vessels. Similarly, the present application used anti-CD41 antibody conjugated with a fluorescent dye to label platelets. The results showed that in the control area, platelets and neu-migrasomes floated with the blood flow and moved rapidly( Figure 6a)。In contrast, a large number of neu-migrasomes were concentrated at the wound site five minutes after injury, and platelets had aggregated ( Figure 4b )。The present application also introduced exogenous neu-migrasomes by intravenous injection. Exogenous neu-migrasomes were also rapidly enriched at the injury site ( Figure 6b )。Taken together, these data indicate that circulating neu-migrasomes can rapidly accumulate at the injury site, and their kinetics are similar to those of platelets.
[0168] Example 5
[0169] Exogenous neu-migrasomes rescue excessive bleeding caused by neutrophil depletion
[0170] Next, the present application tested the role of neu-migrasomes in in vivo blood coagulation. First, the present application depleted neutrophils in mice with anti-Ly6G antibody. Flow cytometry analysis confirmed that the vast majority of neutrophils were depleted within five days after three injections of anti-Ly6G antibody, while the platelet count was not affected ( Figure 6c )。As a control, the present application also depleted platelets with anti-CD41 antibody and confirmed platelet depletion by flow cytometry ( Figure 6c )。Similarly, platelet depletion did not affect the number of neutrophils ( Figure 6c )。Then, the present application used the tail tip bleeding assay to evaluate the effect of neutrophil depletion on blood coagulation, with the bleeding volume as the measurement index ( Figure 4c )。The results showed that depletion of neutrophils or platelets significantly increased the bleeding volume, and the bleeding volume of neutrophil-depleted mice was similar to that of platelet-depleted mice ( Figure 4d -e). These observations indicate that neutrophils play a crucial role in blood coagulation. Next, the present application tested the role of neu-migrasomes in blood coagulation by injecting neu-migrasomes purified from wild-type mice into neutrophil-depleted mice. The results showed that exogenous neu-migrasomes could rescue the impaired blood coagulation function in neutrophil-depleted mice, and exogenous neu-migrasomes could significantly reduce the bleeding volume of neutrophil-depleted mice to a level lower than that of control mice ( Figure 4f -g). This evidence further supports the key role of neu-migrasomes in blood coagulation.
[0171] Next, the present application examined the formation of blood clots on wounds in control mice and neutrophil-depleted mice. In neutrophil-depleted mice, although the platelet count was normal, platelets were unable to form platelet plugs on the woundsFigure 4h -i). Adding exogenous neu-migrasomes largely restored platelet thrombus formation in neutrophil-depleted mice ( Figure 4h -i). This indicates that neu-migrasomes are essential for platelet thrombus formation.
[0172] Example 6
[0173] Tspan9 regulates blood coagulation by controlling the formation of neu-migrasomes
[0174] The results showed that members of the tetraspanin family regulate the formation of migrasomes, and neutrophil migrasome formation was impaired in Tspan9- / - mice. Using imaging flow cytometry, the present application confirmed that the number of neu-migrasomes was indeed reduced in Tspan9- / - mice ( Figure 6d ). The present application also purified migrasomes from equal amounts of blood from wild-type and Tspan9- / - mice. Then, Western blot analysis was performed using antibodies against Ly6G (neutrophil marker) and integrin α5 (a protein enriched in migrasomes). In the migrasome fraction isolated from the blood of Tspan9- / - mice, the level of integrin α5 was decreased, and the level of Ly6G was significantly decreased ( Figure 6e ), which was consistent with the reduced number of neu-migrasomes in Tspan9- / - mice. In addition, the bleeding volume of Tspan9- / - mice was significantly increased, indicating impaired blood coagulation function in these mice ( Figure 6f -g). Adding exogenous neu-migrasomes could rescue the impairment of blood coagulation function ( Figure 6f -g). Imaging analysis showed that platelet thrombus formation at the wound was impaired in Tspan9- / - mice, while adding neu-migrasomes could restore platelet thrombus formation at the wound ( Figure 6h -i). To further confirm these results and exclude any effects caused by the knockout of Tspan9 in other cell types, the present application generated Tspan9 conditional knockout mice through the Cre-LoxP system. Tspan9flox / flox mice were generated and crossed with LysM-Cre mice to obtain mice with myeloid cell lineage-specific knockout of Tspan9. Using imaging flow cytometry, the present application confirmed that the number of neu-migrasomes was indeed reduced in Tspan9flox / flox; LysM-CreT / T mice ( Figure 4j)。Migrasomes were also purified from equal amounts of blood of Tspan9flox / flox; LysM-CreWT / WT or Tspan9flox / flox; LysM-CreT / T mice. Then, western blot analysis was performed using antibodies against Ly6G and integrin α5. The results showed that the levels of Ly6G and integrin α5 in the migrasome fraction isolated from the blood of Tspan9flox / flox; LysM-CreT / T mice were significantly reduced( Figure 4k )。In addition, in vivo imaging was performed on Tspan9flox / flox; LysM-CreWT / WT and Tspan9flox / flox; LysM-CreT / T mice, and it was found that the formation of neu-migrasomes in Tspan9flox / flox; LysM-CreT / T mice was impaired( Figure 4l -m). This further confirmed the reduction of neu-migrasomes in Tspan9flox / flox; LysM-CreT / T mice. Again, this application showed that the blood loss of Tspan9flox / flox; LysM-CreT / T mice was significantly increased, indicating impaired blood coagulation function in these mice( Figure 4n -o). In addition, the addition of exogenous neu-migrasomes could rescue the impairment of blood coagulation function( Figure 4n -o), which further supported the key role of neu-migrasomes in blood coagulation.
[0175] Although the preferred embodiments of the present invention have been shown and described, these embodiments are merely provided by way of example, which will be apparent to those skilled in the art. The specific examples provided in this application are not intended to limit the scope of the present invention. Although the present invention has been described through the above description, the description of these embodiments and the drawings should not be construed as restrictive. Now, many variations, changes, and alternatives will occur to those skilled in the art without departing from the present invention. In addition, it should be understood that all aspects of the present invention are not limited to the specific depictions, configurations, or relative proportions set forth in this application, which depend on various conditions and variables. It should be understood that various alternative embodiments of the present invention can be applied in practice. Therefore, it is contemplated that the present invention also covers any such alternatives, modifications, variations, or equivalents. The following claims define the scope of the present invention, and methods and structures within the scope of these claims and their equivalents are covered.
Claims
1. A method for regulating blood coagulation and / or platelet function, the method comprising regulating the formation and / or function of migrasomes derived from neutrophils.
2. The method according to claim 1, wherein The platelet function includes platelet aggregation and / or thrombin generation.
3. The method according to any one of claims 1-2, wherein The regulation of blood coagulation includes the regulation of bleeding.
4. The method according to any one of claims 1 to 3, wherein The migrasome is Ly6G + .
5. The method according to any one of claims 1-4, wherein The method increases blood coagulation and / or platelet function and includes promoting the formation and / or function of the migrasomes.
6. The method according to claim 5, wherein, Promoting the formation and / or function of the migrasomes includes increasing the number and / or function of tetraspanins, functional fragments thereof, and / or functional variants thereof in the neutrophils and / or migrasomes.
7. The method according to any one of claims 5-6, wherein Promoting the formation and / or function of the migrasomes includes overexpressing tetraspanins, functional fragments thereof, and / or functional variants thereof in the neutrophils.
8. The method according to claim 7, wherein, The tetraspanins include TSPAN1, TSPAN2, TSPAN4, TSPAN6, TSPAN7, TSPAN9, TSPAN18, CD82, CD81, TSPAN13, CD53, TSPAN3, TSPAN5, and / or CD37.
9. The method according to any one of claims 5-8, wherein Promoting the formation and / or function of the migrasomes includes increasing the number and / or function of sphingomyelin.
10. The method according to claim 9, wherein, Promoting the formation and / or function of the migrasomes includes increasing the conversion of ceramide to sphingomyelin in the cells.
11. The method according to any one of claims 9-10, wherein, Promoting the formation and / or function of the migrasomes includes increasing the expression and / or function of sphingomyelin synthase in the cells.
12. The method according to any one of claims 9-11, wherein, Promoting the formation and / or function of the migrasomes includes overexpressing sphingomyelin synthase 2 (SGMS2), functional fragments thereof, and / or functional variants thereof in the neutrophils.
13. The method according to any one of claims 9-12, wherein, Promoting the formation and / or function of the migrasomes includes reducing the degradation of sphingomyelin to ceramide in the neutrophils.
14. The method according to any one of claims 9 - 13, wherein, Promoting the formation and / or function of the migrasomes includes reducing the expression and / or function of sphingomyelinase (SMase) in the neutrophils.
15. The method according to any one of claims 5-14, wherein, Promoting the formation and / or function of the migrasomes includes increasing the number and / or function of PIP2, PIP5K1, and / or Rab35.
16. The method according to claim 15, wherein, The PIP2 includes PI(4,5)P2.
17. The method according to any one of claims 15-16, wherein, Promoting the formation and / or function of the migrasomes includes increasing the conversion of PI4P to PIP2.
18. The method according to any one of claims 15-17, wherein Promoting the formation and / or function of the migrasomes includes increasing the number and / or function of PI4P kinases.
19. The method according to any one of claims 15 - 18, wherein, Promoting the formation and / or function of the migrasomes includes increasing the expression and / or function of PIP5K1, functional fragments thereof, and / or functional variants thereof.
20. The method according to any one of claims 15-19, wherein The PIP5K1 includes PIP5K1α and / or PIP5K1γ.
21. The method according to any one of claims 15-20, wherein, Promoting the formation and / or function of the migrasomes includes reducing the degradation of PIP2 to PI4P in the neutrophils.
22. The method according to any one of claims 15-21, wherein, Promoting the formation and / or function of the migrasomes includes reducing the expression and / or function of PLCD3 in the neutrophils.
23. The method according to any one of claims 15-22, wherein, Promoting the formation and / or function of the migrasomes includes increasing the expression and / or function of Rab35.
24. The method according to any one of claims 5-23, wherein, Promoting the formation and / or function of the migrasomes includes increasing the number and / or function of cholesterol in the cells that generate the neutrophils.
25. The method according to claim 24, wherein, The promotion of migrasome formation and / or function includes increasing cholesterol synthesis and / or uptake in the neutrophils.
26. The method according to any one of claims 24-25, wherein, Promoting cholesterol uptake includes culturing the neutrophils in a cholesterol-enriched environment.
27. The method according to any one of claims 5-26, wherein, The promotion of migrasome formation and / or function includes increasing the quantity and / or function of integrin proteins and / or extracellular matrix (ECM) proteins.
28. The method according to claim 27, wherein, The integrin proteins include integrin α1, integrin α2, integrin α3, integrin α5, and / or integrin α6.
29. The method according to any one of claims 27-28, wherein, The ECM proteins include fibronectin, laminin, and / or collagen.
30. The method according to any one of claims 5-29, wherein, The promotion of migrasome function includes increasing the quantity and / or function of coagulation factors, their functional fragments, and / or their functional variants on the migrasomes.
31. The method according to claim 30, wherein, The coagulation factors include prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII, and / or vWF.
32. The method according to any one of claims 1-31, wherein The method reduces blood coagulation and / or platelet function and includes inhibiting the formation and / or function of the migrasomes.
33. The method according to claim 32, wherein, The inhibition of migrasome formation and / or function includes inhibiting the expression and / or function of tetraspanins in the neutrophils and / or migrasomes.
34. The method according to claim 33, wherein, The inhibition of the expression and / or function of tetraspanins includes knocking out or knocking down the expression of the gene encoding the tetraspanin in the neutrophils.
35. The method according to any one of claims 33-34, wherein, The tetraspanins include tetraspanin 4 and / or tetraspanin 9.
36. The method according to any one of claims 32-35, wherein, The inhibition of migrasome formation and / or function includes reducing the quantity and / or function of sphingomyelin.
37. The method according to claim 36, wherein, The inhibition of migrasome formation and / or function includes reducing the conversion of ceramide to sphingomyelin in the cells.
38. The method according to any one of claims 36-37, wherein, The inhibition of migrasome formation and / or function includes reducing the expression and / or function of sphingomyelin synthase in the cells.
39. The method according to any one of claims 36-38, wherein the inhibition of migrasome formation and / or function includes knocking out or knocking down sphingomyelin synthase 2 (SGMS2), its functional fragments, and / or its functional variants in the neutrophils.
40. The method according to claim 39, wherein the inhibition of migrasome formation and / or function includes providing a reagent capable of inhibiting the function of SGMS2.
41. The method according to claim 40, wherein, The SGMS2 inhibitor inhibits the assembly of SGMS2 foci and / or the catalytic activity of SGMS2.
42. The method according to claim 41, wherein, The SGMS2 inhibitors include SGMS2-IN-1, SGMS2-IN-2, Ly93, dominant negative SGMS2, and / or their derivatives.
43. The method according to any one of claims 36 - 42, wherein, The inhibition of migrasome formation and / or function includes increasing the degradation of sphingomyelin to ceramide in the neutrophils.
44. The method according to any one of claims 36-43, wherein, The inhibition of migrasome formation and / or function includes increasing the expression and / or function of sphingomyelinase (SMase) in the neutrophils.
45. The method according to any one of claims 32 - 44, wherein, The inhibition of migrasome formation and / or function includes reducing the quantity and / or function of PIP2, PIP5K1, and / or Rab35.
46. The method according to claim 45, wherein, The PIP2 includes PI(4,5)P2.
47. The method according to any one of claims 45 - 46, wherein, The inhibition of migrasome formation and / or function includes reducing the conversion of PI4P to PIP2.
48. The method according to any one of claims 45-47, wherein, The inhibition of migrasome formation and / or function includes reducing the amount and / or function of PI4P kinases.
49. The method according to any one of claims 45 - 48, wherein, The inhibition of migrasome formation and / or function includes reducing the expression and / or function of PIP5K1, its functional fragments, and / or its functional variants.
50. The method according to claim 49, wherein, The PIP5K1 includes PIP5K1α and / or PIP5K1γ.
51. The method according to any one of claims 45 - 50, wherein, The inhibition of migrasome formation and / or function includes increasing the degradation of PIP2 to PI4P in the neutrophils.
52. The method according to any one of claims 45-51, wherein, The inhibition of migrasome formation and / or function includes increasing the expression and / or function of PLCD3 in the neutrophils.
53. The method according to any one of claims 45 - 52, wherein, The inhibition of migrasome formation and / or function includes reducing the expression and / or function of Rab35.
54. The method according to any one of claims 45 - 53, wherein, The inhibition of migrasome formation and / or function includes providing ITGa5 that is not bound to Rab35.
55. The method according to any one of claims 32 - 54, wherein, The inhibition of migrasome formation and / or function includes reducing the amount and / or function of cholesterol in the cells that generate the neutrophils.
56. The method according to claim 55, wherein, The inhibition of migrasome formation and / or function includes inhibiting cholesterol synthesis and / or uptake in the neutrophils.
57. The method according to any one of claims 55 - 56, wherein, The inhibition of cholesterol synthesis and / or uptake in the neutrophils includes administering a cholesterol synthesis inhibitor to the neutrophils.
58. The method according to claim 57, wherein, The cholesterol synthesis inhibitor includes pravastatin.
59. The method according to any one of claims 55 - 58, wherein, Inhibiting cholesterol uptake includes culturing the neutrophils in a cholesterol-free environment.
60. The method according to any one of claims 32 - 59, wherein, The inhibition of migrasome formation and / or function includes reducing the amount and / or function of integrin proteins and / or extracellular matrix (ECM) proteins.
61. The method according to claim 60, wherein, The integrin proteins include integrin α1, integrin α2, integrin α3, integrin α5, and / or integrin α6.
62. The method according to any one of claims 60 - 61, wherein, The ECM proteins include fibronectin, laminin, and / or collagen.
63. The method according to any one of claims 32-62, wherein, The inhibition of migrasome function includes reducing the amount and / or function of coagulation factors, their functional fragments, and / or their functional variants on the migrasomes.
64. The method according to claim 63, wherein, The reduction of the amount and / or function of coagulation factors includes treating the migrasomes with a reagent capable of inhibiting the function of the coagulation factors.
65. The method according to any one of claims 63-64, wherein, The reagent capable of inhibiting the function of the coagulation factors includes proteases, small molecules, and / or antibodies capable of inhibiting the activity of the coagulation factors.
66. The method according to any one of claims 63-65, wherein, The coagulation factors include prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII, and / or vWF.
67. A method of regulating blood coagulation, the method including providing a migrasome derived from neutrophils.
68. The method according to claim 67, wherein, The migrasome includes coagulation factors, their functional fragments, and / or their functional variants.
69. The method according to claim 68, wherein, The coagulation factors include prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII, and / or vWF.
70. The method according to any one of claims 67-69, wherein The regulation of blood coagulation includes regulating bleeding.
71. The method according to any one of claims 67 - 70, wherein, The migrasome is Ly6G + .
72. A migrasome derived from neutrophils.
73. The migrasome according to claim 72, wherein, The migrasome is Ly6G + .
74. The migrasome according to any one of claims 72-73, wherein, The migrasome is MPO positive.
75. The migrasome according to any one of claims 72-74, wherein, The migrasome is used for regulating blood coagulation.
76. A reagent for regulating the formation and / or function of migrasomes derived from neutrophils.
77. The reagent for adjustment according to claim 76, wherein, The reagent regulates the amount and / or function of tetraspanins, their functional fragments, and / or their functional variants in the neutrophils and / or the migrasomes.
78. The reagent for regulation according to claim 77, wherein, The reagent modulates the amount and / or function of sphingomyelin.
79. A reagent for regulation according to any one of claims 76-78, wherein, The reagent modulates the amount and / or function of PIP2, PIP5K1, and / or Rab35.
80. A reagent for regulation as described in any one of claims 76-79, wherein, The reagent modulates the amount and / or function of cholesterol in the cells that generate the neutrophils.
81. A reagent for regulation according to any one of claims 76 - 80, wherein, The reagent modulates the amount and / or function of integrin proteins and / or extracellular matrix (ECM) proteins.
82. A reagent for regulation according to any one of claims 76-81, wherein, The reagent modulates the amount and / or function of coagulation factors, functional fragments thereof, and / or functional variants thereof on the migrasomes.
83. An engineered cell that has the ability to alter coagulation and / or platelet function relative to a corresponding unmodified cell, wherein the engineered cell has been modified to alter its migrasome-generating ability.
84. The engineered cell according to claim 83, wherein, The engineered cell has been modified to increase its ability to generate migrasomes.
85. The engineered cell according to claim 84, wherein, The engineered cell has been modified to increase the amount and / or function of tetraspanins therein.
86. The engineered cell according to claim 85, wherein, The engineered cell has been modified to overexpress tetraspanins, functional fragments thereof, functional variants thereof, and / or nucleic acid molecules encoding one or more of them.
87. The engineered cell according to any one of claims 85-86, wherein, The tetraspanins include TSPAN1, TSPAN2, TSPAN4, TSPAN6, TSPAN7, TSPAN9, TSPAN18, CD82, CD81, TSPAN13, CD53, TSPAN3, TSPAN5, and / or CD37.
88. The engineered cell according to any one of claims 84-87, wherein, The engineered cell has been modified to increase the amount and / or function of sphingomyelin.
89. The engineered cell according to claim 88, wherein, The engineered cell has been modified to increase the conversion of ceramide to sphingomyelin in the cell.
90. The engineered cell according to any one of claims 88-89, wherein, The engineered cell has been modified to increase the expression and / or function of sphingomyelin synthase in the cell.
91. The engineered cell according to any one of claims 88-90, wherein, The engineered cell has been modified to overexpress sphingomyelin synthase 2 (SGMS2), functional fragments thereof, and / or functional variants thereof in the neutrophils.
92. The engineered cell according to any one of claims 88-91, wherein, The engineered cell has been modified to reduce the degradation of sphingomyelin to ceramide in the neutrophils.
93. The engineered cell according to any one of claims 88-92, wherein, The engineered cell has been modified to reduce the expression and / or function of sphingomyelinase (SMase) in the neutrophils.
94. The engineered cell according to any one of claims 84-93, wherein, The engineered cell has been modified to increase the amount and / or function of PIP2, PIP5K1, and / or Rab35.
95. The engineered cell according to claim 94, wherein, The PIP2 includes PI(4,5)P2.
96. The engineered cell according to any one of claims 94-95, wherein, The engineered cell has been modified to increase the conversion of PI4P to PIP2.
97. The engineered cell according to any one of claims 94-96, wherein, The engineered cell has been modified to increase the amount and / or function of PI4P kinase.
98. The engineered cell according to any one of claims 94-97, wherein, The engineered cell has been modified to increase the expression and / or function of PIP5K1, functional fragments thereof, and / or functional variants thereof.
99. The engineered cell according to any one of claims 94-98, wherein, The PIP5K1 includes PIP5K1α and / or PIP5K1γ.
100. The engineered cell according to any one of claims 94-99, wherein, The engineered cell has been modified to increase the degradation of PIP2 to PI4P in the neutrophils.
101. The engineered cell according to any one of claims 94-100, wherein, The engineered cell has been modified to reduce the expression and / or function of PLCD3 in the neutrophils.
102. The engineered cell according to any one of claims 94-101, wherein, The engineered cell has been modified to increase the expression and / or function of Rab35.
103. The engineered cell according to any one of claims 84-102, wherein, The engineered cell has been modified to increase the amount and / or function of cholesterol in the cells that generate the neutrophils.
104. The engineered cell according to claim 103, wherein, The engineered cells have been modified to increase cholesterol synthesis and / or uptake in the neutrophils.
105. The engineered cell according to any one of claims 103-104, wherein, Promoting cholesterol uptake includes culturing the neutrophils in a cholesterol-enriched environment.
106. The engineered cell according to any one of claims 84-105, wherein, The engineered cells have been modified to increase the quantity and / or function of integrin proteins and / or extracellular matrix (ECM) proteins.
107. The engineered cell according to claim 106, wherein, The integrin proteins include integrin α1, integrin α2, integrin α3, integrin α5, and / or integrin α6.
108. The engineered cell according to any one of claims 106-107, wherein, The ECM proteins include fibronectin, laminin, and / or collagen.
109. The engineered cell according to any one of claims 84-108, wherein, The engineered cells have been modified to increase the quantity and / or function of coagulation factors, functional fragments thereof, and / or functional variants thereof on the migrasomes.
110. The engineered cell according to claim 109, wherein, The coagulation factors include prothrombin, factor XIII, factor X, factor VIII, factor XI, factor XII, and / or vWF.
111. The engineered cell according to claim 83, wherein, The engineered cells have been modified to reduce the ability to generate migrasomes.
112. The engineered cell according to claim 111, wherein, The engineered cells have been modified to reduce the quantity and / or function of tetraspanins therein.
113. The engineered cell according to claim 112, wherein, The expression of the gene encoding the tetraspanin has been knocked out or knocked down.
114. The engineered cell according to any one of claims 112-113, wherein, The tetraspanins include tetraspanin 4 and / or tetraspanin 9.
115. The engineered cell according to any one of claims 111-114, wherein, The engineered cells have been modified to reduce the quantity and / or function of sphingomyelin.
116. The engineered cell according to claim 115, wherein, The engineered cells have been modified to reduce the conversion of ceramide to sphingomyelin in the cells.
117. The engineered cell according to any one of claims 115-116, wherein, The engineered cells have been modified to reduce the expression and / or function of sphingomyelin synthase in the cells.
118. The engineered cell according to any one of claims 115-117, wherein, The engineered cells have been modified to knockout or knockdown sphingomyelin synthase 2 (SGMS2), functional fragments thereof, and / or functional variants thereof in the neutrophils.
119. The engineered cell according to claim 118, wherein, The engineered cells have been modified to provide a reagent capable of inhibiting the function of SGMS2.
120. The engineered cell according to claim 119, wherein the SGMS2 inhibitor inhibits the assembly of SGMS2 foci and / or the catalytic activity of SGMS2.
121. The engineered cell according to any one of claims 119-120, wherein, The SGMS2 inhibitors include SGMS2-IN-1, SGMS2-IN-2, Ly93, dominant-negative SGMS2, and / or derivatives thereof.
122. The engineered cell according to any one of claims 115-121, wherein, The engineered cells have been modified to increase the degradation of sphingomyelin to ceramide in the neutrophils.
123. The engineered cell according to any one of claims 115-122, wherein, The engineered cells have been modified to increase the expression and / or function of sphingomyelinase (SMase) in the neutrophils.
124. The engineered cell according to any one of claims 111-123, wherein, The engineered cells have been modified to reduce the quantity and / or function of PIP2, PIP5K1, and / or Rab35.
125. The engineered cell according to claim 124, wherein, The PIP2 includes PI(4,5)P2.
126. The engineered cell according to any one of claims 124-125, wherein, The engineered cells have been modified to reduce the quantity and / or function of PI4P kinases.
127. The engineered cell according to any one of claims 124-126, wherein, The engineered cells have been modified to reduce the expression and / or function of PIP5K1, functional fragments thereof, and / or functional variants thereof.
128. The engineered cell according to any one of claims 124-127, wherein, The PIP5K1 includes PIP5K1α and / or PIP5K1γ.
129. The engineered cell according to any one of claims 124-128, wherein, The engineered cells have been modified to increase the degradation of PIP2 to PI4P in the neutrophils.
130. The engineered cell according to any one of claims 124-129, wherein, The engineered cells have been modified to increase the expression and / or function of PLCD3 in the neutrophils.
131. The engineered cell according to any one of claims 124-130, wherein, The engineered cells have been modified to reduce the expression and / or function of Rab35.
132. The engineered cell according to any one of claims 124-131, wherein, The engineered cells have been modified to express ITGa5 that is not bound to Rab35.
133. The engineered cell according to any one of claims 111-132, wherein, The engineered cells have been modified to reduce the amount and / or function of cholesterol in the cells that generate the neutrophils.
134. The engineered cell according to claim 133, wherein, The engineered cells have been modified to inhibit cholesterol synthesis and / or uptake in the neutrophils.
135. The engineered cell according to any one of claims 133-134, wherein, The engineered cells have been modified to administer a cholesterol synthesis inhibitor.
136. The engineered cell according to claim 135, wherein, The cholesterol synthesis inhibitor includes pravastatin.
137. The engineered cell according to any one of claims 133-136, wherein, Inhibiting cholesterol uptake includes culturing the neutrophils in a cholesterol-free environment.
138. A composition comprising a migrasome according to any one of claims 72-75, a reagent according to any one of claims 76-82, and / or an engineered cell according to any one of claims 83-137.
139. The composition according to claim 138, which is a pharmaceutical composition and may optionally include a pharmaceutically acceptable excipient.
140. A kit comprising a migrasome according to any one of claims 72-75, a reagent according to any one of claims 76-82, an engineered cell according to any one of claims 83-137, and / or a composition according to any one of claims 138-139.
141. A method for monitoring coagulation and / or platelet function, the method comprising analyzing the presence, quantity, and / or function of migrasomes obtained from a biological sample.
142. The method according to claim 141, wherein, The platelet function includes platelet aggregation and / or thrombin generation.
143. The method according to any one of claims 141 - 142, wherein, The biological sample includes a body fluid sample of a subject.
144. The method according to any one of claims 141 - 143, wherein, The biological sample includes a blood sample of a subject.
145. The method according to any one of claims 141-144, wherein, An increase in the quantity of the migrasomes indicates an increase in the coagulation and / or platelet function.
146. The method according to any one of claims 141 - 145, wherein, Analyzing the presence, quantity, and / or function of the migrasomes includes analyzing the presence and / or quantity of marker molecules of the migrasomes.
147. The method according to any one of claims 141-146, wherein analyzing the presence, quantity, and / or function of the migrasome comprises determining Tspan4 + , Integrin + , Pleckstrin homology (PH) domain + , NDST1 + , PIGK + , CPQ + , EOGT + , KUL01 + , CD115 + and / or the presence and / or quantity of CCR2 + vesicles.
148. The method according to any one of claims 141 - 147, wherein, Analyzing the presence, quantity, and / or function of the migrasomes includes staining the biological sample with wheat germ agglutinin (WGA).
149. The method according to any one of claims 141-148, wherein, The migrasome is Ly6G + .
150. The method according to any one of claims 141-149, wherein, The migrasomes are positive for MPO.
151. A method for modulating blood coagulation and / or platelet function, the method comprising: (i) Monitoring coagulation according to any one of claims 141-150; and (ii) administering a modulator according to the result of step (i).
152. A method for monitoring migrasomes derived from neutrophils, the method comprising analyzing the presence and / or quantity of marker molecules of the migrasomes.
153. The method according to claim 152, wherein, The migrasomes are positive for MPO.
154. The method according to any one of claims 152 - 153, wherein, Analysis of the presence, quantity, and / or function of the migrasome includes determining Tspan4 in the biological sample + , Integrin + , Pleckstrin homology (PH) domain + , NDST1 + , PIGK + , CPQ + , EOGT + , KUL01 + , CD115 + and / or the presence and / or quantity of CCR2 + vesicles.
155. The method according to any one of claims 152 - 154, wherein, Analyzing the presence, quantity, and / or function of the migrasomes includes staining the biological sample with wheat germ agglutinin (WGA).
156. The method according to any one of claims 152-155, wherein, The migrasome is Ly6G + .
157. A method for isolating platelets, the method comprising excluding migrasomes derived from neutrophils from a sample.
158. The method according to claim 157, wherein, The method includes removing neutrophils before collecting the biological sample.
159. The method according to any one of claims 157-158, wherein, The method includes providing a Ly6G binder to remove neutrophils.
160. The method according to any one of claims 157-159, wherein, The method includes providing an anti-Ly6G antibody to remove neutrophils.
161. The method according to any one of claims 157 - 160, wherein, The method includes providing an anti-Ly6G antibody five days or more before collecting the biological sample.
162. The method according to any one of claims 157-161, wherein, The method further includes collecting the platelets by centrifugation.
163. A composition comprising platelets isolated according to any one of claims 157-162.
164. The composition according to claim 163, which is a pharmaceutical composition and optionally comprises a pharmaceutically acceptable excipient.
165. A kit comprising platelets isolated according to any one of claims 157-162 and / or the composition according to any one of claims 163-164.