Polypeptide coded by Pri-miR399b and application of polypeptide in aspect of delaying ripening of grape fruits

By synthesizing the polypeptide PEP1-2 encoded by Pri-miR399b and spraying its aqueous solution before the grape coloration period, the problem of difficulty in effectively controlling the grape maturity period in the prior art is solved, safe and environmentally friendly delay in fruit ripening, and ensuring the time-separation supply of safe fresh fruits.

CN120230187APending Publication Date: 2025-07-01HENAN UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510384416.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-07-01

AI Technical Summary

Technical Problem

The existing technology is difficult to effectively regulate the maturity of grapes, resulting in large fluctuations in market prices, affecting the economic benefits of growers, and commonly used chemical preparations are harmful to the environment and public health.

Method used

By predicting the primary sequence of miR399b, the relevant small peptides were predicted, and the polypeptide PEP1-2 encoded by Pri-miR399b was synthesized to make an aqueous solution, and sprayed before the grape color conversion period to delay the ripening of grape fruits.

Benefits of technology

It significantly delays the ripening of grape fruits and delays color conversion by 14 days. It has high efficiency and accuracy, is safe and environmentally friendly, and does not introduce exogenous substances.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120230187A_ABST
    Figure CN120230187A_ABST
Patent Text Reader

Abstract

The invention provides a Pri-miR399b-coded polypeptide and application thereof in delaying grape fruit ripening, and belongs to the technical field of molecules. The Pri-miR399b-coded polypeptide is PEP1-2, and the amino acid sequence of the PEP1-2 is shown as SEQ ID NO.1. An aqueous solution prepared from the Pri-miR399b-coded polypeptide PEP1-2 can delay grape fruit ripening after being applied before the grape color changing period, and the application of the Pri-miR399b-coded polypeptide PEP1-2 in delaying grape fruit ripening is facilitated. After PEP1-2 treatment, the Kyoho grapes enter an initial color changing stage 14 days later than a control group, the initial color changing stage is obviously lagged behind the control group, and an important reference is provided for accurate regulation and control technology research and mechanism research in the grape mature period.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular technology, and particularly relates to a polypeptide encoded by Pri-miR399b and its application in delaying the ripening of grape fruits. Background Art

[0002] ‘Kyoho’ grape is one of the important cultivated varieties in China. At present, the maturity periods in its main production areas are relatively concentrated, resulting in a stage of oversupply, large fluctuations in market prices, and seriously affecting the economic benefits of growers. At present, the commonly used methods for regulating the maturity period of grapes in production are changing cultivation conditions, optimizing variety structures, spraying chemical agents, etc. However, the costs of changing cultivation conditions and optimizing variety structures are relatively high, while the spraying of chemical agents has a greater impact on the environment and public health. Therefore, the regulation of fruit maturity period has become a technical bottleneck restricting the improvement of grape economic benefits.

[0003] There is an urgent need for a healthy and pollution-free method that can regulate the maturity period of grapes to ensure the segmented supply of safe fresh fruits. Summary of the Invention

[0004] The first object of the present invention is to provide a polypeptide encoded by Pri-miR399b, in order to explore the key polypeptide for regulating the maturity period of grapes.

[0005] The second object of the present invention is to provide an application of a polypeptide encoded by Pri-miR399b in delaying the ripening of grape fruits, in order to obtain a healthy and pollution-free method that can regulate the maturity period of grapes to ensure the segmented supply of safe fresh fruits.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] A polypeptide encoded by Pri-miR399b, the polypeptide encoded by Pri-miR399b is PEP1-2, and the amino acid sequence of PEP1-2 is shown in SEQ ID NO.1.

[0008] The present invention belongs to a pioneering invention. The present invention predicts related small peptides according to the primary sequence of miR399b, predicts the possible coding frames within 600bp upstream of pre-miR399b, translates them into small peptide sequences, synthesizes related small peptides, and subsequent experiments prove that the polypeptide PEP1-2 encoded by Pri-miR399b has the effect of delaying the maturity period of grapes.

[0009] To achieve the above object, the present invention provides an application of a polypeptide encoded by Pri-miR399b in delaying the ripening of grape fruits.

[0010] The beneficial effects of the above technical solution are as follows: The polypeptide PEP1-2 encoded by Pri-miR399b is made into an aqueous solution, and spraying before the grape color-changing period can delay the color change of grapes by 14 days compared with normal grapes, significantly delaying the ripening of grape fruits. This method has the advantages of being green and environmentally friendly, not introducing foreign substances, and having high efficiency and accuracy.

[0011] Preferably, a solution containing the PEP1-2 polypeptide is applied before the grape color-changing period.

[0012] More preferably, the concentration of the PEP1-2 polypeptide in the solution containing the PEP1-2 polypeptide is 0.2 μM.

[0013] More preferably, the solution containing the PEP1-2 polypeptide is composed of the PEP1-2 polypeptide, a surfactant, and water, and the surfactant is Silwet L-77.

[0014] More preferably, the volume concentration of the surfactant is 0.01%.

[0015] Preferably, the application method is: spraying once 10 - 15 days before the grape color-changing period, and conducting a second spraying 4 - 5 days after the first spraying.

[0016] More preferably, the application method is: spraying once 10 days before the grape color-changing period, and conducting a second spraying 4 days after the first spraying.

[0017] More preferably, the application amount is 50 mL of the solution containing the PEP1-2 polypeptide for single cluster of grapes.

[0018] Preferably, the grape variety is 'Kyoho' grape. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is the distribution diagram of the polypeptide, pre-miR399b, and miR399b on Pri-miR399b in the embodiment of the present invention;

[0020] Figure 2 It is the primer position diagram of the three polypeptides for detecting Pri-miR399b in the embodiment of the present invention;

[0021] Figure 3 It is the electrophoresis diagram for verifying the sequence expression of the encoded polypeptide in the embodiment of the present invention;

[0022] Figure 4 It is the field treatment result of the three polypeptides of Pri-miR399b in the embodiment of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0023] The present invention mainly aims at the lack of healthy and pollution-free methods for regulating the ripening period of grapes in the prior art, and the inability to ensure the time-divided supply of safe fresh fruits. A polypeptide PEP1-2 encoded by Pri-miR399b is provided. An aqueous solution prepared from PEP1-2 can delay the color change of grapes by 14 days compared with normal grapes when applied before the color change period of grapes, and can significantly delay the ripening of grape fruits. The method has the advantages of high efficiency and accuracy. In addition, the PEP1-2 polypeptide is a substance synthesized by the grapes themselves, which is safe and environmentally friendly and has the advantage of not introducing exogenous substances.

[0024] The technical solution of the present invention is further described below in conjunction with specific embodiments.

[0025] 1. Specific embodiments of a polypeptide encoded by Pri-miR399b of the present invention

[0026] Example 1

[0027] Analysis and identification of orf on pri-miR399b in 'Kyoho' grape

[0028] With reference to the grape genome (PN 40024) included in the Ensemble-plants (https: / / plants.ensembl.org / index.html) website, based on the sequence information of miR399b (TGCCAAAGGAGAGTTGCCCTG) and its precursor (pre-miR399b) information (ATCAATCATAGGGCACCTCTTTCTTGGCAGGCACTGGCTCCTATATATGAATAT ACATAGCTTAGCTGCAGTAAAAAGATGTGACTTGCCAAAGGAGAGTTGCCCTGTGACTG CTTC, a total of 117 bp), its position on the chromosome was located (Chr.16:17130164-17130275, a total of 111 bp), and based on the position information of pre-miR399b, the open reading frames (orfs) in the upstream 600 bp sequence were analyzed (Chr.16:17129558-17130164, a total of 606 bp). Figure 1 As shown, there are three orf segments on pri-miR399b, which are named as: PEP1-1, PEP1-2, and PEP2-1, respectively. The amino acid sequence of PEP1-2 is shown in SEQ ID NO.1, the amino acid sequence of PEP1-1 is shown in SEQ ID NO.2, and the amino acid sequence of PEP2-1 is shown in SEQ ID NO.3.

[0029] Example 2

[0030] Verify the existence of the three ORFs of pri-miR399b

[0031] According to the sequence information of the three predicted polypeptides, corresponding primers were designed. The primer sequences of PEP1-1, PEP1-2, and PEP2-1 are shown in SEQ ID NO.4 to SEQ ID NO.9. Among them, the upstream primer is the starting position of the polypeptide coding, and the downstream primer is the sequence immediately upstream of pre-miR399b, as Figure 2 shown. Using the cDNA of 'Kyoho' grape as a template for PCR amplification, the reaction system used is a 20 μl system, in which 10 μl of ThermoFisher taq enzyme mix, 1 μl of each upstream and downstream primer, 1 μl of template cDNA, and 7 μl of water are used. The program used is pre-denaturation at 94 °C for 3 minutes, (94 °C for 30 seconds, 55 °C for 30 seconds, 72 °C for 30 seconds) for 30 cycles, extension at 72 °C for 5 minutes, and cooling to 25 °C to end. After PCR, the electrophoresis results are as Figure 3 shown, and the sizes of the three polypeptide sequences are in line with expectations.

[0032] II. Specific examples of the application of a polypeptide encoded by Pri-miR399b of the present invention in delaying the ripening of grape fruits

[0033] Example 3

[0034] 'Kyoho' grape field treatment experiment

[0035] Select 40 bunches of 'Kyoho' grapes with consistent growth status in the grape resource nursery of Henan University of Science and Technology, and hang four labels of PEP1-1, PEP1-2, PEP2-1, and CK (control group) respectively (5 bunches for each label). The three polypeptides of PEP1-1, PEP1-2, and PEP2-1 were synthesized by Sangon Biotech Co., Ltd. The molecular weights of PEP1-1, 1-2, and 2-1 are 1987.4, 3892.5, and 2493.1 respectively. The mass of the synthesized polypeptides is 5 mg each. The three polypeptides were dissolved in 2.52 ml, 1.3 ml, and 2 ml of water respectively to obtain 1000 μmol / L mother liquors. Take 200 μl of the mother liquor and make up to 1 L of water to obtain a 0.2 μmol / L working solution. Add 100 μl of Silwet L-77 to 1 L of the working solution to obtain a spraying solution. The CK control group is pure water containing 0.01% surfactant Silwet L-77. Spray the grape fruits twice before the color change period of the 'Kyoho' grape fruit development, 10 days before (June 25, 2023) and 4 days later, that is, 5 days before the color change period (June 30, 2023). Each time, spray 50 mL of the spraying solution, and observe the color change of the grapes.

[0036] The results are as Figure 4As shown in the figure, the grape color change of the method in Example 3 was tracked and observed. The results showed that after the grapes in the CK group changed color, the grapes in the PEP1-2 treatment group began to initially change color after 14 days, and the maturity period was significantly delayed; while there was no difference or little difference in the color change time between the grapes in the PEP1-1 and PEP2-1 treatment groups and the grapes in the CK group. From this, it was concluded that the aqueous solution of PEP1-2 polypeptide had a delaying effect on the ripening of grape fruits.

Claims

1. A polypeptide encoded by Pri-miR399b, characterized in that: The polypeptide encoded by the Pri-miR399b is PEP1-2, and the amino acid sequence of PEP1-2 is shown in SEQ ID NO.

1.

2. Use of the polypeptide encoded by Pri-miR399b as claimed in claim 1 in delaying the ripening of grape fruit.

3. The use of the polypeptide encoded by Pri-miR399b according to claim 2 in delaying the ripening of grape fruit, characterized in that: The solution containing the PEP1-2 polypeptide is applied before the grapes change color.

4. The use of the polypeptide encoded by Pri-miR399b according to claim 3 in delaying the ripening of grape fruit, characterized in that: The concentration of the PEP1-2 polypeptide in the solution containing the PEP1-2 polypeptide is 0.2 μM.

5. The use of the polypeptide encoded by Pri-miR399b according to claim 4 in delaying the ripening of grape fruit, characterized in that: The solution containing PEP1-2 polypeptide consists of PEP1-2 polypeptide, surfactant and water, and the surfactant is Silwet L-77.

6. The use of the polypeptide encoded by Pri-miR399b according to claim 5 in delaying the ripening of grape fruit, characterized in that: The volume concentration of the surfactant is 0.01%.

7. The use of the polypeptide encoded by Pri-miR399b according to claim 3 in delaying the ripening of grape fruit, characterized in that: The application method is: spraying once 10 to 15 days before the grape color change period, and spraying a second time 4 to 5 days after the first spraying.

8. The use of the polypeptide encoded by Pri-miR399b according to claim 7 in delaying the ripening of grape fruit, characterized in that: The application method is: spraying once 10 days before the grape color change period, and spraying the second time 4 days after the first spraying.

9. The use of the polypeptide encoded by Pri-miR399b according to claim 8 in delaying the ripening of grape fruit, characterized in that: The application amount is 50 mL of the solution containing the PEP1-2 polypeptides for each bunch of grapes.

10. The use of the polypeptide encoded by Pri-miR399b in delaying the ripening of grape fruit according to claim 2, characterized in that: The grape variety is 'Kyoho' grape.