Anti-fibrosis microRNA compositions

Abstract

Provided herein are compositions and methods for treating fibrosis using miR-25 mimetics. More specifically, disclosed herein are novel mimetics, and methods for attenuating the progression of fibrosis, in particular liver fibrosis, in a subject.

Description

[0001] Related Applications

[0002] This application claims priority to Australian Provisional Application No. 2022902721, titled "MicroRNA (miRNA) Compositions for Anti-Fibrosis," filed on September 20, 2022, the content of which is incorporated herein by reference in its entirety. Field of the Invention

[0003] The present invention generally relates to compositions and methods for treating fibrosis. More specifically, the present invention relates to novel miR mimics and methods for attenuating fibrosis progression in a subject. Background of the Invention

[0005] Any reference in this specification to any prior publication (or information derived therefrom) or to any matter known is not, and should not be taken to be, an admission or acknowledgment or any form of implication that the prior publication (or information derived therefrom) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

[0006] Hepatic stellate cells (HSCs) are part of the non-parenchymal cell compartment of the liver and act together with macrophages (Kupffer cells), other non-parenchymal hepatocytes, and hepatocytes to support liver function. In a healthy organ, HSCs are quiescent cells that store cytoplasmic vitamin A, regulate sinusoidal blood flow, and have immunocyte functions (Geerts 2001). During tissue injury, profibrotic factors such as transforming growth factor β (TGF-β) are released from cells including Kupffer cells and HSCs, causing HSC activation and subsequent transdifferentiation into myofibroblast-like cells (Friedman 2008). In contrast to the quiescent state, activated HSCs express excessive levels of extracellular matrix (ECM) proteins and are highly contractile (by α-smooth muscle actin (αSMA) expression), proliferative, inflammatory, and profibrotic cells. Following chemokine gradients, HSCs migrate to the site of injury, where they secrete fibrillar collagens type I, III, and IV and regulate ECM degradation by altering the expression of matrix metalloproteinases (MMPs) and their inhibitors (tissue inhibitors of metalloproteinases (TIMPs)) (Bataller and Brenner 2005). Thus, HSC activation is considered the major event in hepatic fibrogenesis (by increased collagen expression) (Mederacke et al., 2013). The TGF-β signaling pathway plays a major role in the progression of liver fibrosis due to its dysregulation in the diseased state, inducing HSC proliferation and excessive collagen expression (Dooley et al., 2001). Constitutive active Notch signaling is also involved in HSC activation (Villanueva et al., 2012; Xie et al., 2013), and the crosstalk between the TGF-β and Notch signaling pathways is emphasized as an important mechanism in the progression of liver fibrosis (Bansal et al., 2015; Wang et al., 2017).

[0007] MicroRNA (miRNA) is an important regulator of a series of cellular processes, including proliferation (leSage et al., 2007), differentiation (Yu et al., 2008), protein and gene expression (Eichorn et al., 2014; Guo et al., 2010). They interact with the RNA-induced silencing complex (RISC) and bind to target messenger RNA (mRNA) through complementary base pairing, thereby inhibiting mRNA translation or promoting degradation (Bartel 2009; Ha and Kim 2014). miRNAs have been developed as novel therapeutic agents due to their stability and accessibility in body fluids (such as serum) (Krauskopf et al., 2017). Importantly, miRNAs are involved in post-transcriptional gene regulation of the TGF-β and Notch signaling pathways (Ichimura et al., 2011; Inui et al., 2010), and thus are considered to play a key role in fibrogenesis.

[0008] The present inventors previously demonstrated that miR-25-3p (miR-25) was downregulated in the sera of children with cystic fibrosis associated with liver disease (CFLD) (including hepatic fibrosis) compared to those with cystic fibrosis without liver disease, indicating a protective role of miR-25 in preventing the development of hepatic fibrosis (Cook et al., 2015). Recently, the present inventors found that miR-25 was endogenously expressed in human and murine HSCs and was upregulated in vitro and in vivo during HSC activation (Genz et al., 2019). Using pull-down experiments and target gene sequencing, the present inventors identified ADAM-17 and FKBP14 (integrating mediators of Notch signaling) as direct targets of miR-25. Overexpression of miR-25 in activated HSCs inhibited the expression of ADAM-17 and FKBP14 target genes, thereby inhibiting Notch-1 receptor cleavage and translocation of the intracellular domain of the signaling active form (NICD1) to the nucleus. In addition, miR-25 blocked the expression of TGF-β receptor I (TGF-βRI), a target of the Notch signaling pathway, thereby inhibiting TGF-β-induced collagen I expression (Genz et al., 2019). These results highlight the potential of miR-25 as an anti-fibrotic agent; however, transient transfection of a commercially available miR-25 mimic into HSCs showed relatively modest effects, with limited target gene inhibition efficiency (up to 25%) (Genz et al., 2019). This inspired the design of a proprietary miR-25 mimic to further investigate the effect of miR-25 on the HSC phenotype. Summary of the Invention

[0009] The present invention is based in part on the discovery that phosphorothioate-linked and 2'-O-methyl-modified miR-25 mimics significantly increase the protective anti-fibrotic effects of miR-25 in activated human HSCs. Specifically, compared to commercially available mimics, the downregulation of the target genes FKBP14 and ADAM-17 is significantly increased, resulting in subsequent inhibition of TGF-βRI and TGFβ-induced collagen type 1a1 (COL1A1) expression. In addition, the mRNA expression of type I fibrillar collagens (COL1A1, COL1A2) and type III fibrillar collagen (COL3A1) is significantly downregulated. Accordingly, the inventors believe that miR-25 proprietary mimetic, due to its higher efficacy in inhibiting TGF-β-induced fibrillar collagen expression, can be used as a potential novel anti-fibrotic therapeutic agent to attenuate liver fibrosis progression.

[0010] In some embodiments, the first strand corresponds to nucleotide residues 52-73 of the mature miR-25 sequence shown in SEQ ID NO:1, is conjugated with two uracil residues at the 3' end, and has at least one modified nucleotide. In some embodiments, the second strand hybridizes to the first strand at least under low stringency conditions and has at least one modified nucleotide.

[0011] In some embodiments, the modified nucleotide comprises a nucleotide having a backbone modification and / or a sugar residue. In some embodiments of this type, the backbone modification includes one or more of phosphorothioate, morpholino, methyl phosphonate, amide bond, or phosphonocarboxylate bond. In some preferred embodiments, the first two nucleotides at the 5' end of the first strand are linked to each other by a phosphorothioate bond. In some preferred embodiments, the last 4 or 5 nucleotides at the 3' end of the first strand are linked to each other by a phosphorothioate bond. In additional embodiments, at least one of the 3' nucleotides of the first strand is a 2'-O-methyl-modified nucleotide. In additional embodiments, at least one nucleotide of the first strand is a 2'-fluoro nucleotide. In some embodiments, the first strand does not have a modified sugar residue at the second position at both the 5' and 3' ends.

[0012] In some embodiments, the backbone modification of the second strand includes one or more of phosphorothioate, morpholino, methyl phosphonate, amide, or phosphonyl carboxylate linkages. In some preferred embodiments, the first two nucleotides at the 5'-end of the second strand are linked by phosphorothioate linkages. In another embodiment, the last seven nucleotides at the 3'-end of the second strand are linked by phosphorothioate linkages. In another embodiment, the first nucleotide at the 5'-end of the second strand is a 2'-O-methyl modified nucleotide. In another embodiment, the first seven nucleotides at the 3'-end of the second strand are 2'-O-methyl modified nucleotides.

[0013] In another aspect of the invention, the miR-25 mimic compounds are as shown in Table 1. In some embodiments, the first strand comprises a sequence selected from SEQ ID NO: 2, 4, 9, 11, 12, 13, or 14, and the second strand comprises the sequence shown in SEQ ID NO: 5. In a preferred embodiment, the first strand comprises the sequence of SEQ ID NO: 2, and the second strand comprises the sequence of SEQ ID NO: 5. In another preferred embodiment, the first strand comprises the sequence of SEQ ID NO: 11, and the second strand comprises the sequence of SEQ ID NO: 5. In another preferred embodiment, the first strand comprises the sequence of SEQ ID NO: 13, and the second strand comprises the sequence of SEQ ID NO: 5.

[0014] In another aspect, the invention provides a pharmaceutical composition comprising a miR-25 mimic compound, the mimic compound comprising a first strand and a second strand, consisting of or consisting essentially of a first strand and a second strand, the first strand comprising a sequence selected from Table 1 or Table 2, the second strand comprising the sequence shown in SEQ ID NO: 5; and a pharmaceutically acceptable carrier, excipient, and / or diluent

[0015] In yet another aspect, the invention provides a method for treating or preventing fibrosis in a subject. As an illustrative example, the fibrosis is liver fibrosis.

[0016] In some embodiments, the miR-25 compound can reduce the expression of COL1A1, COL1A2, COL3A1, COL4A3, COL5A2, COL11A1, FN1, MMP2, CTGF, TGFB2, and / or TGFB3.

[0017] In some embodiments, the mir-25 mimic compound is used for manufacturing a medicament for therapeutically treating fibrosis (such as liver fibrosis). BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The following figures form a part of the specification and are included to further illustrate certain aspects of the present disclosure. The present disclosure can be better understood by referring to one or more of these figures in combination with the detailed description of the specific embodiments presented herein.

[0019] Figure 1 . Optimize the concentration of the novel miR-25 mimic using FKBP14 target gene downregulation. Titrate the novel miR-25 mimic from 5 pmol / mL to 50 pmol / mL (combinations 1 - 8; A - H). Commercially available miR-25 (CM) and negative control (-ve) mimics were used at 20 pmol / mL as previously described (Genz, B et al., Scientific Reports, 2019). Transiently transfect LX-2 cells with miR-25 mimics or controls (Caenorhabditis elegans non-specific miRNA mimics) and analyze using qRT-PCR after 48 hours. Evaluate the optimal target gene downregulation using FKBP14 relative mRNA expression, normalized to GAPDH and negative control expression. Data are represented as mean ± SEM. n = 3 - 4. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates P < 0.05).

[0020] Figure 2 . Optimize the concentration of the novel miR-25 mimic using FKBP14 target gene downregulation. Titrate the novel miR-25 mimic from 5 pmol / mL to 40 pmol / mL (combinations 10 - 16). Negative control (-ve) mimics were used at 20 pmol / mL as previously described (Genz, B et al., Scientific Reports, 2019). Transiently transfect LX-2 cells with miR-25 mimics or controls (Caenorhabditis elegans non-specific miRNA mimics) and analyze using qRT-PCR after 48 hours. Evaluate the optimal target gene downregulation using FKBP14 relative mRNA expression, normalized to GAPDH and negative control expression. Data are represented as mean ± SEM. n = 3. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates P < 0.05).

[0021] Figure 3. Analyze the effects of C3 miR-25 mimics on the mRNA and protein expressions of FKBP14 and ADAM-17. The optimized concentration of combination 3 (C3; 5, 20, 40 pmol / mL), commercially available miR-25 mimics (CM; 20 and 40 pmol / mL), and negative control (-ve; non-specific Caenorhabditis elegans miRNA mimics; 20 pmol / mL) were transfected into LX-2 cells. (A-B) At 48 hours after transfection, the mRNA expressions of the aforementioned 20 key target genes of miR-25, FKBP14, and ADAM-17 were analyzed using qRT-PCR. (C-D) At 72 hours after transfection, protein expression was analyzed by Western blotting. Data are presented as mean ± SEM. n = 3-12. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates P < 0.05).

[0022] Figure 4 . 48-hour protein expression analysis of miRNA-25 targets. At 48 hours after transfection with C3, CM, and negative control, protein expressions of miRNA-25 targets, FKBP14 (A), ADAM-17 (B), and TGFBR1 (C) were analyzed by Western blotting. Data are presented as mean ± SEM. n = 7-18. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis.

[0023] Figure 5 . Analyze the effects of C13 and C15 miR-25 mimics on the mRNA and protein expressions of FKBP14 and ADAM-17. The optimized concentration of combination 13 (C13) and combination 15 (C15; 5, 20, 40 pmol / mL) and negative control (-ve; non-specific Caenorhabditis elegans miRNA mimics; 20 pmol / mL) were transfected into LX-2 cells. At 48 hours after transfection, the mRNA expressions of the aforementioned key target genes of miR-25, FKBP14 (A, C), and ADAM-17 (B, D) were analyzed using qRT-PCR. Data are presented as mean ± SEM. n = 3-5. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates P < 0.05).

[0024] Figure 6. Analyze the effects of C3 miR-25 mimics on the secretion, mRNA, and protein expression of collagen type 1α1. Transfect optimized concentrations of C3 (5, 20, 40 pmol / mL), commercially available miR-25 mimics (CM; 20 and 40 pmol / mL), and negative control (-ve; non-specific Caenorhabditis elegans miRNA mimic; 20 pmol / mL) into LX-2 cells. (A) At 48 hours after transfection, analyze the mRNA expression of fibrillar collagen 1α1 using qRT-PCR. (B) At 72 hours after transfection, analyze the protein expression of fibrillar collagen 1α1 using Western blot. (C) At 72 hours after transfection, collect cell supernatants from transfected LX-2 cells. Collagen secretion is analyzed using the Abcam human procollagen Iα1 ELISA kit. (D) After transfection with recombinant human TGF-β (10 ng / mL) or RNase-free water (control treatment (Ctrl)) for 24 hours, perform a TGF-β stimulation assay by stimulating transfected LX-2 cells for 24 hours. The relative expression of collagen-1α1 and α-SMA mRNA is analyzed using qRT-PCR. Data are presented as mean ± SEM. n = 3 - 15. Data are analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001).

[0025] Figure 7 . Analyze the effects of C13 and C15 miR-25 mimics on the secretion, mRNA, and protein expression of collagen types 1α1 and 1α2. Transfect optimized concentrations of combinations 13 and 15 (5, 20, 40 pmol / mL) and negative control (-ve; non-specific Caenorhabditis elegans miRNA mimic; 20 pmol / mL) into LX-2 cells. At 48 hours after transfection, analyze the mRNA expression of fibrillar collagen 1α1 (A, C) and 1α2 (B, D) using qRT-PCR. Data are presented as mean ± SEM. n = 3 - 5. Data are analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001).

[0026] Figure 8. Effects of C3 miR-25 mimics on fibrillar collagen (secretion), mRNA, and protein expression. LX-2 cells were transfected with optimized concentrations of C3 (5, 20, 40 pmol / mL), commercially available miR-25 mimics (CM; 20 and 40 pmol / mL), and negative control (-ve; non-specific Caenorhabditis elegans miRNA mimic; 20 pmol / mL). (A) At 48 h after transfection, mRNA expression of fibrillar collagens type 1α2 and 3α1 was analyzed using qRT-PCR. (C-D) At 72 h after transfection, protein expression of fibrillar collagens 1α2 and 3α1 was analyzed using Western blotting. Data are represented as mean ± SEM. n = 3-16. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001).

[0027] Figure 9 . Target gene analysis of gelatinous collagen type IV using C3 miR-25 mimics. LX-2 cells were transfected with optimized concentrations of C3 (5, 20, 40 pmol / mL), commercially available miR-25 mimics (CM; 20 pmol / mL), and negative control (-ve; non-specific Caenorhabditis elegans miRNA mimic; 20 pmol / mL). At 48 h after transfection, mRNA expression of gelatinous collagen IV was analyzed using qRT-PCR. Data are represented as mean ± SEM. n = 6-15. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates p < 0.05, ** indicates p < 0.01).

[0028] Figure 10 . Effects of C3 miR-25 mimics on components of the TGF-β signaling pathway. LX-2 cells were transfected with optimized concentrations of C3 (5, 20, 40 pmol / mL), commercially available miR-25 mimics (CM; 20 and 40 pmol / mL), and negative control (-ve; non-specific Caenorhabditis elegans miRNA mimic; 20 pmol / mL). (A) At 48 h after transfection, mRNA expression of TGF-β receptor 1 was analyzed using qRT-PCR. (B) At 72 h after transfection, protein expression of TGF-β receptor 1 was analyzed using Western blotting. (C-F) At 48 h after transfection, mRNA expression of other components of TGF-β signaling was analyzed using qRT-PCR. Data are represented as mean ± SEM. n = 2-15. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001, **** indicates p < 0.0001).

[0029] Figure 11 . Effects of C13 and C15 miR-25 mimics on fibrillar collagen (secretion) and TGF-β signaling pathway, mRNA and protein expression. Optimized concentrations of C13 and C15 (5, 20, 40 pmol / mL) and negative control (-ve; non-specific Caenorhabditis elegans miRNA mimic; 20 pmol / mL) were transfected into LX-2 cells. At 48 hours after transfection, mRNA expression of procollagen type 3α1 and TGF-β receptor 1 was analyzed using qRT-PCR. Data are presented as mean ± SEM. n = 3 - 5. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates P < 0.05, ** indicates P < 0.01, *** indicates P < 0.001, **** indicates P < 0.0001).

[0030] Figure 12 . Target gene analysis of HSC ECM regulators using C3 miR-25 mimic. Optimized concentrations of C3 (5, 20, 40 pmol / mL), commercially available miR-25 mimic (CM; 20 pmol / mL) and negative control (-ve; non-specific Caenorhabditis elegans miRNA mimic; 20 pmol / mL) were transfected into LX-2 cells. At 48 hours after transfection, mRNA expression of collagen regulators was analyzed using qRT-PCR. Data are presented as mean ± SEM. n = 6 - 16. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis (* indicates p < 0.05, ** indicates p < 0.01, *** indicates p < 0.001).

[0031] Figure 13. Effects of C3 mimics on HSC activation markers. LX-2 cells were transfected with C3 (20 and 40 pmol / mL), commercially available miR-25 mimics (CM; 20 and 40 pmol / mL), and non-specific Caenorhabditis elegans miRNA mimics as a negative control (-ve; 40 pmol / mL). (A) Cell migration assay. Wounding was performed in confluent cell layers with a scratch wound marker. Wound width (μm) was measured every 2 hours for 24 hours using an IncuCyte Zoom live cell analysis system (left panel). The wound width after 24 hours is shown in the right panel. (B) Cell proliferation assay. Cells were incubated in an IncuCyte Zoom live cell analysis system for up to 7 days, and confluence was measured every 3 hours (left panel). The growth rate over time was calculated as the growth constant (K; right panel). (C) Cell contractility assay. Transfected cells were re-plated onto a collagen grid and stimulated to contract 48 hours after transfection by adding endothelin 1 (10 nM). Collagen matrix contraction was measured at 0.5, 1, 2.5, and 6 hours after adding endothelin 1 (left panel). The collagen area after 6 hours is shown in the right panel. Data are represented as mean ± SEM. n = 5 - 16. Data were analyzed using one-way ANOVA with Dunnett's post hoc analysis. Detailed implementation

[0032] 1. Definitions

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. For the purposes of the present invention, the following terms are defined as follows.

[0034] As used herein, the indefinite articles "a" and "an" are used herein to refer to or encompass a single or plural element or feature, and should not be construed to mean or limit "one" or "single" element or feature. For example, "a" protein includes one protein, one or more proteins.

[0035] The term "about" as used herein refers to the usual error range of each value readily known to those skilled in the art. The embodiments involving the value or parameter itself are included (and described) when a "about" value or parameter is mentioned herein.

[0036] The term "agent" includes compounds that induce a desired pharmacological and / or physiological effect. The term also encompasses pharmaceutically acceptable and pharmacologically active ingredients of those compounds specifically mentioned herein, including but not limited to salts, esters, amides, prodrugs, active metabolites, analogs, etc. When using the above term, it should be understood that this includes the agent itself as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, prodrugs, metabolites, analogs, etc. The term "agent" should not be construed narrowly, but extends to small molecules, bicyclic peptide mimetics such as peptides, polypeptides, and proteins, and compositions containing them and genetic molecules such as RNA, DNA, their mimetics, and chemical analogs, as well as cellular agents.

[0037] As used herein, "and / or" means and encompasses any and all possible combinations of one or more of the related listed items, as well as the absence of a combination when interpreted in the alternative (or).

[0038] "Coding sequence" means any nucleic acid sequence that contributes to encoding the polypeptide product of a gene or the final mRNA product of a gene (e.g., the mRNA product of a gene after splicing). In contrast, the term "non-coding sequence" means any nucleic acid sequence that does not contribute to encoding the polypeptide product of a gene or the final mRNA product of a gene.

[0039] Throughout the specification, unless the context requires otherwise, the word "comprise" and its various grammatical forms "comprises" and "comprising" will be understood to imply the inclusion of the stated step or element or group of steps or elements, but not the exclusion of any other step or element or group of steps or elements. Thus, the use of the term "comprise" etc. indicates that the listed elements are required or mandatory, but other elements are optional and may or may not be present. "Consisting of" means including and limited to whatever follows the phrase "consisting of". Thus, the phrase "consisting of" indicates that the listed elements are required or mandatory and that no other elements may be present. "Consisting essentially of" means including any element listed after the phrase and limited to other elements that do not interfere with or contribute to the activity or action specified for the listed elements in the present invention. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or mandatory, but other elements are optional and may or may not be present, depending on whether they affect the activity or action of the listed elements.

[0040] "Complementary" means that each nucleobase of the oligonucleotide is capable of pairing with the nucleobase at each corresponding position in the target nucleic acid. In certain embodiments, the oligonucleotide is fully complementary to the microRNA, i.e., each nucleobase of the oligonucleotide is complementary to the nucleobase at the corresponding position in the microRNA. In certain embodiments, an oligonucleotide in which each nucleobase is complementary to a nucleobase within the stem-loop sequence region of the microRNA is fully complementary to the microRNA stem-loop sequence.

[0041] "Corresponds to" means a nucleotide sequence that exhibits substantial sequence similarity or identity to a reference amino acid sequence. Typically, the amino acid sequence exhibits at least about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 97, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or even up to 100% sequence similarity or identity with at least a portion of the reference amino acid sequence.

[0042] "Derivative" means a molecule, such as a nucleotide sequence, derived from a basic molecule by modification, such as by conjugation or complexing with other chemical moieties, or by post-translational modification techniques understood in the art. The term "derivative" also includes within its scope alterations made to the parental sequence, including additions or deletions that provide functionally equivalent molecules.

[0043] "Effective amount" is at least the minimum amount required to achieve a measurable improvement or prevention of a particular disorder. The effective amount herein can vary depending upon factors such as the disease state, age, sex, and weight of the patient, and the ability of the polynucleotide to elicit the desired response in an individual. An effective amount is also an amount in which any toxic or detrimental effects of the treatment are outweighed by the therapeutic beneficial effects. For prophylactic applications, beneficial or desired results include results such as eliminating or reducing risk, alleviating severity, or delaying the onset of a disease, including biochemical, histological, and / or behavioral symptoms of the disease, its complications, and intermediate pathological phenotypes presented during the progression of the disease. For therapeutic uses, beneficial or desired results include clinical outcomes such as reducing one or more symptoms caused by the disease, improving the quality of life of those suffering from the disease, reducing the dosage of other medications required to treat the disease, enhancing the effect of another medication, such as by targeting, delaying the progression of the disease, and / or prolonging survival. The effective amount can be administered in one or more administrations. For the purposes of the present invention, an effective amount of a drug, compound, or pharmaceutical composition is an amount sufficient to directly or indirectly effect a prophylactic or therapeutic treatment. As understood in the clinical context, an effective amount of a drug, compound, or pharmaceutical composition can or cannot be achieved in combination with another drug, compound, or pharmaceutical composition. Thus, "effective amount" can be considered in the context of administering one or more therapeutic agents, and if administered in combination with one or more other active agents, a single active agent can be considered to be administered in an effective amount such that the desired result can be achieved or attained.

[0044] The term "expression" refers to the biosynthesis of a gene product. For example, in the case of a coding sequence, expression includes transcribing the coding sequence into mRNA and translating the mRNA into one or more polypeptides. In contrast, expression of a non-coding sequence includes transcribing the non-coding sequence into a transcript only. The term "expression" is also used herein to refer to the presence of a protein or molecule at a particular location and can thus be used interchangeably with "localization".

[0045] The term "expression" with respect to a gene sequence refers to transcribing the gene to produce an RNA transcript (e.g., mRNA, antisense RNA, siRNA, shRNA, miRNA, etc.), and optionally, translating the resulting mRNA transcript into a protein. Thus, it will be clear from the context that expression of a coding sequence results from transcription and translation of the coding sequence. In contrast, expression of a non-coding sequence results from transcription of the non-coding sequence.

[0046] "Fibrosis" refers to the formation or development of excessive fibrous connective tissue in an organ or tissue. In certain embodiments, fibrosis occurs as a repair or response process. In certain embodiments, fibrosis occurs in response to injury or trauma. The term "fibrosis" should be understood as the formation or development of excessive fibrous connective tissue in an organ or tissue as a repair or response process, as opposed to the formation of fibrous tissue as an abnormal constituent of an organ or tissue.

[0047] As used herein, the term "high" refers to a measure that is greater than a normal value, greater than a standard (e.g., a predetermined measure or a subgroup measurement), or relatively greater than another subgroup measure. A normal measure can be determined by any method available to those skilled in the art. The term "high" can also refer to a measure that is equal to or greater than a predetermined measure, e.g., a predetermined cut-off value. If a subject is not "high" for a particular biomarker, then the subject is "low" for that biomarker. Generally, the cut-off value used to determine whether a subject is "high" or "low" should be chosen such that the partitioning becomes clinically relevant.

[0048] As used herein, "hybridization" refers to the pairing of complementary nucleotide sequences to yield a DNA-DNA hybrid, a DNA-RNA hybrid, or an RNA-RNA hybrid. Complementary base sequences are those that are related by base-pairing rules. In DNA, A pairs with T, and C pairs with G. In RNA, U pairs with A, and C pairs with G. In this regard, the terms "match" and "mismatch" as used herein refer to the hybridization potential of paired nucleotides in complementary nucleic acid strands. Matched nucleotides hybridize effectively, e.g., the classic A-T / U and G-C base pairs described above. A mismatch is any other combination of nucleotides that do not hybridize effectively. In the present invention, preferred pairing mechanisms include hydrogen bonding between complementary nucleosides or nucleobases (nucleobases) of an oligomeric compound chain, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding. For example, adenine and thymine are complementary nucleobases that pair by forming hydrogen bonds. Hybridization can occur in a variety of circumstances known to those skilled in the art.

[0049] As used herein, the term "inhibitor" refers to an agent that reduces or inhibits at least one function or biological activity of a target molecule.

[0050] The term "locked nucleic acid (LNA)" refers to a substituted and conformationally restricted sugar moiety that contains a methylene bridge between the 4' and 2' furanosyl ring atoms.

[0051] Throughout the disclosure, the term "microRNA mimic compound" can be used interchangeably with the terms "promiR-25", "miR-25 agonist", "microRNA mimic", "miRNA mimic", or "miR-25 mimic", and refers to an endogenous non-coding RNA between 18 and 25 nucleobases in length, which is the product of the cleavage of pre-microRNA by the Dicer enzyme. Examples of mature microRNAs can be found in the microRNA database called miRbase ( http: / / microrna.sanger.ac.uk / )。In certain embodiments, microRNA is abbreviated as "miR". The term "first strand" may be used interchangeably with the term "antisense strand" or "guide strand"; the term "second strand" may be used interchangeably with the term "sense strand" or "passenger strand".

[0052] "Nucleobase" refers to a heterocyclic moiety capable of non-covalently pairing with another nucleobase.

[0053] "Nucleoside" refers to a nucleobase linked to a sugar moiety.

[0054] "Nucleotide" refers to such a nucleoside having a phosphate group covalently linked to the sugar moiety of the nucleoside.

[0055] As used herein, the terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to polymers of amino acid residues and their variants and synthetic analogs. Thus, these terms apply to amino acid polymers in which one or more amino acid residues are synthetic non-naturally occurring amino acids, such as chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. These terms do not exclude modifications such as glycosylation, acetylation, phosphorylation, etc. Soluble forms of the subject peptides are particularly useful. Included in this definition are, for example, peptides containing one or more amino acid analogs, including, for example, non-natural amino acids or polypeptides having substituted linkages.

[0056] The term "pharmaceutical composition" or "pharmaceutical formulation" refers to a formulation in a form such that the biological activity of the active ingredient is effective and which does not contain additional components that are unacceptably toxic to the subject to whom the composition or formulation will be administered. Such formulations are sterile. "Pharmaceutically acceptable" excipients (solvents, additives) are those that can be reasonably administered to a test mammalian subject to provide an effective dose of the active ingredient used.

[0057] "Pharmaceutically acceptable carrier" refers to a pharmaceutical solvent composed of materials that are not biologically or otherwise undesirable, i.e., the materials can be administered to a subject together with the selected active agent without causing any or substantial adverse reactions. The carrier may include excipients and other additives such as diluents, detergents, coloring agents, wetting agents or emulsifiers, pH buffering agents, preservatives, transfection agents, etc.

[0058] Similarly, "pharmacologically acceptable" salts, esters, amides, prodrugs or derivatives of the compounds provided herein are salts, esters, amides, prodrugs or derivatives that are not biologically or otherwise undesirable.

[0059] The term "phosphorothioate bond" refers to a bond between nucleosides in which one of the non-bridging oxygen atoms is replaced by a sulfur atom.

[0060] As used herein, the term "prevent" and its various grammatical forms (e.g., "prevented" or "preventing") refer to prophylactic treatment that increases a subject's resistance to developing a disease or condition, or in other words, reduces the likelihood that the subject will develop the disease or condition, as well as treatment after the disease or condition has already begun in order to completely reduce or eliminate the disease or condition or prevent it from getting worse. These terms also encompass within their scope preventing the disease or condition from occurring in a subject who is susceptible to the disease or condition but has not been diagnosed as having the disease or condition.

[0061] The terms "reduce", "inhibit", "suppress", "lower" and grammatically equivalent expressions, when used in reference to the level of a substance and / or a phenomenon in a first sample relative to a second sample, mean that the amount of the substance and / or the phenomenon in the first sample is lower by any amount that is statistically significant using any accepted statistical analysis method in the art. In one embodiment, the reduction can be determined subjectively, e.g., when a patient refers to their subjective perception of disease symptoms such as pain, fatigue, etc. In additional embodiments, the reduction can be determined objectively. In additional embodiments, the amount of the substance and / or the phenomenon in the first sample is at least 10% lower than the amount of the same substance and / or the phenomenon in the second sample. In additional embodiments, the amount of the substance and / or the phenomenon in the first sample is at least 25% lower than the amount of the same substance and / or the phenomenon in the second sample. In yet another embodiment, the amount of the substance and / or the phenomenon in the first sample is at least 50% lower than the amount of the same substance and / or the phenomenon in the second sample. In other embodiments, the amount of the substance and / or the phenomenon in the first sample is at least 75% lower than the amount of the same substance and / or the phenomenon in the second sample. In yet another embodiment, the amount of the substance and / or the phenomenon in the first sample is at least 90% lower than the amount of the same substance and / or the phenomenon in the second sample. Alternatively, the difference can be expressed as an "n-fold" difference.

[0062] As used herein, the terms “salt” and “prodrug” include any pharmaceutically acceptable salt, ester, hydrate, or any other compound which, upon administration to a recipient, is capable of providing (directly or indirectly) the miR-25 mimics of the invention or its active metabolite or residue. Suitable pharmaceutically acceptable salts include salts of pharmaceutically acceptable inorganic acids such as hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid, carbonic acid, boric acid, sulfamic acid, and hydrobromic acid, or salts of pharmaceutically acceptable organic acids such as acetic acid, propionic acid, butyric acid, tartaric acid, maleic acid, hydroxymaleic acid, fumaric acid, citric acid, lactic acid, mucic acid, gluconic acid, benzoic acid, succinic acid, oxalic acid, phenylacetic acid, methanesulfonic acid, toluenesulfonic acid, benzenesulfonic acid, salicylic acid, p-aminobenzenesulfonic acid, aspartic acid, glutamic acid, ethylenediaminetetraacetic acid, stearic acid, palmitic acid, oleic acid, lauric acid, pantothenic acid, tannic acid, ascorbic acid, and valeric acid. Basic salts include, but are not limited to, those formed with pharmaceutically acceptable cations such as sodium, potassium, lithium, calcium, magnesium, ammonium, and alkylammonium. In addition, basic nitrogen-containing groups may be quaternized with reagents such as lower alkyl halides like methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dialkyl sulfates such as dimethyl sulfate and diethyl sulfate; and others. However, it should be understood that non-pharmaceutically acceptable salts also fall within the scope of the invention since these can be used to prepare pharmaceutically acceptable salts. The preparation of salts and prodrugs can be carried out by methods known in the art. For example, metal salts can be prepared by reacting the compounds of the invention with metal hydroxides.

[0063] As used herein, the term “sample” includes any biological sample that can be extracted, untreated, treated, diluted, or concentrated from a subject. Samples can include, but are not limited to, biological fluids such as whole blood, serum, red blood cells, white blood cells, plasma, saliva, urine, feces (i.e., excreta), tears, sweat, sebum, nipple aspirate, ductal lavage fluid, tumor exudate, synovial fluid, ascites, peritoneal fluid, amniotic fluid, cerebrospinal fluid, lymph fluid, fine needle aspirate, any other body fluid, cell lysates, cell secretory products, inflammatory fluids, semen, and vaginal secretions. Samples can include tissue samples and biopsy samples, tissue homogenates, etc. Advantageous samples can include samples containing a detectable amount of any one or more of the biomarkers taught herein. Suitably, samples can be readily obtained by minimally invasive methods, allowing removal or isolation of the sample from the subject. In certain embodiments, the sample comprises blood, especially peripheral blood, or a fraction or extract thereof. Generally, the sample includes blood cells, such as mature, immature, or developing white blood cells, including lymphocytes, polymorphonuclear leukocytes, neutrophils, monocytes, reticulocytes, basophils, coelomocytes, hemocytes, eosinophils, megakaryocytes, macrophages, dendritic cells, natural killer cells, or fractions of such cells (e.g., nucleic acid or protein fractions). In a specific embodiment, the sample comprises white blood cells, including peripheral blood mononuclear cells (PBMC).

[0064] The term "first strand" may be used interchangeably with the term "antisense strand" or "guide strand"; the term "second strand" may be used interchangeably with the term "sense strand" or "passenger strand".

[0065] As used herein, "stringency" refers to temperature and ionic strength conditions, as well as the presence or absence of certain organic solvents and / or detergents during hybridization. The higher the stringency, the higher the level of complementarity required between hybridizing nucleotide sequences.

[0066] "Stringent conditions" refers to those conditions under which nucleic acid hybridization occurs only with nucleic acids having a high frequency of complementary bases.

[0067] The terms "subject", "patient", "host", or "individual" are used interchangeably herein and refer to any subject, particularly a vertebrate subject, and even more particularly a mammalian subject, for which treatment or prophylaxis is desired. Suitable vertebrates within the scope of the present invention include, but are not limited to, any member of the subphylum Chordata, including primates (e.g., humans, monkeys, and apes, and including monkey species of the genus Macaca (e.g., Macaca fascicularis such as the cynomolgus macaque and / or Macaca mulatta) and baboons (Papio ursinus), as well as marmosets (species from the genus Callithrix), squirrel monkeys (species from the genus Saimiri), and tamarins (species from the genus Saguinus), as well as ape species such as chimpanzees (Pan troglodytes), rodents (e.g., mice, rats, guinea pigs), lagomorphs (e.g., rabbits, hares), bovines (e.g., cows), ovines (e.g., sheep), caprines (e.g., goats), porcines (e.g., pigs), equines (e.g., horses), canines (e.g., dogs), felines (e.g., cats), avians (e.g., chickens, turkeys, ducks, geese, companion birds such as canaries, budgerigars, etc.), marine mammals (e.g., dolphins, whales), reptiles (snakes, frogs, lizards, etc.), and fish. In some embodiments, the subject is a mammalian. In other embodiments, the subject is a human.

[0068] As used herein, terms such as "treatment" refer to clinical interventions designed to alter the natural course in a treated individual or cell in a clinical pathological process. Desired effects of treatment include reducing the rate of disease progression, ameliorating or alleviating the disease state, and relieving or improving prognosis. For example, an individual is successfully "treated" if one or more symptoms associated with a fibrotic disorder are reduced or eliminated, including but not limited to reducing fibrosis proliferation (or disruption), reducing symptoms caused by the disease, increasing the quality of life of those suffering from the disease, reducing the dosage of other medications required to treat the disease, and / or prolonging the survival of the individual.

[0069] The term "2'-O-fluoro" refers to a sugar having a fluorine modification at the 2' position.

[0070] The term "2'-O-methyl" refers to a sugar having an O-methyl modification at the 2' position.

[0071] Unless otherwise specifically stated, each embodiment described herein applies, with necessary modifications, to every and all embodiments.

[0072] 2. Compositions

[0073] The present invention is based in part on the discovery that phosphorothioate-linked and 2'-O-methyl-modified miR-25 mimics significantly increase the protective anti-fibrotic effect of miR-25 in activated human HSCs. Specifically, compared to commercially available mimics, the downregulation of the target genes FKBP14 and ADAM-17 is significantly increased, resulting in subsequent inhibition of TGF-βRI and TGFβ-induced collagen type 1a1 (COL1A1) expression. In addition, the mRNA expression of type I fibrillar collagens (COL1A1, COL1A2) and type III fibrillar collagen (COL3A1) is significantly downregulated. Accordingly, the present invention provides novel miR-25 mimics, which can be used as novel anti-fibrotic therapeutic agents for controlling the progression of fibrosis due to their higher efficacy in inhibiting TGF-β-induced fibrillar collagen expression.

[0074] 2.1 miR-25 Mimics

[0075] MicroRNA (miRNA) is a class of non-coding RNAs, belonging to a group of regulatory molecules found in plants and animals, which control gene expression by binding to complementary sites on target messenger RNA (mRNA) transcripts. miRNA is generated from larger RNA precursors (called pri-miRNA), which are processed in the nucleus into pre-miRNA of approximately 70 nucleotides, which fold into an imperfect stem-loop structure. Pre-miRNA undergoes additional processing steps in the cytoplasm, where the mature miRNA of 18 - 25 nucleotides in length is cleaved from one side of the pre-miRNA hairpin by the RNase III enzyme Dicer.

[0076] It has been shown that miRNA regulates gene expression in two ways. First, miRNA that binds to the mRNA sequence encoding a protein that is fully complementary to the miRNA can induce the RNA-mediated interference (RNAi) pathway. The messenger RNA target is cleaved by ribonucleases in the RISC complex. In the second mechanism, miRNA that binds to imperfectly complementary sites on messenger RNA transcripts directs gene regulation at the post-transcriptional level, but does not cleave their mRNA targets. miRNAs identified in plants and animals use this mechanism to exert translational control over their gene targets.

[0077] As used herein, "microRNA" (miRNA or miR) includes mature single-stranded miRNA precursors miRNA (pre-miR) and their variants, which can be naturally occurring. In some cases, the term "miRNA" also includes primary miRNA transcripts and duplex miRNAs. Unless otherwise specified, when used herein, the name of a specific miRNA refers to the mature miRNA of the pre-miRNA. For example, miR-25 refers to the mature miRNA sequence derived from pre-miR-25.

[0078] The native mature pri-miR-25 sequence (hsa-miR-25-3p miRBase accession number: MIMAT0000081) is shown below.

[0079] GGCCAGUGUUGAGAGGCGGAGACUUGGGCAAUUGCUGGACGC

[0080] UGCCCUGGGCAUUGCACUUGUCUCGGUCUGACAGUGCCGGCC

[0081] [SEQ ID NO:1].

[0082] The miR-25 mimics of the present invention comprise a first strand and a second strand, wherein the first strand comprises, consists of, or consists essentially of the mature miR-25 sequence (i.e., CAUUGCACUUGUCUCGGUCUGA [SEQ ID NO:3]), and the second strand comprises a sequence that is substantially complementary to the first strand and has at least one modified nucleotide.

[0083] In some embodiments, the nucleotide sequence shown in SEQ ID NO:3 or a fragment, variant, or derivative thereof has two nucleotide residues overhanging at the 3' end and no modification at the second nucleotide position at both the 5' end and the 3' end, and the second strand comprises a sequence that is substantially complementary to the first strand, which comprises a modification at the first residue at the 3' end and a modified linker between each of the last seven nucleotides at the 5' end. The term "modified nucleotide" refers to a nucleotide in which the nucleobase and / or sugar moiety is modified relative to an unmodified nucleotide.

[0084] In some embodiments, the first strand of the microRNA mimic compound comprises about 24 nucleotides, which includes the sequence of mature miR-25; and the second strand comprises about 24 nucleotides, which includes a sequence that is partially, substantially, or completely complementary to the first strand. In various embodiments, the first strand may comprise about 22, 23, 24, 25, or 26 nucleotides, and the second strand may comprise about 22, 23, 24, 25, or 26 nucleotides.

[0085] The nucleotides forming the first strand of the microRNA mimic compound may include ribonucleotides, deoxyribonucleotides, modified nucleotides, and combinations thereof. In certain embodiments, the first and second strands of the microRNA mimic comprise ribonucleotides and / or modified ribonucleotides. The term "modified nucleotide" refers to a nucleotide in which the nucleobase and / or sugar moiety is modified relative to an unmodified nucleotide.

[0086] In certain embodiments, the microRNA mimic compound has a first strand or antisense strand whose sequence is identical in whole or in part to the sequence of mature miR-25, and a second strand or sense strand whose sequence is about 70% to about 100% complementary to the sequence of the first strand. In some embodiments, the first strand of the miRNA mimic compound is at least about 75, 80, 85, 90, 95 or 100% identical to the entire sequence of the mature, naturally-occurring miR-25 sequence, including all integers therebetween. In certain embodiments, the first strand is about or at least about 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identical to the sequence of a mature, naturally-occurring miRNA, such as the human, murine or rat miR-25 sequence. Alternatively, the first strand may comprise 20, 21, 22 or 23 nucleotide positions that are identical to a mature, naturally-occurring miRNA as compared to sequence alignment algorithms and methods known in the art.

[0087] It should be understood that the sequence of the first strand is considered to be identical to the sequence of mature miR-25 even if the first strand includes modified nucleotides rather than naturally-occurring nucleotides. For example, if the mature, naturally-occurring miRNA sequence contains a cytidine nucleotide at a particular position, the first strand of the mimic compound may contain a modified cytidine nucleotide, such as 2'-fluoro-cytidine, at the corresponding position, or if the mature, naturally-occurring miRNA sequence contains a uridine nucleotide at a particular position, the miRNA region of the first strand of the mimic compound may contain a modified uridine nucleotide, such as 2'-fluoro-uridine, 2'-O-methyl-uridine, 5'-fluorouracil or 4-thiouridine, at the corresponding position. Thus, the sequence of the first strand is considered to be identical to the sequence of the mature, naturally-occurring miRNA sequence as long as the modified nucleotide has the same base-pairing ability as the nucleotide present in the mature, naturally-occurring miRNA sequence. In some embodiments, the first strand may have a 5'-terminal monophosphate. In some other embodiments, the first strand is devoid of a 5'-terminal monophosphate.

[0088] In some embodiments, the second strand of the microRNA mimic compound is partially complementary to the sequence of the first strand. For example, the sequence of the second strand is at least about 70, 75, 80, 85, 90, 95 or 99% (including all integers therebetween) complementary to the sequence of the first strand. In some other embodiments, the sequence of the second strand may be fully complementary to the first strand. In certain embodiments, about 19, 20, 21, 22 or 23 nucleotides of the complementary region of the second strand may be complementary to the first strand.

[0089] In some embodiments, the second strand contains about 1, 2, 3, 4, 5, or 6 mismatches relative to the first strand. That is, up to 1, 2, 3, 4, 5, or 6 nucleotides between the first and second strands may not be complementary. In one embodiment, the mismatches are non - contiguous and are distributed throughout the second strand. In additional embodiments, the mismatches are contiguous and can create a bulge. In some embodiments, the second strand contains one, two, or three mismatches relative to the first strand.

[0090] In some embodiments, the first and / or second strand of the mimic compound can include an overhang at the 5' or 3' end of the strand. In certain embodiments, the first strand contains a 3' overhang, i.e., a single - stranded region that extends beyond the duplex region relative to the second strand. The 3' overhang of the first strand can range from about one nucleotide to about four nucleotides. In certain embodiments, the 3' overhang of the first strand can contain 1 or 2 nucleotides. In some embodiments, the nucleotides containing the 3' overhang in the first strand are linked by phosphorothioate bonds. The nucleotides containing the 3' overhang in the first strand can include ribonucleotides, deoxyribonucleotides, modified nucleotides, or combinations thereof. In certain embodiments, the 3' overhang of the first strand contains two uridine nucleotides linked by phosphorothioate bonds. In some embodiments, the first strand may not contain an overhang.

[0091] In certain embodiments, the second strand contains a 3' overhang, i.e., a single - stranded region that extends beyond the duplex region relative to the first strand. The 3' overhang of the second strand can range from about one nucleotide to about four nucleotides. In certain embodiments, the 3' overhang of the second strand can contain 1 or 2 nucleotides. In some embodiments, the nucleotides containing the 3' overhang in the second strand are linked by phosphorothioate bonds. The nucleotides containing the 3' overhang in the second strand can include ribonucleotides, deoxyribonucleotides, modified nucleotides, or combinations thereof. In certain embodiments, the 3' overhang of the second strand contains two 2'-O - methyl - uridine nucleotides linked by phosphorothioate bonds. In some embodiments, the second strand may not contain an overhang.

[0092] In some embodiments, the nucleotides in the second / sense strand of the miR - 25 mimic of the present invention are linked by phosphodiester bonds, except for the last five nucleotides at the 3' end which are linked to each other by phosphorothioate bonds. In some embodiments, the nucleotides in the first / antisense strand of the miR - 25 mimic of the present invention are linked by phosphodiester bonds, except for the last two or three nucleotides at the 3' end which are linked to each other by phosphorothioate bonds.

[0093] In multiple embodiments, the miR-25 mimics of the present invention comprise modified nucleotides. For example, in some embodiments, the first strand of the mimic comprises one or more 2'-O-methyl modified nucleotides. In some of the same embodiments and some other embodiments, the first strand comprises one or more 2'-fluoronucleotides. In some preferred embodiments, the first strand may not include any modified nucleotides.

[0094] In some embodiments, the second strand comprises one or more 2'-O-methyl modified nucleotides. In some preferred embodiments of this type, the last seven nucleotides at the 3' end are 2'-O-methyl modified nucleotides.

[0095] In some embodiments, the first strand does not contain modified nucleotides at the second positions at both the 5' end and the 3' end. In this regard, the first strand may contain modified nucleotides at the second position starting from the 5' end. Alternatively, the first strand may contain modified nucleotides at the second position starting from the 3' end.

[0096] In various embodiments, the miR-25 mimics according to the present invention comprise the first and second strands listed in Tables 1 and 2 below. The definitions of the modifications are shown in Table 3. These miR-25 mimic compounds can be used to regulate the expression of extracellular matrix genes in cells and treat related diseases, such as fibrosis.

[0097] Table 1

[0098] The First Group of miR-25 Mimic Strand Sequences

[0099]

[0100] Table 2

[0101] The Second Group of miR-25 Mimic Strand Sequences

[0102]

[0103] Table 3

[0104] Abbreviations

[0105] Nucleotide Units or Modifications Abbreviations Ribose A rA Ribose G rG Ribose C rC Ribose U rU 2’-O-Methyl A mA 2’-O-Methyl G mG 2’-O-Methyl C mC 2’-O-Methyl U mU 2’-Fluoro A fA 2’-Fluoro G fG 2’-Fluoro C fC 2’-Fluoro U fU LNA Nucleotide Modification LT Phosphorothioate Bond *

[0106] In certain embodiments, the miR-25 mimics comprise a first strand containing SEQ ID NO:2 and a second strand containing SEQ ID NO:5. In other embodiments, the miR-25 mimics comprise a first strand containing SEQ ID NO:14 and a second strand containing SEQ ID NO:5. In yet other embodiments, the miR-25 mimics comprise a first strand containing SEQ ID NO:16 and a second strand containing SEQ ID NO:5.

[0107] In some other embodiments, the miR-25 mimics comprise a first strand containing SEQ ID NO:4 and a second strand containing SEQ ID NO:5. In yet other embodiments, the miR-25 mimics comprise a first strand containing SEQ ID NO:11 and a second strand containing SEQ ID NO:5. In yet other embodiments, the miR-25 mimics comprise a first strand containing SEQ ID NO:12 and a second strand containing SEQ ID NO:5. In yet other embodiments, the miR-25 mimics comprise a first strand containing SEQ ID NO:15 and a second strand containing SEQ ID NO:5. In yet other embodiments, the miR-25 mimics comprise a first strand containing SEQ ID NO:17 and a second strand containing SEQ ID NO:5.

[0108] Modifications of the miR-25 mimic compounds useful in the present disclosure may include nucleotides with base modifications or substitutions. The natural or unmodified bases in RNA are the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U) (DNA has thymine (T)). In contrast, modified nucleobases also refer to heterocyclic base moieties, including other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azauracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo (including 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines), 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azadenine, 7-deazaguanine and 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0109] In other embodiments, the modification includes one or more backbone alterations, such as pyrimidines including a 2'-fluoro ribose structure, C5-halopyrimidines, phosphorothioate groups, or 2'-O-methyl ribose structures. In a preferred embodiment, the modification includes a 2'-fluoro ribose structure modification. In an even more preferred embodiment, the modification includes a 2'-O-methyl ribose structure modification.

[0110] In some embodiments, the modification can include nucleotides having modified sugar moieties. Representative modified sugars include carbocyclic or acyclic sugars, sugars having substituents at one or more of their 2', 3', or 4' positions, and sugars having substituents that replace one or more hydrogen atoms of the substituted sugar. In certain embodiments, the sugar is modified by having a substituent at the 2' position. In additional embodiments, the sugar is modified by having a substituent at the 3' position. In other embodiments, the sugar is modified by having a substituent at the 4' position. It is also contemplated that the sugar can have modifications at more than one of these positions, or that the RNA molecule can have one or more nucleotides having a sugar modification at one position and one or more nucleotides having a sugar modification at a different position.

[0111] Sugar modifications contemplated in miRNA mimetic compounds include, but are not limited to, substituents selected from the following: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where the alkyl, alkenyl, and alkynyl can be substituted or unsubstituted C1-C 10 alkyl or C2-C 10 alkenyl and alkynyl.

[0112] In some embodiments, the miRNA mimetic compound has a sugar substituent selected from the following: C1-C 10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, CI, Br, CN, OCN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, or similar substituents. In one embodiment, the modification includes 2'-methoxyethoxy (2'-O-CH2CH2OCH3, also referred to as 2'-O-(2-methoxyethyl) or 2'-MOE), i.e., an alkoxyalkoxy. Additional modifications include 2'-dimethylaminooxyethoxy, i.e., the O(CH2)2ON(CH3)2 group (also referred to as 2'-DMAOE), and 2'-dimethylaminoethoxyethoxy (also referred to in the art as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH3)2.

[0113] The sugar substituent at the 2'-position (2'-) can be in the arabino (up) or ribo (down) configuration. One 2'-arabino modification is 2'-F. Similar modifications can also be made at other positions on the sugar moiety, particularly at the 3'-terminal nucleoside or at the 3'-position of the sugar in a 2'-5'-linked oligonucleotide and the 5'-position of the 5'-terminal nucleotide.

[0114] In certain embodiments, the sugar modification is 2'-O-alkyl (e.g., 2'-O-methyl, 2'-O-methoxyethyl), 2'-halo (e.g., 2'-fluoro, 2'-chloro, 2'-bromo), and 4'-thio modifications. For example, in some embodiments, the first strand of the miR-25 mimetic compound comprises one or more 2'-fluoronucleotides. In another embodiment, the first strand of the mimetic compound does not have modified nucleotides. In yet another additional embodiment, the second strand of the miR-25 mimetic compound comprises one or more 2'-O-methyl modified nucleotides.

[0115] The first and second strands of the microRNA mimetic compounds of the invention can also include backbone modifications, such as one or more phosphorothioate, morpholino, or phosphonocarboxylate linkages (see, e.g., U.S. Patent Nos. 6,693,187 and 7,067,641, which are incorporated herein by reference in their entirety). For example, in some embodiments, the nucleotides comprising a 3'-overhang in the first and / or second strand are linked by phosphorothioate bonds. A phosphorothioate bond replaces a non-bridging oxygen in the oligonucleotide phosphate backbone with a sulfur atom. This modification renders the internucleotide bond resistant to nuclease degradation. In some preferred embodiments, the first two nucleotides at the 5'-end of the second strand are linked by phosphorothioate bonds.

[0116] In some embodiments, the microRNA mimetic compounds are conjugated to a carrier molecule such as a steroid (cholesterol), vitamin, fatty acid, carbohydrate or glycoside, peptide or other small molecule ligand to facilitate in vivo delivery and stability. Preferably, the carrier molecule is linked to the second strand of the microRNA mimetic compound at its 3' or 5' end via a linker or spacer group. In various embodiments, the carrier molecule is cholesterol, a cholesterol derivative, a bile acid or a bile acid derivative. For example, the use of carrier molecules is also disclosed in U.S. Patent No. 7,202,227, which is incorporated herein by reference in its entirety. In certain embodiments, the carrier molecule is cholesterol and is linked to the 3' or 5' end of the second strand via at least a six-carbon linker. In some embodiments, the linker is a cleavable linker. In various embodiments, the linker comprises a substantially linear hydrocarbon moiety. The hydrocarbon moiety may contain from about 3 to about 15 carbon atoms. In certain embodiments, the hydrocarbon linker / spacer group comprises an optionally substituted C2-C15 saturated or unsaturated hydrocarbon chain (e.g., an alkylene or alkenylene). The various linker / spacer groups described in U.S. Patent No. 9,012,225 can be used in the present invention, which is incorporated herein by reference in its entirety.

[0117] 3. Pharmaceutical Compositions

[0118] The present disclosure also provides pharmaceutical compositions comprising a therapeutically effective amount of one or more miR-25 mimetic compounds described above and / or elsewhere herein, and a pharmaceutically acceptable carrier or excipient. According to the present invention, the first strand of the mimetic compound generally comprises the mature miR-25-3p sequence, and the second strand is substantially complementary to the first strand.

[0119] The present invention also includes embodiments in which an additional therapeutic agent can be co-administered with the miR-25 mimetic compound. In one embodiment, the additional therapeutic agent is a second anti-fibrotic agent. The additional therapeutic agent can be administered simultaneously but in separate formulations or sequentially. In other embodiments, the additional therapeutic agent can be administered at different times before or after the administration of the miR-25 mimetic compound. When considering clinical applications, the pharmaceutical composition will be formulated in a form suitable for the intended application. Generally, this will require preparing a composition that is substantially free of pyrogens and other impurities that may be harmful to humans or animals.

[0120] Colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads and lipid-based systems, including water-in-oil emulsions, micelles, mixed micelles, liposomes and exosomes, can be used as delivery carriers for the miR-25 mimetic compounds. In some embodiments, the miR-25 mimetic of the present invention can be formulated into liposome particles, which can then be aerosolized for inhalation delivery.

[0121] Commercially available lipid emulsions suitable for delivering the nucleic acids of the present invention include II, III, Nutrilipid, and other similar lipid emulsions. Preferred colloidal systems for in vivo delivery carriers are liposomes (i.e., artificial membrane vesicles). The preparation and use of such systems are known in the art. Exemplary formulations are also disclosed in U.S. Patent Nos. 5,981,505; 6,217,900; 6,383,512; 5,783,565; 7,202,227; 6,379,965; 6,127,170; 5,837,533; and 6,747,014; and International PCT Patent Publication No. WO03 / 093449, the entire contents of which are incorporated herein by reference.

[0122] In certain embodiments, the liposomes for delivery are zwitterionic liposomes, such as (Marina Biotech, Inc.), which is described in detail in U.S. Patent Publication No. 2011 / 0076322. The surface charge on them is completely reversible, which makes them particularly suitable for the delivery of nucleic acids. They can be delivered by injection, remain stable, do not aggregate, and cross cell membranes to deliver nucleic acids.

[0123] It is generally desirable to use appropriate salts and buffers to stabilize the delivery carrier and allow uptake by target cells. The aqueous compositions of the present invention contain an effective amount of a delivery vehicle that contains miR-25 mimics (e.g., liposomes or other complexes) dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. The phrase "pharmaceutically acceptable" or "pharmacologically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal or a human. As used herein, "pharmaceutically acceptable carrier" includes solvents, buffers, solutions, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, and absorption delaying agents, etc., which are acceptable for formulating drugs, e.g., drugs suitable for administration to humans. The use of such media and agents for pharmaceutical active substances is well known in the art. Unless any conventional medium or active agent is incompatible with the active ingredient of the present invention, it is contemplated to be used in the therapeutic compositions. Supplementary active ingredients can also be incorporated into the compositions, provided that they do not inactivate the polynucleotides of the compositions.

[0124] In one embodiment, the pharmaceutical composition of the present invention is formulated for pulmonary, nasal, intranasal or ocular delivery and may be in the form of a powder, aqueous solution, aqueous aerosol, nasal drops, aerosol and / or eye drops. Solid formulations for nasal / intranasal administration may contain excipients such as lactose or dextran. Liquid formulations for nasal / intranasal administration may be aqueous or oily solutions for aerosol, nasal drops or metered spray forms. Formulations for pulmonary / nasal / intranasal administration may also include surfactants such as glycocholic acid, taurocholic acid, ethocholic acid, deoxycholic acid, chenodeoxycholic acid, dehydrocholic acid, glycochenodeoxycholic acid, salts of these acids and cyclodextrin.

[0125] In some embodiments, formulations for pulmonary / nasal / intranasal administration by inhalation include, but are not limited to, dry powder formulations, liposomal formulations, nano-suspensions or micro-suspensions.

[0126] In some embodiments, a drug composition for pulmonary / nasal / intranasal delivery is administered using an inhalation device. The term "inhalation device" refers to any device capable of administering the miR-25 mimetic composition to the respiratory tract of a subject. Inhalation devices include devices such as metered dose inhalers (MDIs), dry powder inhalers (DPIs), jet nebulizers, ultrasonic nebulizers, thermal evaporators, soft mist inhalers, hot aerosol inhalers, electrohydrodynamic-based solution spray inhalers. Inhalation devices also include high-efficiency nebulizers. In some embodiments, the nebulizer is a jet nebulizer, an ultrasonic nebulizer, a pulsating membrane nebulizer, a nebulizer comprising a vibrating mesh or plate with multiple small holes, a nebulizer comprising a vibration generator and an aqueous chamber, or a nebulizer that uses controlled device features to assist the inhalation flow of an aqueous solution for atomization to the lungs of a subject. Nebulizers, metered dose inhalers and soft mist inhalers deliver drugs by forming an aerosol comprising droplet sizes that can be easily inhaled.

[0127] In some embodiments, the composition administered with a high-efficiency nebulizer comprises one or more miR-25 mimetics and pharmaceutically acceptable excipients or carriers such as purified water, mannitol, surfactants and salts such as sodium chloride and sodium EDTA, etc.

[0128] The active compositions of the present invention may include conventional pharmaceutical formulations. Administration of these compositions according to the present invention can be via any common route, provided that the target tissue is reached via that route. Such routes include oral, nasal (e.g., inhalation), ocular, or buccal. Alternatively, administration can be by intravenous, intradermal, subcutaneous, intraocular, or intramuscular injection, or by direct injection into the lung, heart, liver, pancreas, kidney, tumor, or skin tissue. A pharmaceutical composition containing an miRNA mimic can also be administered via a catheter system or a system that isolates the coronary circulation for delivering a therapeutic agent to the heart. Various catheter systems for delivering a therapeutic agent to the heart and coronary vasculature are known in the art.

[0129] Some non-limiting examples of catheter-based delivery methods or coronary isolation methods suitable for the present invention are disclosed in U.S. Patent Nos. 6,416,510; 6,716,196; and 6,953,466, International Patent Publication Nos. WO2005 / 082440 and WO2006 / 089340, and U.S. Patent Publication Nos. 2007 / 0203445; 2006 / 0148742 and 2007 / 0060907, the entire contents of which are incorporated herein by reference. Such compositions are generally administered as pharmaceutically acceptable compositions as described herein.

[0130] In other embodiments of the present invention, a composition containing an miR-25 mimic as described herein can be formulated as a coating for a medical device such as a stent, balloon, or catheter. Particularly useful in a method of treating cardiac fibrosis in a subject, the miR-25 mimic can be used to coat a metal stent to produce a drug-eluting stent. A drug-eluting stent is a stent that keeps a narrowed or diseased artery open and releases a compound to prevent cell proliferation and / or inflammation. The mimic compound can be applied to a metal stent embedded in a thin polymer for release of an agonist or inhibitor over time. Methods for device-based delivery and methods for coating devices are well known in the art, such as drug-eluting stents and other implantable devices. See, for example, U.S. Patent Nos. 7,294,329; 7,273,493; 7,247,313; 7,236,821; 7,232,573; 7,156,869; 7,144,422; 7,105,018; 7,087,263; 7,083,642; 7,055,237; 7,041,127; 6,716,242; and 6,589,286, and International PCT Publication No. WO2004 / 004602, the entire contents of which are incorporated herein by reference. Accordingly, the present invention includes a medical device coated with an miR-25 mimic, such as a balloon, catheter, or stent.

[0131] A sterile injectable solution can be prepared by incorporating the appropriate amount of the active compound with any other ingredients as desired (such as those enumerated above) into a solvent, followed by filtration sterilization. Generally, dispersions are prepared by incorporating various sterilized active ingredients into a sterile vehicle that contains a basic dispersion medium and the other ingredients as desired (such as those enumerated above).

[0132] The compositions of the present invention can generally be formulated in neutral or salt form. Pharmaceutically acceptable salts include, for example, acid addition salts (formed with the free amino groups of the protein) derived from inorganic acids (such as hydrochloric acid or phosphoric acid) or from organic acids (such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed with the free carboxyl groups of the protein can also be derived from inorganic bases (such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or ferric hydroxide) or from organic bases (such as isopropylamine, trimethylamine, histidine, procaine, etc.).

[0133] Upon formulation, the solution is preferably administered in a manner compatible with the dosage formulation and in a therapeutically effective amount. The formulations can be readily administered in various dosage forms, such as injectable solutions, drug-release capsules, drug-eluting stents or other coated vascular devices, etc. For parenteral administration in an aqueous solution, for example, the solution is generally suitably buffered and the liquid diluent is first made isotonic, for example, with sufficient saline or glucose. Such aqueous solutions can be used for, for example, intravenous, intramuscular, subcutaneous, intradermal, intraocular and intraperitoneal administration.

[0134] The pharmaceutical compositions of the present invention can be readily formulated into dosage forms suitable for administration using pharmaceutically acceptable carriers known in the art. Such carriers enable the compounds of the present invention to be formulated into dosage forms such as tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions, etc., for administration to a subject to be treated. For example, a pharmaceutical composition formulated for oral ingestion will contain a suitable carrier, such as selected from sugars, starches, cellulose and its derivatives, malt, gelatin, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffer solutions, emulsifiers, isotonic saline and pyrogen-free water.

[0135] The pharmaceutical compositions suitable for the present invention include compositions containing an effective amount of an active ingredient to achieve its intended purpose. The dosage of the active agent administered to a patient should be sufficient to elicit a beneficial response over time in the patient, such as the alleviation of symptoms associated with the condition. The amount of the therapeutic / preventive agent to be administered may depend on the subject to be treated, including its age, sex, weight, and general health. In this regard, the precise dosage of the therapeutic / preventive agent will depend on the judgment of the physician. When determining the effective amount of the active agent to be administered in the treatment or prevention of a condition, the physician can evaluate the tissue levels of the polypeptide antigen and the progression of the disease or condition. In any case, those skilled in the art can readily determine the appropriate dosage of the therapeutic and / or preventive agents of the present invention.

[0136] Pharmaceutical preparations for parenteral administration include aqueous solutions of the active compound in water-soluble form. Additionally, suspensions of the active compound can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or carriers include fatty oils such as sesame oil or synthetic fatty acid esters such as ethyl oleate or triglycerides or liposomes. Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or active agents that increase the solubility of the compound to allow the preparation of highly concentrated solutions.

[0137] Pharmaceutical preparations for oral use can be obtained by mixing the active compound with a solid excipient, optionally grinding the resulting mixture, and processing the granule mixture with the addition of suitable auxiliaries, if necessary, to obtain tablets or dragee cores. Suitable excipients are in particular fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations, such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If necessary, disintegrating agents can be added, such as cross-linked polyvinylpyrrolidone, agar, or alginic acid or its salts, such as sodium alginate. Such compositions can be prepared by any pharmaceutical method, but all methods include the step of combining one or more of the therapeutic agents described above with a carrier that constitutes one or more essential ingredients. Generally, the pharmaceutical compositions of the present invention can be prepared in a manner known per se, for example, by conventional mixing, dissolving, granulating, sugar-coating, grinding, emulsifying, encapsulating, entrapping, or lyophilization methods.

[0138] The dosage form of the therapeutic agent of the present invention may also include an injection or an implant of a controlled release device specifically designed for this purpose or other forms of implants modified to act additionally in this manner. The controlled release of the active agent of the present invention can be achieved by coating with a hydrophobic polymer, which includes acrylic resins, waxes, higher fatty alcohols, polylactic acid, polyglycolic acid, and certain cellulose derivatives such as hydroxypropyl methyl cellulose. In addition, controlled release can be achieved by using other polymer matrices, liposomes, and / or microspheres.

[0139] The therapeutic agent of the present invention can be provided as a salt with a pharmaceutically compatible counterion. Pharmaceutically compatible salts can be formed with many acids, including but not limited to hydrochloric acid, sulfuric acid, acetic acid, lactic acid, tartaric acid, malic acid, succinic acid, etc. The salts tend to be more soluble in aqueous or other protic solvents in the corresponding free base form.

[0140] A sterile injectable solution can be prepared by incorporating the appropriate amount of the active compound, along with any other desired ingredients (such as those listed above), into a solvent, followed by filtration sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains a basic dispersion medium and the other desired ingredients, for example, as listed above.

[0141] The compositions of the present invention are suitable pharmaceutical compositions. Pharmaceutical compositions generally contain one or more "pharmaceutically acceptable carriers". These carriers include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition. Suitable carriers are typically large, slowly metabolized macromolecules, such as proteins, polysaccharides, polylactic acid, polyglycolic acid, polymeric amino acids, amino acid copolymers, and lipid aggregates (e.g., oil droplets or liposomes). Such carriers are known to those of ordinary skill in the art. Diluents such as water, saline, glycerol, etc. may also be present in the composition. Additionally, auxiliary substances such as wetting agents or emulsifiers, pH buffering substances, etc. may be present. A comprehensive discussion of pharmaceutically acceptable components can be found in Gennaro (2000) Remington: The Science and Practice of Pharmacy. 20th Edition, ISBN: 0683306472.

[0142] The compositions of the present disclosure can generally be formulated in neutral or salt form. Pharmaceutically acceptable salts include, for example, acid addition salts (formed with the free amino groups of proteins), which are derived from inorganic acids (e.g., hydrochloric acid or phosphoric acid) or from organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed with the free carboxyl groups of proteins can also be derived from inorganic bases (e.g., sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide) or from organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine, etc.).

[0143] Upon formulation, the solution is preferably administered in a manner compatible with the dosage formulation and in a therapeutically effective amount. The formulations can be readily administered in various dosage forms, such as injectable solutions, topical solutions, drug-eluting devices, or other coated vascular devices, etc. In a specific embodiment, the miR-25 mimetic compound is formulated for administration by intravenous injection, intramuscular injection, subcutaneous injection, intranasal spray / inhalation, iontophoresis, subconjunctival injection, subtenon injection, intravitreal injection, intracameral or topical injection.

[0144] Colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, liposomes, and exosomes, can be used as delivery carriers for the miR-25 mimetic compound. In some embodiments, the miR-25 mimetic of the present disclosure can be formulated into liposome particles.

[0145] In some embodiments, the pharmaceutical compositions of the present disclosure comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, or more miR-25 mimetics of the present disclosure. In some embodiments, the pharmaceutical composition comprises one or more miR-25 mimetics of the present disclosure and one or more other microRNAs or microRNA mimetics, including but not limited to miR-25 mimetics other than those disclosed herein.

[0146] 4. Dosage

[0147] The present invention generally relates to therapeutic and prophylactic compositions. The compositions will comprise an effective amount of the compositions defined herein such that a certain amount of the miR-25 mimetic can be produced in vivo to produce a therapeutic effect in the individual to whom it is administered. The exact amount required will vary depending on the subject being treated; the age and general condition of the subject to be treated; the ability of the subject's immune system to synthesize antibodies; the degree of protection desired; the severity of the condition being treated; and other factors such as the mode of its administration. A person skilled in the art can readily determine the appropriate effective amount. Thus, the effective amount will fall within a relatively wide range that can be determined by routine experimentation.

[0148] The dosage and interval can be adjusted individually to provide a plasma level of the active compound that is sufficient to maintain the target antigen-reducing effect or the effect of improving the disease or condition. The patient dosage range for systemic administration is generally about 1 μg - 500 μg, 0.5 mg - 200 mg, and is usually about 20 μg - 500 μg.

[0149] In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a miR-25 mimic compound and a pharmaceutically acceptable carrier, wherein the pharmaceutically acceptable carrier is selected from water for injection (WFI), 0.9% (w / v) sodium chloride, 5 mM phosphate buffer, 10 mM phosphate buffer, 25 mM phosphate buffer, 50 mM phosphate buffer, 85 mM phosphate buffer, and 100 mM phosphate buffer.

[0150] In some embodiments, the pharmaceutical composition comprises 0.2 mg / mL - 200 mg / mL of the miR-25 mimic. In some embodiments, the pharmaceutical composition comprises 0.2 mg / mL - 10 mg / mL, 10 mg / mL - 50 mg / mL, 50 mg / mL - 90 mg / mL, or 90 mg / mL - 120 mg / mL of the miR-25 mimic. In some embodiments, the pharmaceutical composition comprises 0.2 mg / mL - 1 mg / mL, 1 mg / mL - 5 mg / mL, 5 mg / mL - 10 mg / mL, 10 mg / mL - 20 mg / mL, 20 mg / mL - 30 mg / mL, 30 mg / mL - 40 mg / mL, 40 mg / mL - 50 mg / mL, 50 mg / mL - 60 mg / mL, 60 mg / mL - 70 mg / mL, 70 mg / mL - 90 mg / mL, or 90 mg / mL - 120 mg / mL of the miR-25 mimic. In some embodiments, the pharmaceutical composition comprises at least about 0.1 mg / ml, at least about 0.2 mg / ml, at least about 0.3 mg / mL, at least about 0.5 mg / mL, at least about 1 mg / mL, at least about 2 mg / mL, at least about 3 mg / mL, at least about 4 mg / mL, at least about 5 mg / mL, at least about 7 mg / mL, at least about 10 mg / mL, at least about 20 mg / mL, at least about 30 mg / mL, at least about 40 mg / mL, at least about 50 mg / mL, at least about 60 mg / mL, at least about 70 mg / mL, at least about 80 mg / mL, at least about 90 mg / mL, or at least about 100 mg / mL of the miR-25 mimic.

[0151] In some embodiments, the pharmaceutical composition comprises about 100 mg / mL, about 70 mg / mL, about 35 mg / mL, about 7 mg / mL, about 3.5 mg / mL, about 0.7 mg / mL, or about 0.35 mg / mL of the miR-25 mimic. In some embodiments, the pharmaceutical composition comprises about 70 mg / mL of the miR-25 mimic. In some embodiments, the pharmaceutical composition comprises about 35 mg / mL of the miR-25 mimic.

[0152] In some embodiments, the pH of the pharmaceutical composition is from 4 to 9. In some embodiments, the pH of the pharmaceutical composition is about 4, about 4.5, about 5, about 5.5, about 6, about 6.5, about 7, about 7.5, about 8, about 8.5, or about 9.

[0153] Alternatively, the active agent can be administered in a local rather than a systemic manner, for example, by direct injection of the compound into the tissue, typically in the form of a depot or sustained release formulation. In addition, the active agent can be administered in a targeted drug delivery system, such as in liposomes coated with a tissue-specific antibody. The liposomes will be targeted to the tissue and selectively taken up by the tissue.

[0154] For any compound used in the methods of the present invention, an effective dose can be initially estimated by cell culture assays. For example, a dose can be formulated in an animal model to achieve a circulating concentration range that includes the IC50 determined in cell culture (e.g., the concentration of the test active agent that achieves half-maximal reduction of the target antigen). This information can be used to more accurately determine the useful dose in mammals.

[0155] The toxicity and therapeutic efficacy of the compounds of the present invention can be determined in cell cultures or experimental animals by standard pharmacological procedures, such as those used to determine the LD50 (the dose that kills 50% of the population) and the ED50 (the dose that is therapeutically effective in 50% of the population). The dose ratio between toxicity and therapeutic effect is the therapeutic index, and it can be expressed as the ratio LD50 / ED50. Compounds that exhibit a high therapeutic index are preferred. Data obtained from these cell culture assays and animal studies can be used to formulate a dose range for use in a subject. The dose of such compounds is preferably within the circulating concentration range that includes the ED50, with little or no toxicity. The dose can vary within this range depending on the dosage form used and the route of administration. The exact formulation, route of administration, and dose can be selected by an individual physician based on the condition of the subject. (See, e.g., Fingl et al., 1975, “The Pharmacological Basis of Therapeutics”, page 1, chapter 1).

[0156] The composition of the present invention can be suitably formulated into an injectable. The composition can be prepared in unit dosage forms in ampoules or multi-dose containers. The polynucleotide can be present in an oily or preferably aqueous solvent in the form of a suspension, solution or emulsion, etc. Alternatively, the polynucleotide can be in a lyophilized form for reconstitution with a suitable solvent such as sterile pyrogen-free water upon delivery. Both the liquid to be reconstituted and the lyophilized form will contain an amount of an active agent, preferably a buffer, required to appropriately adjust the pH of the injection solution. For any parenteral application, especially a preparation to be administered intravenously, the total concentration of the solute should be controlled so that the preparation is isotonic, hypotonic or weakly hypertonic. Non-ionic materials, such as sugars, are preferably used to adjust the tonicity, and sucrose is particularly preferred. Any of these forms can also contain suitable formulations, such as starches or sugars, glycerol or saline. Each unit dose of the composition, whether liquid or solid, can contain 0.1% to 99% of the polynucleotide material.

[0157] The unit dose ampoules or multi-dose containers for packaging the polynucleotide before use can comprise a sealed container that contains a certain amount of the polynucleotide or a solution containing the polynucleotide suitable for its pharmaceutically effective dose, or a multiple effective dose. The polynucleotide is packaged as a sterile preparation, and the sealed container is designed to maintain the sterility of the preparation until use.

[0158] The dosage to be administered depends to a large extent on the condition and size of the patient being treated and the frequency of treatment and the route of administration. The regimen for continuous treatment, including the dosage and frequency, can be guided by the initial response and clinical judgment. The parenteral route of injection into the tissue space is preferred, although other parenteral routes may be required in specific administrations, such as inhalation aerosol formulations, such as administration to the nasal, pharyngeal, bronchial tissues or the mucosa of the lungs.

[0159] 5. Method of treatment

[0160] In various embodiments, the present disclosure provides a method of treating, ameliorating or preventing a fibrotic condition in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the miR-25 mimics described herein.

[0161] Fibrotic conditions that can be treated using the miR-25 mimics of the present disclosure include, but are not limited to, liver fibrosis, renal fibrosis, pulmonary fibrosis, cardiac fibrosis, skin fibrosis, age-related fibrosis, splenic fibrosis, scleroderma and / or post-transplant fibrosis.

[0162] In certain embodiments, the fibrosis is liver fibrosis and is present in a subject having a disease selected from chronic liver injury, hepatitis infection (such as hepatitis B infection and / or hepatitis C infection), non-alcoholic steatohepatitis, alcoholic liver disease, liver injury after exposure to environmental toxins and / or natural products, and cirrhosis.

[0163] In certain embodiments, the pulmonary fibrosis is idiopathic pulmonary fibrosis, or the subject has chronic obstructive pulmonary disease.

[0164] In some embodiments, the fibrosis is renal fibrosis and is present in a subject having a disease or condition selected from: glomerulosclerosis, tubulointerstitial fibrosis, IgA nephropathy, intestinal fibrosis / tubular atrophy, chronic kidney injury, chronic kidney disease, glomerular disease, glomerulonephritis, diabetes, idiopathic focal segmental glomerulosclerosis, membranous nephropathy, collapsing glomerular disease, chronic recurrent kidney infection, chronic kidney disease after acute kidney injury (AKI), kidney injury after exposure to environmental toxins and / or natural products, and end-stage renal disease. In certain embodiments, the renal fibrosis is caused by acute or repeated trauma to the kidney.

[0165] In certain embodiments, the disease is an inflammatory disease.

[0166] In some embodiments, administration of the miR-25 mimics of the present disclosure can reduce the expression or activity of one or more extracellular matrix genes in the cells of a subject. In additional embodiments, administration of the miR-25 mimics of the present disclosure can reduce the expression or activity of one or more collagen synthesis genes in the cells of a subject. The cells of the subject, wherein the expression or activity of various genes is regulated by the miR-25 mimics of the present disclosure in fibroblasts, corneal cells, epidermis, epithelium, endothelial cells, and hepatic stellate cells. In some embodiments, administration of the miR-25 mimics can reduce the expression of COL1A1, COL1A2, COL3A1, COL4A3, COL5A2, COL11A1, FN1, MMP2, CTGF, TGFB2, and / or TGFB3. In some embodiments, administration of the miR-25 mimics downregulates the inflammatory response associated with fibrosis (e.g., MCP1). In some embodiments, administration of the miR-25 mimics can reduce the infiltration of immune effector cells such as neutrophils, lymphocytes, monocytes, and macrophages in fibrotic tissues or organs. In some embodiments, administration of the miR-25 mimics can reduce or inhibit epithelial-to-mesenchymal transition. In some embodiments, administration of the miR-25 mimics can reduce or inhibit myofibroblast differentiation.

[0167] In certain embodiments, the present disclosure provides methods of modulating extracellular matrix genes in hepatic stellate cells, including contacting the cells with the miR-25 mimics of the present disclosure. In some embodiments, the present disclosure provides methods of modulating collagen synthesis genes in hepatic stellate cells, including contacting the hepatic stellate cells with the miR-25 mimics of the present disclosure. Upon treatment or contact, the miR-25 mimics reduce the expression or activity of the extracellular matrix genes or collagen synthesis genes.

[0168] In some embodiments, the present disclosure provides methods of treating, preventing, reducing, or eliminating fibrosis secondary to organ treatment with an antibody, small molecule drug, biologic, aptamer, or virus (e.g., viral vector).

[0169] The present disclosure also provides methods for assessing the efficacy of fibrosis treatment with a miR-25 agonist (e.g., a drug or miR-25 mimic). For example, in some embodiments, the method for assessing treatment efficacy includes determining the expression levels of one or more genes in the hepatic stellate cells of a subject before treatment with a miR-25 mimic, wherein the one or more genes are selected from a group of genes regulated by miR-25; determining the expression levels of the same one or more genes in the cells / fibrotic tissue of the subject after treatment with the miR-25 mimic; and determining whether the treatment is effective, less effective, or ineffective based on the expression levels before and after treatment. In additional embodiments, a difference in gene expression of at least 1-fold, 1.5-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, or 4-fold before and after treatment indicates that the treatment is effective.

[0170] 6. Kits

[0171] The present invention also provides kits comprising miR-25 mimics as described extensively above and elsewhere herein. Such kits may additionally comprise alternative immunogenic agents for use in conjunction with the immunostimulatory compositions of the present invention.

[0172] In some embodiments, in addition to the immunostimulatory compositions of the present invention, the kits may include suitable components for performing the above-described prime-boost regimen. For example, the kits may include at least one polypeptide antigen in separately stored prime and boost doses.

[0173] The kits may include other components to assist in practicing the methods of the present invention, such as administration devices, buffers, and / or diluents. The kits may also include containers for holding the various components and instructions for using the kit components in the methods of the present invention.

[0174] To make the present invention easy to understand and put into practice, specific preferred embodiments will now be described by the following non-limiting examples.

[0175] Example

[0176] Example 1

[0177] Novel miR-25 mimics effectively downregulate the target genes FKBP14 and ADAM-17

[0178] The present inventors previously demonstrated that the Notch-signaling regulators FKBP14 and ADAM-17 are direct targets of miR-25, and that FKBP14 and ADAM-17 are downregulated by overexpressing miR-25 in HSCs using a commercially available miR-25 mimic (Genz, B et al., Scientific Reports, 2019). To increase the efficiency of target gene downregulation, the present inventors designed 15 proprietary mimics (Table 4; Combinations 1-16, C1-16), which are based on the mature miR-25 sequence (SEQ ID NO:1). Among the 15 mimics, using mimics at 5-40 pmol / mL, C2, C3, C13, and C15 showed concentration-dependent downregulation of FKBP14, and C3 exhibited the highest target gene downregulation of up to 50% (p < 0.05 at 40 pmol / mL; Figure 1 and Figure 2 ). Therefore, in further experiments, C3, C13, and C15 were used at 5 pmol / mL, 20 pmol / mL, and 40 pmol / mL to evaluate the effects of low and high concentrations of miR-25 on target genes.

[0179] Table 4

[0180]

[0181]

[0182] Compared with the negative control and the commercially available mimic, using C3 downregulated the mRNA expression of both FKBP14 and ADAM-17. Compared with the negative control, using 20 and 40 pmol / mL C3 to downregulate FKBP14 was statistically significant (p < 0.05; Figure 3 A), and its mRNA was further reduced by ~30% compared with the commercially available mimic. Using the commercially available mimic, 5, 20, and 40 pmol / mL of C3, the downregulation of ADAM-17 was statistically significant (p < 0.05; Figure 3 B). Initial analysis of protein expression 48 hours after transfection with the miR-25 mimic showed that neither FKBP14 nor ADAM-17 was significantly reduced ( Figure 4)。The protein expression of FKBP14 was significantly downregulated after 72 hours using commercially available miR-25 at 40 pmol / mL (p < 0.05), as well as C3 at 20 pmol / mL (p < 0.05) and 40 pmol / mL (p < 0.001). Figure 3 B). Using C3 downregulated the protein expression of ADAM-17 after 72 hours compared to the negative control and commercially available mimics; however, the results did not reach statistical significance. Figure 3 B).

[0183] For C13 and C15, the mRNA expression of both FKBP14 and ADAM-17 was downregulated compared to the negative control. The downregulation of FKBP14 was statistically significant for both C13 and C15 at 5, 20, and 40 pmol / mL compared to the negative control (p < 0.05; Figure 5 A and 5C). The downregulation of ADAM-17 was statistically significant only for C15 at 20 pmol / mL compared to the negative control (p < 0.05; Figure 5 D). Using C13 downregulated the protein expression of ADAM-17 after 72 hours compared to the negative control; however, the results did not reach statistical significance. Figure 5 B).

[0184] Example 2

[0185] Novel miR-25 mimics that inhibit collagen expression

[0186] In extrahepatic cell types, miR-25 has been shown to downregulate fibrillar collagen expression. Of great interest in this application, C3 significantly downregulated the mRNA expression of type I and type III fibrillar collagens. Using C3 at 5 pmol / mL (p < 0.01), 20 pmol / mL, and 40 pmol / mL (p < 0.001) significantly downregulated COL1A1 mRNA compared to the negative control. Using C3 at 20 pmol / mL and 40 pmol / mL significantly improved the downregulation of COL1A1 mRNA by ~35% compared to the commercially available mimics (p < 0.05; Figure 6 A). Therefore, using C3 at 20 pmol / mL and 40 pmol / mL significantly downregulated the protein expression of COL1A1 after 72 hours compared to the negative control (p < 0.001; Figure 6 B). Using C3 at 20 pmol / mL and 40 pmol / mL further downregulated the protein expression of COL1A1 by ~43% compared to 40 pmol / mL of commercially available miR-25 (p < 0.05; Figure 6B). Similarly, compared with the negative control, C3 at 20 pmol / mL (p < 0.05) and 40 pmol / mL (p < 0.01) significantly reduced the expression of procollagen 1α1 in the supernatant of LX-2 cell cultures after 72 hours ( Figure 6 C).

[0187] TGF-β stimulation significantly upregulated the expression of COL1A1 mRNA in LX-2 cells transfected with the negative control mimic (p < 0.01; Figure 6 D; left panel). TGF-β-dependent COL1A1 induction was inhibited in cells transfected with C3, reaching statistical significance at 40 pmol / mL (p < 0.05; Figure 6 D; left panel). Compared with the commercially available miR-25 mimic, C3 further reduced TGF-β-induced COL1A1 expression by ~20%, although not reaching statistical significance ( Figure 6 D; left panel). Overexpression of miR-25 had no obvious effect on TGF-β-induced ACTA2 mRNA expression ( Figure 6 D; right panel).

[0188] For C13 and C15, the mRNA expression of both COL1A1 and COL1A2 was downregulated compared with the negative control. The downregulation of COL1A1 was statistically significant for C13 at 40 pmol / mL and C15 at 5, 20, and 40 pmol / mL compared with the negative control (p < 0.05; Figure 7 A&7C). The downregulation of COL1A2 was statistically significant only for C13 at 5, 20, and 40 pmol / mL compared with the negative control (p < 0.05; Figure 5 B). Compared with the negative control, C15 downregulated COL1A2 protein expression after 72 hours; however, the results did not reach statistical significance ( Figure 7 D).

[0189] Compared with the negative control, the use of all three concentrations of C3 also significantly downregulated COL1A2 mRNA (p < 0.001) ( Figure 8 A). Similarly, compared with the negative control, C3 at 20 pmol / mL and 40 pmol / mL significantly downregulated COL1A2 protein expression after 72 hours (p < 0.01; Figure 8 B). Compared with the negative control, C3 at 20 pmol / mL and 40 pmol / mL also significantly downregulated COL3A1 mRNA (p < 0.05; Figure 8C). In addition, compared with the negative control (p < 0.05), C3 at 20 pmol / mL significantly downregulated COL3A1 protein expression after 72 hours; and compared with the negative control (p < 0.001) and a commercially available mimic at 40 pmol / mL (p < 0.05; Figure 8 D), C3 at 40 pmol / mL significantly downregulated COL3A1 protein expression after 72 hours.

[0190] Example 3

[0191] C3 had a slight effect on non-fibrillar collagen expression

[0192] Compared with the negative control, C3 at 20 pmol / mL (p < 0.05) and 40 pmol / mL (p < 0.01) significantly downregulated COL4A1 mRNA expression ( Figure 9 A). Compared with the negative control and the commercially available mimic, C3 at 5, 20, and 40 pmol / mL downregulated COL4A2 mRNA expression by ~60%, 25%, and 30%, respectively, although this did not reach statistical significance ( Figure 9 B). Overexpression of miR-25 did not significantly downregulate COL4A5 mRNA ( Figure 9 ).

[0193] Example 4

[0194] The novel miR-25 mimic selectively downregulates TGF-βR1

[0195] The inventors further investigated the effect of miR-25 overexpression on TGF-β signaling genes. Compared with the negative control, C3 at 5 pmol / mL (p < 0.01), 20 pmol / mL (p < 0.001), and 40 pmol / mL (p < 0.0001) significantly downregulated TGF-βR1 mRNA in a concentration-dependent manner ( Figure 10 A). Compared with the commercially available mimic (20 pmol / mL; p < 0.05; Figure 10 A), C3 at 40 pmol / mL also significantly downregulated TGF-βR1 mRNA. TGF-βR1 protein expression after 72 hours reflected this same effect, with C3 at 40 pmol / mL downregulating expression by ~55% compared with the negative control (p < 0.05; Figure 10 ). Expression of TGF-βR2, TGF-βR3, TGF-β1, and TGF-β2 mRNA was not affected by miR-25 overexpression ( Figure 10 C-F).

[0196] Compared with the negative control, C13 at 20 pmol / mL and 40 pmol / mL significantly downregulated COL3A1 mRNA (p < 0.05; Figure 11 A). The inventors further investigated the effect of miR-25 overexpression on TGF-β signaling genes. Compared with the negative control, C13 and C15 at 5 pmol / mL (p < 0.01), 20 pmol / mL (p < 0.001), and 40 pmol / mL (p < 0.0001) significantly downregulated TGF-βR1 mRNA in a concentration-dependent manner ( Figure 11 B&D).

[0197] Example 5

[0198] C3 specifically downregulates collagen regulators through TGFβ signaling

[0199] To broaden the understanding of the function of miR-25 in HSCs, the inventors analyzed its effect on the expression of collagen regulators that increase during HSC activation and fibrosis. miR-25 had no effect on MMP1 expression ( Figure 12 A). Compared with the negative control, C3 at 5 and 20 pmol / mL (p < 0.01) and 40 pmol / mL (p < 0.05; Figure 12 B) significantly downregulated MMP2 mRNA. TIMP-1 and TIMP-3 mRNA expression was downregulated with miR-25 overexpression, but not to a statistically significant effect ( Figure 12 C-D).

[0200] Example 6

[0201] C3 reduces cell proliferation, but does not affect cell migration or cell contractility

[0202] Cell proliferation, migration, and contractility increase during HSC activation. The inventors examined whether miR-25 overexpression affects this phenotype. Compared with the commercially available mimics and the negative control, C3 did not significantly upregulate the wound width closure rate (μm) ( Figure 13 A). Compared with the negative control (p < 0.0001) and with two concentrations of commercially available miR-25 mimics (p < 0.0001; Figure 13 B), C3 at 20 pmol / mL and 40 pmol / mL significantly reduced the cell proliferation rate. Compared with the negative control, commercially available miR-25 also significantly reduced cell proliferation, but to a lesser extent than C3 (p < 0.001 at 20 pmol / mL, p < 0.001 at 40 pmol / mL; Figure 13B). Compared with commercially available mimics and negative controls, the use of C3 did not significantly affect cell contractility ( Figure 13 C).

[0203] Materials & Methods

[0204] 6.1 Synthesis and Annealing of Proprietary miR-25-3p Mimics

[0205] A chemically modified single-stranded RNA sequence was synthesized based on the mature miR-25-3p sequence. Before cooling to room temperature, the RNA sequence was annealed in 1 mL of 1× annealing buffer (ultrapure aqueous solution of 10 mM UltraPure Tris, 50 mM NaCl, 1 mM EDTA) by heating to 85 °C. Different combinations of the sequences were annealed to generate proprietary miRNA mimics (Table 4). The proprietary mimics include RNA nucleotides (rA / rG / rC / rU) containing conventional phosphate and phosphorothioate (*) bonds, as well as 2'-O-methyl-RNA nucleotides (mA / mG / mC / mU) or 2'-fluoro-RNA nucleotides (fA / fG / fC / fU) (Table 3).

[0206] 6.2 Cell Culture and miRNA Mimic Transfection

[0207] All experiments were conducted in vitro in LX-2 cells, an immortalized human HSC line (provided by Prof. Scott L. Friedman, Mount Sinai School of Medicine, New York, USA). LX-2 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM, high glucose; Sigma Aldrich, St. Louis, MO, USA) containing 2% fetal bovine serum (FCS), 1% glutamine, and 1% penicillin / streptomycin at 37 °C and 5% CO2. The cells were seeded in 6-well tissue culture plates (2×10 5 cells / well for RNA isolation) or 10 cm cell culture dishes (5×10 5Cells were cultured to 80% confluence in a cell culture dish for protein extraction. Twenty-four hours after cell seeding, cells were transiently transfected with 5, 20, or 40 pmol / mL of C3, a commercially available miR-25 mimic, or a negative control (MISSION microRNA, Sigma) using Lipofectamine LTX (Life Technologies, Carlsbad, CA, USA) according to the manufacturer's protocol. The negative control used was a non-specific miRNA mimic from Caenorhabditis elegans (MISSION microRNA mimic negative control 2; Sigma). Forty-eight hours after transfection, cells were harvested in 350 μl of RLT buffer (Qiagen, Hilden, Germany) for RNA isolation, or in 100 μl of RIPA buffer (PBS solution with 2% NP-40, 0.05% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 1× protease and phosphatase inhibitors) for protein isolation and stored at -20 °C until further use.

[0208] 6.3 RNA Isolation and qRT-PCR Analysis

[0209] RNA was isolated from transfected LX-2 cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. RNA concentration was quantified using a NanoDropTM spectrophotometer (ThermoFisher Scientific, Waltham, MA, USA). One hundred nanograms of isolated RNA was transcribed into complementary DNA (cDNA) using the SensiFASTTM cDNA Synthesis Kit (Bioline, Luckenwade, Germany) under the following conditions: priming at 25 °C for 10 minutes, reverse transcription at 42 °C for 15 minutes, and inactivation at 85 °C for 5 minutes. The cDNA was diluted 1:2 in nuclease-free water and stored at -20 °C. Real-time fluorescence quantitative PCR (qRT-PCR) was performed using the custom primer sequences listed in Table 5. Using the standard protocol (incubating UDG at 50 °C for 2 minutes, holding at 95 °C for 2 minutes, 40 cycles: 95 °C for 15 seconds, 60 °C for 30 seconds), Platinum SYBR Green qPCR SuperMix-UDG (Life Technologies) was used on a CFX384 Touch TMqPCR was performed in a thermal cycler (BioRad). The relative expression of target gene mRNA was normalized to the relative expression of the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and analyzed using the 2ΔCT method. The relative expression values of each treatment were normalized to the average of the negative control samples to calculate the fold change.

[0210] Table 5

[0211] Primer Sequences for qRT-PCR

[0212]

[0213]

[0214] 6.4 TGF-β Stimulation Assay

[0215] After transfection of cells with combination 3 (5, 20, and 40 pmol / mL), commercially available miR-25, or negative control mimic (20 pmol / mL) for 24 hours, the cells were stimulated with TGF-β (10 ng / mL in DMEM) or control (RNase-free water). After an additional 24 hours, the cells were harvested and the relative expression of COL1A1 and ACTA2 mRNA was analyzed using qRT-PCR as described above.

[0216] 6.5 SDS-PAGE and Western Blot

[0217] Protein lysates were quantified using the BCA assay (ThermoFisher Scientific). 10 μg of protein from each sample was separated by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and then wet transferred to a low-fluorescence PVDF membrane (Merck Millipore, Burlington, MA, USA) at 90 V for 2 hours. The membrane was blocked in blocking buffer for 1 hour at room temperature and then incubated overnight at 4°C with the primary antibody in TB blocking buffer containing 0.2% Tween-20 (antibodies and dilutions are listed in Table 5). The membrane was then washed and incubated with the IRDye secondary antibody (Table 6) in TBS blocking buffer containing 0.2% Tween-20 and 0.01% SDS for 1 hour at room temperature. The membrane was scanned using a CLX infrared imaging system (Li-Cor Biosciences, Nebraska, USA) and analyzed using Image Studio Lite software version 5.2.5 (Li-Cor Biosciences). The protein expression of the target gene was normalized to the relative protein expression of β-actin.

[0218] Table 6

[0219] Primary Antibodies and Secondary Antibodies for Western Blot Analysis

[0220]

[0221]

[0222] 6.6 Enzyme-Linked Immunosorbent Assay (ELISA)

[0223] LX-2 cells were seeded and transfected with proprietary mimic C3 or commercially available miR-25 mimics (20 pmol / mL and 40 pmol / mL) or negative control mimic (40 pmol / mL) into 10 cm culture dishes as described above. After 24 hours, the cells were washed with 1×PBS and the medium was replaced with fresh DMEM. After 48 hours of transfection, the cell medium was collected and centrifuged at 2,000×g for 10 minutes to remove debris. The supernatant was stored at -80 °C. The cells were washed again and the cell medium was replaced. At 72 hours after transfection, the cell medium was collected and stored at -80 °C as described above. Human procollagen Iα1 SimpleStep Kit (Abcam, Cambridge, UK) was used to analyze the change in COL1A1 secretion after miR-25 transfection. Samples were diluted 1:64 and analyzed according to the manufacturer's protocol.

[0224] 6.7 Cell Migration Analysis

[0225] Twenty-four hours after transfection of LX-2 cells with proprietary mimic C3 or commercially available miR-25 mimics (20 pmol / mL and 40 pmol / mL) or negative control mimic (40 pmol / mL), the cells were re-seeded at 4.5×10 4 cells / well into 96-well cell culture plates. After 24 hours, once the cells were confluent, wound treatment was performed using a scratch wound marker (Essen Bioscience, Ann Arbor, Michigan, USA), and the plates were incubated in an IncuCyte Zoom live cell analysis system (Essen Bioscience) for 24 hours. Wound closure over time was measured by wound width (μm). Data were normalized in GraphPad Prism (version 8.4.3; GraphPad Software, San Diego, CA, USA).

[0226] 6.8 Cell Proliferation Assay

[0227] The cell proliferation assay was performed as described above to analyze the changes in HSC proliferation. LX-2 cells were transfected with the proprietary mimic C3 or commercially available miR-25 (20 pmol / mL and 40 pmol / mL) or negative control mimic (40 pmol / mL). After 24 hours, the transfected cells were re-seeded in triplicate at 2×10 5 cells / well in a 12-well plate, and the plate was incubated in an IncuCyte Zoom live cell analysis system (Essen Bioscience) for up to 7 days. Cell proliferation was measured based on the change in cell confluence (%) over time. The data were normalized relative to the baseline in GraphPad Prism, and a one-phase correlation non-linear regression was performed to calculate the growth constant (K) indicative of the cell proliferation rate.

[0228] 6.9 Cell Contractility Assay

[0229] The collagen contraction assay was performed as described above to analyze the changes in HSC contractility. LX-2 cells were transfected with the proprietary mimic C3 or commercially available miR-25 (20 pmol / mL and 40 pmol / mL) or negative control mimic (40 pmol / mL). According to the manufacturer's instructions, the type I collagen solution from bovine skin (Sigma) was adjusted to physiological pH and stiffness. In a 24-well cell culture plate, 900 μL / well was placed overnight at 37 °C to form a collagen lattice. After 24 hours of transfection, the cells were re-seeded at 1×10 5 cells / well onto the collagen matrix in 1 mL of serum-free DMEM (1% glutamine and 1% penicillin / streptomycin). After another 24 hours, endothelin-1 (10 nM, Sigma) was added to stimulate cell contraction, and the plates were photographed at 0.5, 1, 2.5, and 6 hours using a gel imaging system (Vilber Lourmat, Collégien, France). The contraction of the collagen matrix over time was measured in ImageJ software (version 1.5j8, National Institutes of Health, USA). The data were normalized in GraphPad Prism.

[0230] 6.10 Statistical Analysis

[0231] All data are represented as the mean ± standard error of the mean (SEM). GraphPad Prism (version 8.4.3) was used for statistical analysis of the data. The Shapiro-Wilk normality test was used to test the normality of the data. All results were analyzed using one-way ANOVA with Dunnett's multiple comparison post hoc analysis. A significant difference was defined as P < 0.05.

[0232] The disclosures of each patent, patent application, and publication cited herein are hereby incorporated by reference in their entirety.

[0233] The citation of any reference herein should not be construed as an admission that such reference is available as "prior art" for the present application.

[0234] Throughout the specification, the aim is to describe the preferred embodiments of the invention and not to limit the invention to any one embodiment or particular set of features. Those skilled in the art will thus understand that, in light of the present disclosure, various modifications and changes can be made to the particular embodiments illustrated without departing from the scope of the invention. All such modifications and changes are intended to be included within the scope of the appended claims.

[0235] References

[0236] Geerts, A. History, heterogeneity, developmental biology, and functions of quiescent hepatic stellate cells. Semin Liver Dis 21, 311 - 335, doi:10.1055 / s - 2001 - 17550(2001).

[0237] Friedman, S. L. Hepatic Stellate Cells: Protean, Multifunctional, and Enigmatic Cells of the Liver. Physiological Reviews 88, 125 - 172, doi:10.1152 / physrev.00013.2007(2008).

[0238] Bataller, R. & Brenner, D. A. Liver fibrosis. J Clin Invest 115, 209 - 218, doi:10.1172 / JCI24282(2005).

[0239] Mederacke, I. et al., Fate tracing reveals hepatic stellate cells as dominant contributors to liver fibrosis independent of its aetiology. Nature Communications 4, 2823, doi:10.1038 / ncomms3823(2013).

[0240] Dooley, S. et al., Transforming growth factor beta signal transduction in hepatic stellate cells via Smad2 / 3 phosphorylation, a pathway that is abrogated during in vitro progression to myofibroblasts. TGFbeta signal transduction during transdifferentiation of hepatic stellate cells. FEBS Lett 502, 4 - 10 (2001).

[0241] Villanueva, A. et al., Notch signaling is activated in human hepatocellular carcinoma and induces tumor formation in mice. Gastroenterology 143, 1660 - 1669.e1667, doi:10.1053 / j.gastro.2012.09.002 (2012).

[0242] Xie, G. et al., Cross - talk between Notch and Hedgehog regulates hepatic stellate cell fate in mice. Hepatology (Baltimore, Md.) 58, 1801 - 1813, doi:10.1002 / hep.26511 (2013).

[0243] Bansal, R., van Baarlen, J., Storm, G. & Prakash, J. The interplay of the Notch signaling in hepatic stellate cells and macrophages determines the fate of liver fibrogenesis. Scientific Reports 5, 18272, doi:10.1038 / srep18272 (2015).

[0244] Wang, Y. et al., Notch signaling mediated by TGF-β / Smad pathway in concanavalin A-induced liver fibrosis in rats. World J Gastroenterol 23, 2330 - 2336, doi:10.3748 / wjg.v23.i13.2330(2017).

[0245] le Sage, C. et al., Regulation of the p27(Kip1) tumor suppressor by miR-221 and miR-222 promotes cancer cell proliferation. EMBO J 26, 3699 - 3708, doi:10.1038 / sj.emboj.7601790(2007).

[0246] Yu, F. et al., let-7 Regulates Self Renewal and Tumorigenicity of Breast Cancer Cells. Cell 131, 1109 - 1123, doi:10.1016 / j.cell.2007.10.054(2008).

[0247] Eichhorn, S.W. et al., mRNA destabilization is the dominant effect of mammalian microRNAs by the time substantial repression ensues. Mol Cell 56, 104 - 115, doi:10.1016 / j.molcel.2014.08.028(2014).

[0248] Guo, H., Ingolia, N.T., Weissman, J.S. & Bartel, D.P. Mammalian microRNAs predominantly act to decrease target mRNA levels. Nature 466, 835 - 840, doi:10.1038 / nature09267(2010).

[0249] Bartel, D. P. MicroRNAs: Target Recognition and Regulatory Functions. Cell 136, 215 - 233, doi: https: / / doi.org / 10.1016 / j.cell.2009.01.002 (2009).

[0250] Ha, M. & Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology 15, 509 - 524, doi: 10.1038 / nrm3838 (2014).

[0251] Krauskopf, J. et al., Serum microRNA signatures as "liquid biopsies" for interrogating hepatotoxic mechanisms and liver pathogenesis in human. PLoS One 12, e0177928 - e0177928, doi: 10.1371 / journal.pone.0177928 (2017).

[0252] Ichimura, A., Ruike, Y., Terasawa, K. & Tsujimoto, G. miRNAs and regulation of cell signaling. The FEBS Journal 278, 1610 - 1618, doi: 10.1111 / j.1742 - 4658.2011.08087.x (2011).

[0253] Inui, M., Martello, G. & Piccolo, S. MicroRNA control of signal transduction. Nature Reviews Molecular Cell Biology 11, 252 - 263, doi: 10.1038 / nrm2868 (2010).

[0254] Cook, N. L., Pereira, T. N., Lewindon, P. J., Shepherd, R. W. & Ramm, G. A. Circulating microRNAs as noninvasive diagnostic biomarkers of liver disease in children with cystic fibrosis. J Pediatr Gastroenterol Nutr 60, 247 - 254, doi:10.1097 / MPG.0000000000000600 (2015).

[0255] Genz, B. et al., Overexpression of miR - 25 - 3p inhibits Notch1 signaling and TGF - β - induced collagen expression in hepatic stellate cells. Scientific Reports 9, 8541, doi:10.1038 / s41598 - 019 - 44865 - 1 (2019).

Claims

1. A composition comprising a miR-25 mimetic compound, wherein the miR-25 mimetic compound comprises: a. A first strand that comprises a nucleotide sequence corresponding to residues 52-73 of the mature miR-25 sequence shown in SEQ ID NO:1, is conjugated with two uracil residues at the 3’ end, and has at least one modified nucleotide; and b. A second strand that hybridizes with the first strand at least under low stringency conditions and has at least one modified nucleotide.

2. The composition according to claim 1, wherein the modified nucleotide comprises a nucleotide having a backbone modification and / or a modified sugar residue.

3. The composition according to claim 2, wherein the backbone modification comprises one or more phosphorothioate, morpholino, or phosphonyl carboxylate bonds.

4. The composition according to claim 3, wherein the first two nucleotides at the 5’ end of the first strand are linked to each other by a phosphorothioate bond.

5. The composition according to claim 3 or claim 4, wherein the last 4 or 5 nucleotides at the 3’ end of the first strand are linked to each other by a phosphorothioate bond.

6. The composition according to any one of claims 1 to 5, wherein at least one 3’ nucleotide of the first strand is a 2’-O-methyl modified nucleotide.

7. The composition according to any one of claims 1 to 6, wherein at least one nucleotide of the first strand is a 2’-fluoronucleotide.

8. The composition according to any one of claims 1 to 7, wherein the first strand does not have a modified sugar residue at the second position at both the 5’ and 3’ ends.

9. The composition according to any one of claims 1 to 8, wherein the backbone modification of the second strand comprises one or more of phosphorothioate, morpholino, or phosphonyl carboxylate bonds.

10. The composition according to claim 9, wherein the first two nucleotides at the 5’ end of the second strand are linked by a phosphorothioate bond.

11. The composition according to claim 9 or claim 10, wherein the last seven nucleotides at the 3’ end of the second strand are linked by a phosphorothioate bond.

12. The composition according to any one of claims 1 to 11, wherein the first nucleotide at the 5’ end of the second strand is a 2’-O-methyl modified nucleotide.

13. The composition according to any one of claims 1 to 11, wherein the first seven nucleotides at the 3’ end of the second strand are 2’-O-methyl modified nucleotides.

14. The composition according to any one of claims 1 to 13, wherein the miR-25 mimetic compound is as shown in Table 1: Table 1 Table 2 15. The composition according to any one of claims 1 to 14, wherein the first strand comprises a sequence selected from SEQ ID NO:2, 4, 9, 11, 12, 13, or 14, and the second strand comprises the sequence shown in SEQ ID NO:

5.

16. The composition according to any one of claims 1 to 15, wherein the first strand comprises the sequence of SEQ ID NO:2, and the second strand comprises the sequence of SEQ ID NO:

5.

17. The composition according to any one of claims 1 to 15, wherein the first strand comprises the sequence of SEQ ID NO:14, and the second strand comprises the sequence of SEQ ID NO:

5.

18. The composition according to any one of claims 1 to 15, wherein the first strand comprises the sequence of SEQ ID NO:16, and the second strand comprises the sequence of SEQ ID NO:

5.

19. A pharmaceutical composition comprising the composition according to any one of claims 1 to 18, and a pharmaceutically acceptable carrier, excipient or diluent.

20. A method for treating fibrosis in a subject, comprising administering to the subject the pharmaceutical composition according to claim 19.

21. A method for treating fibrosis in a subject, wherein the fibrosis is liver fibrosis.

22. The method according to claim 20 or claim 21, wherein the expression of COL1A1, COL1A2, COL3A1, COL4A3, COL5A2, COL11A1, FN1, MMP2, CTGF, TGFB2 and / or TGFB3 is reduced.

23. The method according to any one of claims 20 to 22, wherein the miR-25 mimic compound is as shown in Table 1 or Table 2.

24. The method according to any one of claims 20 to 22, wherein the first strand comprises a sequence selected from SEQ ID NO:2, 4, 9, 11, 12, 13 or 14, and / or the second strand comprises a sequence selected from SEQ ID NO:

5.

25. The method according to any one of claims 20 to 24, wherein the first strand comprises the sequence of SEQ ID NO:2, and the second strand comprises the sequence of SEQ ID NO:

5.

26. The method according to any one of claims 20 to 25, wherein the first strand comprises the sequence of SEQ ID NO:11, and the second strand comprises the sequence of SEQ ID NO:

5.

27. The method according to any one of claims 20 to 26, wherein the first strand comprises the sequence of SEQ ID NO:13, and the second strand comprises the sequence of SEQ ID NO:

5.

28. The method according to any one of claims 20 to 27, wherein the subject is a human.

Images