Application of congenital non-ocular / microphthalmia related protein MAB21L1

Abstract

The invention relates to an application of a congenital non-ocular / microphthalmia related protein MAB21L1. The deletion and mutation of the MAB21L1 gene can cause non-ocular / microocular deformity. Specifically, the R51 site of the MAB21L1R51W mutant protein cannot form a salt bridge network with E49 and E115 sites, the protein stability is reduced, the MAB21L1R51W mutant protein is easily degraded by ubiquitin-proteasome, the expression of a key regulatory factor PAX6 for eye development cannot be promoted, and finally, the anophthalmia / microphthalmia is caused. An MAB21L1R51W human mutant cell strain and a zebra fish model are constructed based on a CRISPR / Cas9 technology, so that in-vivo and in-vitro combined research on an action mechanism of specific gene point mutation in eye development and diseases becomes possible, and a regulation mechanism of eye development diseases can be better understood; a new screening target is provided for antenatal molecular diagnosis of congenital azoopia / ommatidium diseases, and the method has positive practical significance.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to an application of a congenital anophthalmia / microphthalmia-related protein MAB21L1. Background Art

[0002] Anophthalmia / microphthalmia (A / M) is a rare congenital developmental ophthalmological disease that causes vision loss in patients and has no effective treatment strategy. Prenatal counseling and molecular diagnosis are currently effective measures to reduce the incidence of the disease, and exploring and revealing the expression and mechanism of related genes in the process of eye development will provide strong preclinical evidence for prenatal diagnosis of A / M.

[0003] Gene mutation is an important cause of microphthalmia. Currently, there are more than 80 genes that have been identified as being associated with the onset of A / M. Exploring new genes that play an important role in the development of the eye will not only reveal important molecular mechanisms that regulate eye development, but may also provide new detection or treatment targets. This is an important scientific issue that needs to be explored in the study of eye-related diseases. For example, patent CN104450871B provides gene mutations associated with microphthalmia and anophthalmia, their detection methods, and their uses. The gene mutations are mutated ALDH1A3 genes or ALDH1A3 proteins: c.521G>A, p.Cys174Tyr. Patent CN103820548B relates to the use of myosin XVIIIA (MYO18A) in the preparation of genetic diagnostic products for detecting congenital microphthalmia, providing a new use of the MYO18A gene, thereby providing a way to conduct genetic diagnosis of CMIC disease, prenatal genetic screening and genetic counseling. The application results show that the SNP sites and detection primers of the gene can be used for rapid detection of MYO18A gene mutation sites in clinical patients and fetal villi or amniotic fluid.

[0004] In the early stage of this invention, whole exome sequencing technology was used to study the pedigree of patients with congenital anophthalmia and screened out the potential pathogenic gene MAB21L1 R51W Site mutation. Studies have shown that the MAB21L1 gene is very important in the process of eye development. Mutation of this gene is an important cause of congenital anophthalmia / microphthalmia, but the related molecular mechanism has not yet been systematically studied. Summary of the invention

[0005] Based on the above-mentioned drawbacks existing in the prior art, the purpose of this application is to provide an application of the congenital anophthalmia / microphthalmia-related protein MAB21L1. In this application, MAB21L1 represents the human congenital anophthalmia / microphthalmia-related protein, and MAB21L1 represents the human congenital anophthalmia / microphthalmia-related gene; Mab21l1 represents the zebrafish congenital anophthalmia / microphthalmia-related protein, and mab21l1 represents the zebrafish congenital anophthalmia / microphthalmia-related gene.

[0006] The purpose of the present invention can be achieved by the following technical solutions:

[0007] One of the technical solutions of the present invention provides an application of the congenital anophthalmia / microphthalmia-related protein MAB21L1. The amino acid sequence of the congenital anophthalmia / microphthalmia-related protein MAB21L1 is shown as SEQ.ID.No.18. The gene corresponding to the congenital anophthalmia / microphthalmia-related protein MAB21L1 is MAB21L1; the deletion and mutation of the gene MAB21L1 will lead to anophthalmia / microphthalmia.

[0008] Furthermore, the application includes: serving as a detection molecular index for clinically screening congenital anophthalmia / microphthalmia fetuses, preparing a kit for screening congenital anophthalmia / microphthalmia, preparing a drug for treating / saving congenital anophthalmia / microphthalmia, screening a drug for treating / saving congenital anophthalmia / microphthalmia, and constructing an animal model of congenital anophthalmia / microphthalmia.

[0009] Furthermore, the mutant MAB21L1 of the congenital anophthalmia / microphthalmia-related protein MAB21L1 R51W At the R51W site of the mutant protein (the amino acid R at position 51 is mutated to the amino acid W), it is unable to form a salt bridge network with the E49 and E115 sites, the protein stability is reduced, it is easily degraded by the ubiquitin-proteasome, and it is unable to promote the expression of the key regulatory factor PAX6 for eye development, ultimately leading to anophthalmia / microphthalmia.

[0010] Furthermore, the key regulatory factor PAX6 for eye development (OMIM: *607108) is a member of the paired box gene family, highly conserved in multiple species, crucial for the normal development of the eyes and central nervous system, and its loss of function is related to various congenital eye abnormalities. There are research reports that PAX6 is a key node in the gene regulatory network related to mammalian lens development, its mutation will inhibit lens development and lead to a microphthalmia phenotype, and its compound heterozygous mutation can lead to a rare phenotype of bilateral anophthalmia with severe brain and craniofacial defects.

[0011] Furthermore, the expression of the regulatory factor PAX6 is affected by MEIS2 (OMIM: *601740). MEIS2 homologous proteins can directly regulate the expression of PAX6, a key molecule in eye development, during the morphological development of the vertebrate lens. The MEIS2 belongs to the members of the MEIS homeobox family and can affect eye development by regulating cell proliferation and apoptosis. Existing studies have shown that MEIS mutants with loss of function can cause microphthalmia phenotypes in medaka fish. Studies have shown that MEIS2 can bind to a specific 26-bp sequence in the promoter region of the PAX6 gene, thereby enhancing the transcriptional activity of the PAX6 promoter and promoting the expression of the PAX6 gene.

[0012] Furthermore, the MAB21L1 protein and MAB21L1 R51W mutant proteins can both bind to the MEIS2 protein; however, the MAB21L1 protein can promote PAX6 expression, while the stability of the MAB21L1 R51W mutant protein is reduced and it is easily degraded by the ubiquitin-proteasome and cannot promote PAX6 expression.

[0013] The second technical solution of the present invention provides a drug for treating congenital anophthalmia / microphthalmia caused by MAB21L1 gene mutation or deletion, based on the application of the above-mentioned congenital anophthalmia / microphthalmia-related protein MAB21L1 and its mutant MAB21L1 R51W The active ingredient of the drug is any one of a PAX6 gene expression promoter, an MAB21L1 protein stabilizer, or an MAB21L1-MEIS2 conjugate stabilizer. The drug also includes pharmaceutically acceptable excipients.

[0014] The third technical solution of the present invention provides a method for constructing a zebrafish model of eye developmental malformation. The zebrafish model of eye developmental malformation is constructed by knocking out the mab21l1 gene. The zebrafish model requires oligonucleotides synthesized according to the primer sequences shown in SEQ.ID.No.1 to 4 to be transcribed in vitro into gRNA to target the zebrafish mab21l1 gene. The steps of the construction method are as follows:

[0015] 1) According to the primers (primer) shown in SEQ.ID.No.1 to 4 and the scaffold primer shown in SEQ.ID.No.5, synthesize 4 oligonucleotides (oligo) targeting the zebrafish mab21l1 gene, amplify by PCR, purify and recover the DNA, transcribe in vitro into gRNA, remove the DNA, and obtain 4 gRNAs targeting the zebrafish mab21l1 gene after purification;

[0016] 2) Mix the 4 gRNAs obtained in step 1) with Cas9 protein at a ratio of 4:1 evenly, and microinject them into wild-type zebrafish embryos before the two-cell stage;

[0017] 3) Culture the above zebrafish embryos in an incubator at 28.5 °C to obtain a zebrafish model with eye development malformations.

[0018] The fourth technical solution of the present invention provides a method for constructing a zebrafish model for rescuing eye development malformations, which uses mab21l1 mRNA to rescue the mab21l1 gene of zebrafish with eye development malformations. The zebrafish model contains the mixture of 4 gRNAs and Cas9 protein described in the third technical solution, and zebrafish-derived mab21l1 mRNA; the steps of the construction method are as follows:

[0019] 1) According to the primers shown in SEQ.ID.No.1-4 and the scaffold primer sequence shown in SEQ.ID.No.5, synthesize 4 oligonucleotides targeting the zebrafish mab21l1 gene, amplify by PCR, purify and recover DNA, transcribe in vitro into gRNA, remove DNA, and after purification, obtain 4 gRNAs targeting the zebrafish mab21l1 gene; mix the above 4 gRNAs with Cas9 protein evenly at a ratio of 4:1 for standby;

[0020] 2) Amplify the mab21l1 cDNA sequence of zebrafish from zebrafish cDNA, after homologous recombination of the mab21l1 cDNA sequence with the linearized overexpression vector PXT7, obtain the overexpression vector of zebrafish mab21l1, and transcribe it in vitro into mab21l1 mRNA for standby;

[0021] 3) Inject the mixture of 4 gRNAs and Cas9 protein in step 1) into zebrafish embryos, and inject mab21l1 mRNA again before the two-cell stage, and after culture, obtain a zebrafish model with rescued eye development malformations.

[0022] The fifth technical solution of the present invention provides a method for constructing a human lens epithelial cell model with overexpression of the MAB21L1 gene. The human lens epithelial cell model is constructed by the overexpression vector of the MAB21L1 described above. The construction method is as follows:

[0023] 1) Amplify the MAB21L1 cDNA sequence of human lens epithelial cells from the cDNA of human lens epithelial cells, and after ligating the MAB21L1 cDNA sequence with the linearized PIRES overexpression vector using T4 ligase, obtain the overexpression vector of MAB21L1;

[0024] 2) Transfect the overexpression vector obtained in 1) into human lens epithelial cells. After adding G418 antibiotic for screening and culturing for four weeks, sort the EGFP-positive cells by flow cytometry to obtain a human lens epithelial cell model with overexpression of MAB21L1.

[0025] The sixth technical solution of the present invention provides a method for constructing a human lens epithelial cell model with knockdown of the MAB21L1 gene. The cell model is constructed by a knockdown vector obtained by the primer sequences as described in SEQ.ID.No.6-9. The steps of the construction method include:

[0026] 1) Synthesize oligonucleotides specifically targeting the MAB21L1 gene of human lens epithelial cells according to the primer sequences shown in SEQ.ID.No.6-9. After annealing the oligonucleotides by PCR to form double strands, ligate them with the linearized PLKO.1 vector to obtain a MAB21L1 knockdown vector; wherein, the sequence of the oligonucleotide is complementary to the targeted sequence.

[0027] 2) After packaging the knockdown vector obtained in 1) with a lentiviral vector helper vector and measuring the titer, infect human lens epithelial cells at a titer of MOI = 100, and add puromycin for screening for 4 weeks to obtain a human lens epithelial cell model with knockdown of MAB21L1. Subsequently, extract cell RNA and protein to detect the knockdown efficiency of MAB21L1.

[0028] The seventh technical solution of the present invention provides a method for constructing a human lens epithelial cell model with knockout of the MAB21L1 gene. The cell model is constructed by a knockout vector obtained by the primer sequences as described in SEQ.ID.No.10-13. The steps of the construction method include:

[0029] 1) Synthesize oligonucleotides (oligo) targeting the MAB21L1 gene of human lens epithelial cells according to the primer sequences as described in SEQ.ID.No.10-13. After annealing them by PCR to form double strands, ligate them with the linearized puro-scramble-gRNA vector; wherein, SEQ.ID.No.10 is a negative control.

[0030] 2) Co-transfect the constructed puro-scramble-gRNA vector in 1) and the Cas9-blast vector into human lens epithelial cells, and add puromycin and blasticidin for screening for 3 days to obtain double-resistant cells.

[0031] 3) Sort the double-resistant cells in step 2) into a 96-well plate by flow cytometry, with one cell in each well; expand the monoclonal cells and extract genomic DNA for sequencing, and screen for monoclonal strains with MAB21L1 gene knockout, which are the human lens epithelial cell models with MAB21L1 gene knockout.

[0032] The eighth technical solution of the present invention provides a method for constructing a human lens epithelial cell model with MAB21L1 R51W site mutation, and the cell model is constructed by a vector constructed with the primer sequences as described in SEQ.ID.No.13-15 and short single-stranded oligonucleotides as described in SEQ.ID.No.16-17. The steps of the construction method include:

[0033] 1) According to the primer sequences as described in SEQ.ID.No.13-15, synthesize oligonucleotides (oligo) targeting near the 151st site of the MAB21L1 gene in human lens epithelial cells, which form double strands after PCR annealing and are ligated to the linearized gRNA-Cas9-EGFP vector; the 151st site of the MAB21L1 gene corresponds to the 51st site of the protein.

[0034] 2) Chemically synthesize short single-stranded oligonucleotides as described in SEQ.ID.No.16-17, and the short single-stranded oligonucleotides can be used as homologous recombination repair donors to generate MAB21L1 R51W point mutations on the human genome; further, endotoxin treatment is performed on the short single-stranded oligonucleotides and they are reserved for use.

[0035] 3) Co-transfect the constructed gRNA-Cas9-EGFP vector in step 1) and the short single-stranded oligonucleotides synthesized in step 2) into human lens epithelial cells, and add puromycin to screen the cells for 3 days;

[0036] 4) Sort the resistant cells in step 3) into a 96-well plate by flow cytometry, with one cell in each well, expand the monoclonal cells and extract genomic DNA for sequencing, and screen for MAB21L1 R51W mutant monoclonal strains, which are the human lens epithelial cell models with MAB21L1 R51W site mutation.

[0037] Compared with the prior art, the present invention has at least the following advantages:

[0038] (1) The present invention studies a protein MAB21L1 related to congenital anophthalmia / microphthalmia, and the protein MAB21L1 R51WThe type mutation reduces the stability of the protein, making it vulnerable to degradation by the ubiquitin-proteasome pathway. This further prevents it from binding to the MEIS2 protein and translocating to the nucleus, thereby inhibiting the expression of the key eye development factor PAX6 and ultimately leading to eye developmental malformations.

[0039] (2) The present invention constructs a human-derived mutant cell line and a zebrafish model of MAB21L1 based on the CRISPR / Cas9 technology, making it possible to study the mechanism of action of specific gene point mutations in eye development and diseases by combining in vivo and in vitro research. This will contribute to a better understanding of the regulatory mechanism of eye developmental diseases and provide new screening targets for prenatal molecular diagnosis of congenital anophthalmia / microphthalmia diseases, having positive practical significance. R51W The type mutation reduces the stability of the protein, making it vulnerable to degradation by the ubiquitin-proteasome pathway. This further prevents it from binding to the MEIS2 protein and translocating to the nucleus, thereby inhibiting the expression of the key eye development factor PAX6 and ultimately leading to eye developmental malformations. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 . Whole exome sequencing results of patients with congenital anophthalmia malformation, where Figure 1 A: List of dominant mutant genes from whole exome sequencing of patients with congenital anophthalmia malformation; Figure 1 B: Intersection of dominant mutant genes from whole exome sequencing of patients with congenital anophthalmia malformation with lens-enriched genes in the iSyTE database (iSyTE-Home); Figure 1 C: Specific mutation site of the MAB21L1 gene in patients with congenital anophthalmia malformation: mutation at site 151 (c.151C>T, p.R51W); Figure 1 D: High conservation of the MAB21L1 protein (especially at site R51) sequence in multiple organisms;

[0041] Figure 2 . Expression distribution of the Mab21l1 protein at different developmental stages of zebrafish; in the figure, midbrain is the midbrain, hindbrain is the hindbrain, lens is the lens, and retina is the retina;

[0042] Figure 3. Microinjection-mediated knockout of the mab21l1 gene leads to eye malformations in zebrafish; Figure 3 includes Figure 3A 、 Figure 3B , where Figure 3A : Sanger sequencing validates the knockout efficiency of the mab21l1 gene in the zebrafish genome; Figure 3B : Zebrafish in the mab21l1 gene knockout group show eye malformations;

[0043] Figure 4. Microinjection of mab21l1 mRNA rescues the microphthalmia phenotype of mab21l1-KO zebrafish; Figure 4 includes Figure 4A 、 Figure 4B 、 Figure 4C 、 Figure 4D , where Figure 4A: Construct the zebrafish-mab21l1 overexpression vector; Figure 4B : The sanger sequencing results confirmed the successful construction of the vector; Figure 4C : The overexpression vector was linearized and transcribed in vitro into mRNA for microinjection; Figure 4D : While injecting 4gRNA to knockout the mab21l1 gene, mab21l1 mRNA was injected for rescue experiments, significantly reducing the proportion of small eye phenotypes in zebrafish;

[0044] Figure 5. Construct the human-MAB21L1 overexpression cell line; Figure 5 includes Figure 5A 、 Figure 5B 、 Figure 5C 、 Figure 5D ,where Figure 5A : Schematic diagram of the human-MAB21L1 overexpression vector; Figure 5B : The sanger sequencing results confirmed the successful construction of the vector; Figure 5C : qPCR confirmed the successful overexpression of MAB21L1; Figure 5D : Overexpression of MAB21L1 can promote the expression of PAX6;

[0045] Figure 6. Construct the human-MAB21L1 knockdown cell line; Figure 6 includes Figure 6A 、 Figure 6B 、 Figure 6C 、 Figure 6D ,where Figure 6A : Schematic diagram of the human-MAB21L1 knockdown vector; Figure 6B : The sanger sequencing results confirmed the successful construction of the vector; Figure 6C : qPCR confirmed the successful knockdown of MAB21L1; Figure 6D : Knockdown of MAB21L1 can inhibit the expression of key eye development factors such as PAX6 and CRYAB;

[0046] Figure 7. Construct the human-MAB21L1 gene knockout cell line; Figure 7 includes Figure 7A 、 Figure 7B 、 Figure 7C 、 Figure 7D ,where Figure 7A : Schematic diagram of the human-MAB21L1 gene knockout vector; Figure 7B : The sanger sequencing results confirmed the successful construction of the vector; Figure 7C : Genomic DNA was extracted for sanger sequencing to confirm successful knockout; A total of 8 knockout cell lines were successfully constructed, one of which was a large fragment deletion and the rest were frameshift mutations; Figure 7D : Knocking out the MAB21L1 gene can inhibit the expression of key eye development factors such as PAX6 and CRYAB;

[0047] Figure 8. Construction of human-MAB21L1 R51W Mutant cell line; Figure 8 includes Figure 8A , Figure 8B , Figure 8C , Figure 8D , where Figure 8A : human-MAB21L1 R51W Schematic diagram of mutant vector; Figure 8B : Sanger sequencing results confirmed successful vector construction; Figure 8C : Two SSODN sequences as point mutation Donor donors; Figure 8D : Genomic DNA was taken for Sanger sequencing to confirm successful point mutation;

[0048] Figure 9 . Bioinformatics methods and CoIP experiments showed that both MAB21L1 protein / MAB21L1 R51W mutant proteins bind to MEIS2 (a transcription factor of PAX6); Figure 9 including Figure 9 A, Figure 9 B, Figure 9 C, Figure 9 D, Figure 9 E;

[0049] Figure 10 . MAB21L1 R51W mutant protein has reduced stability and is easily degraded by the ubiquitin-proteasome pathway, where Figure 10 A: Bioinformatics methods showed that after the 51st position of the MAB21L1 R51W mutant protein was mutated from arginine to tryptophan, the salt bridge network formed by the R51 site with the E49 site and the E115 site was disrupted, resulting in reduced stability; Figure 10 B: Cycloheximide (CHX) experiment confirmed that the stability of the MAB21L1 R51W mutant protein was reduced; Figure 10 C: Inhibition of the ubiquitin-proteasome pathway (MG132) reduced the protein degradation rate, confirming that the MAB21L1 R51W mutant protein was degraded by the ubiquitin-proteasome pathway; Figure 10 D: Inhibition of the lysosomal autophagy pathway (CQ) did not change the protein degradation rate, confirming that the MAB21L1 R51W mutant protein was not degraded by the autophagy pathway. Specific implementation manners

[0050] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be described in detail below with reference to specific embodiments. It should be noted that the following embodiments will help those skilled in the art to further understand the present invention, but do not limit the present invention in any form. It should be pointed out that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made. These all belong to the protection scope of the present invention.

[0051] There are no special restrictions on the sources of all raw materials of the present invention, and those purchased on the market or prepared according to conventional methods well-known to those skilled in the art are all acceptable.

[0052] Anti-MAB21L1 (Cat#ab154311), Anti-PAX6 (Cat#ab197768), and Anti-MEIS2 (Cat#ab174270) were all purchased from Abcam; zebrafish were donated by Tongji University; the SRA01 / 04 cell line (Cat#YC-A026) was purchased from Yuanjing Biotechnology; cycloheximide (Cat#HY-12320), MG132 (Cat#HY-13259), and Chloroquine (Cat#HY-17589A) were purchased from MCE; TM MEGAscript T7 transcription kit (Cat#AM1333) was purchased from ThermoFisher; 2×Hieff

[0053] Reagent Preparation Instructions: 2% Agarose Gel (50 mL System): Contains 50 mL of 1×TBE and 1 g of agarose. LB (Solid, 1 L System): Contains 10 g of peptone, 5 g of yeast extract, 10 g of NaCl, 10 g of agar, and 1 L of ddH2O. LB (Liquid, 1 L System): Contains 10 g of peptone, 5 g of yeast extract, 10 g of NaCl, 1 L of ddH2O, and 50 mg of antibiotic. Embryo Lysis Solution: Contains 5 μl of protein K and 250 μl of SDS. MAB Solution: Contains 100 mM maleic acid, 150 mM NaCl, made up to 500 mL, pH 7.5. MABT Solution: Contains 40 ml of 10×MAB, 2 ml of 20% Tween, made up to 400 mL. Hybridization Blocking Solution: Dissolve 1 ml of 10% sheep serum and 2 ml of 2% blocking agent in 7 ml of MABT solution. Fab-AP Anti-Digoxigenin Antibody Reaction Solution: Contains 10 ml of hybridization blocking solution and 3.3 μl of antibody. 10% Sheep Serum: Contains 2 ml of sheep serum and 18 ml of MABT. 50% Formamide / 2×SSCT Solution: Contains 10 ml of formamide, 2 ml of 20×SSC, 100 μl of 20% Tween, and 8 mL of ddH2O. AP buffer: 10 mL system, contains 1 ml of 1M 10×Tris, 1 ml of 10×MgCl2, 1 ml of 10×NaCl, 10 μl of 1M levamisole, and 50 μl of 20% Tween. HYB - Solution: Contains 50% formamide, 5×SSC, 0.1% Tween–20. HYB + Solution: Consists of HYB - Solution, 500 μg / ml yeast RNA, and 50 μg / ml heparin. 10% BM Blocking Agent: Contains 10 g of BM blocking reagent and 100 ml of MAB, sterilized by autoclaving. Substrate Staining Solution: Add 1M levamisole at a ratio of 1:200, final concentration is 5 mM.

[0054] In the first stage of the present invention, whole exome sequencing was performed on a family with congenital anophthalmia to screen for potential pathogenic genes and mutation sites of congenital anophthalmia / microphthalmia; then, in situ hybridization technology was used to explore the expression and distribution of Mab21l1 at different developmental stages of zebrafish.

[0055] In the second stage of the present invention, by constructing a mab21l1 gene knockout zebrafish model and a rescue model, the effect of Mab21l1 expression on zebrafish eye development was explored.

[0056] In the third stage of the present invention, by constructing MAB21L1 overexpression / knockdown / knockout and MAB21L1 R51WA human lens epithelial cell model with point mutations was used to explore the regulatory effect of MAB21L1 expression on key molecules in human eye development.

[0057] In the fourth stage of the present invention, the MAB21L1 and mutant MAB21L1 were analyzed by combining bioinformatics and experiments. R51W The specific molecular mechanism for regulating the expression of PAX6, a key molecule in human eye development.

[0058] Specifically, the present invention screened out a potential new mutation MAB21L1 for congenital anophthalmia / microphthalmia through whole exome sequencing technology R51W , a zebrafish model of mab21l1 gene knockout was constructed by CRISPR / Cas9 technology, a human lens epithelial cell line with MAB21L1 overexpression / knockdown was constructed by lentivirus, and a MAB21L1 gene knockout and MAB21L1 gene knockout were constructed by CRISPR / Cas9 technology. R51W The human lens epithelial cell line with point mutation was then tested by qRT-PCR (quantitative reverse transcription polymerase chain reaction) and Western Blot experiments to detect the expression level of MAB21L1 and MAB21L1 R51W Effects of point mutations on key molecules in eye development; simulate and verify MAB21L1 through docking and CoIP experiments R51W The effect of point mutations on the binding ability of MAB21L1-MEIS2; MAB21L1 was simulated and verified by molecular dynamics prediction and protein synthesis inhibitor Cycloheximide R51W The effect of point mutations on protein stability; MAB21L1 was investigated by inhibiting the ubiquitin-proteasome pathway with the proteasome inhibitor MG132 and the lysosomal autophagy inhibitor chloroquine to inhibit the lysosomal pathway. R51W Mutant protein degradation pathway.

[0059] More specifically, the present invention is described in detail with reference to the following embodiments:

[0060] Example 1. Exploration of genes associated with congenital anophthalmia

[0061] (I) Whole exome sequencing of a family with congenital anophthalmia

[0062] (1) DNA library construction and exome sequencing: Skin tissue of the proband was obtained and genomic DNA was extracted. The DNA library was constructed through the main steps of DNA fragmentation, DNA end repair and phosphorylation, 3' end A tail addition, linker ligation, exon capture, PCR amplification, and quality control. Sequencing was performed using the Illumina NovaSeq platform to generate raw sequencing data (FASTQ file).

[0063] (2) Data analysis: After obtaining the whole exome sequencing data (FASTQ files) of the samples feedback from the sequencing company, fastqc and fastp software were used to perform quality control on it, including removing adapters and low-quality bases. Then, the processed sequencing data was aligned to the human reference genome of GRCh37 version using the BWA aligner, and indexing and sorting by chromosome coordinates were performed. The MarkDuplicate program in the Picard tool was used to solve the errors caused by duplicate reads, and the BaseQuality Score Recalibration (BQSR) was used to empirically model the sequencing errors and adjust the quality scores of the original bases accordingly, considering features such as the original quality scores, the positions of the bases, and the context environment. The HaplotypeCaller program of GATK was used to identify candidate variant sites and record them in the VCF file. Finally, a classifier was constructed through the GMM model to perform Variant Quality Score Recalibration (VQSR) quality control on the obtained variant data, evaluate the feasibility of each site, and eliminate false positive results as much as possible. Thus, the somatic variant identification work of this patient was completed. Further, the ANNOVAR software was used to annotate the rsID information of the identified somatic variant results and perform gene annotation to reveal the relationship between the variants and known genes and their functional impacts. In order to obtain more functionally significant variants, the present application screened out the dominant variants located in the exon region and used the genes where they were located as candidate genes.

[0064] The experimental results are as Figure 1 shown: Figure 1 A shows the list of dominant mutant genes in the patient's whole exome sequencing; Figure 1 B shows that only the MAB21L1 gene is highly enriched in the lens among the patient's dominant mutant genes; Figure 1 C shows that the sanger sequencing verifies the whole exome sequencing results, and the results show that there is a mutation at site 151 of the patient's MAB21L1 gene (c.151C>T, p.R51W), and the amino acid at site 51 of the protein is mutated from arginine (R) to tryptophan (W); Figure 1 D shows that the MAB21L1 gene, especially site R51, is highly conserved in multiple organisms.

[0065] (2) In situ hybridization of the expression distribution of Mab21l1 at different developmental stages of zebrafish

[0066] Based on the above sequencing results, in this example, the expression distribution of Mab21l1 at different developmental stages of zebrafish was explored through in situ hybridization technology, and the specific experimental operations are as follows:

[0067] (1) Embryo treatment: Embryos at the 14-somite stage, 1 day, 2 days, and 3 days old (for embryos older than one day, PTU is added to inhibit pigment growth) are de-membraned with protease and then fixed with 4% paraformaldehyde. After standing at room temperature for 2 h, the formaldehyde is aspirated, 100% methanol is added, and the embryos are placed at -20 °C for 2 h for permeabilization. They can be directly subjected to in situ hybridization or stored at -20 °C for a long time.

[0068] (2) Rehydrate the embryos at room temperature: Aspirate 100% methanol, add 50% methanol and shake for 5 min; aspirate 50% methanol, add 25% methanol and shake for 5 min; aspirate 25% methanol, add PBS solution and shake for 5 min, then aspirate the PBS solution.

[0069] (3) Treat the embryos with Proteinase K: Dilute the Proteinase K stock solution at a concentration of 1 dpf - 1 μL, 2 dpf - 2 μL, 3 dpf - 3 μL in PBST to treat the embryos, shake at room temperature on a shaker to permeabilize the embryos, aspirate after 5 min. Add PBST to wash for 5 min and then aspirate.

[0070] (4) Fixation: Add 4% formaldehyde solution and shake at room temperature for 15 min to fix the embryos, then aspirate. Add PBST to wash the embryos for 5 min again, and repeat twice.

[0071] (5) Pre-hybridization: Add 300 μL of preheated HYB - solution, aspirate after a 5-min water bath at 70 °C. Add 300 μL of preheated HYB + solution, perform a 30-min to 1-h water bath at 70 °C, and then aspirate.

[0072] (6) Hybridization: Dilute the digoxigenin probe to 1:20 with HYB + solution in advance and preheat for 5 min to eliminate the secondary structure of the probe. Add the diluted digoxigenin probe, perform an overnight water bath at 70 °C, and recover the probe the next day.

[0073] (7) Wash the probe: Add 50% formamide / 2X SSCT, perform a 30-min water bath at 70 °C, aspirate, and repeat twice. Add 2X SSCT for replacement, perform a 10-min water bath at 70 °C, and aspirate. Add 0.2X SSCT, perform a 30-min water bath at 70 °C, and repeat once. Let it stand at room temperature for 5 min to cool, and then aspirate the solution.

[0074] (8) Antibody binding: Add MABT solution, shake on a shaker for 5 min, aspirate, and repeat once. Add the hybridization blocking solution for blocking, shake on a shaker for 30 min to 1 h, and aspirate. Add the anti-digoxigenin antibody reaction solution (diluted 1:3000), shake on a shaker for 2 h, and then aspirate the solution.

[0075] (9) Wash the antibody: Add 10% sheep serum, shake on a shaker for 30 min, aspirate the solution; add MABT, shake on a shaker for 30 min, aspirate, and repeat twice.

[0076] (10) Add substrate for staining: Add BM purple AP substrate staining buffer, shake at room temperature for 5 min and then aspirate, repeat once.

[0077] (11) Staining: Transfer the embryo into a 24-well cell culture plate with a pipette, add 300 μL of substrate staining solution. Stain at room temperature in the dark, check the staining effect every 30 min. When the staining effect is appropriate, terminate the staining, wash with PBST solution staining buffer for 15 min, repeat twice. Select the embryos with better staining, add about 1 ml of 100% glycerol, mix well on a shaker and take pictures under a microscope. After taking pictures, store the embryos in 4% formaldehyde at 4 °C.

[0078] The results are as Figure 2 shown. At the 14-somite stage (14ss, Figure 2 A), 1 day (1 dpf, Figure 2 B) and 2 days (2 dpf, Figure 2 C) of the embryo, Mab21l1 is mainly expressed in the eyes, midbrain and hindbrain regions; at 3 days (3 dpf, Figure 2 D) of the embryo, the expression of Mab21l1 is mainly concentrated in the midbrain, retina and lens.

[0079] Example 2. Knockout of the mab21l1 gene leads to eye developmental malformations in zebrafish

[0080] The construction of the mab21l1 gene knockout zebrafish includes 2 steps: (i) constructing 4 gRNAs targeting the zebrafish mab21l1 gene and (ii) microinjecting to construct the mab21l1 gene knockout zebrafish, which specifically includes the following steps:

[0081] (i) Construct 4 gRNAs targeting the zebrafish mab21l1 gene

[0082] (1) Design and synthesize 4 sgRNAs (sg-1, sg-2, sg-3, sg-4) specifically targeting the zebrafish mab21l1 gene and scaffold primer and perform PCR amplification. The sequences are shown in Table 1:

[0083] Table 1. Sequences of 4 gRNAs targeting the zebrafish mab21l1 gene and scaffold primer sequences

[0084]

[0085] The primers synthesized in Table 1 were subjected to PCR amplification according to the following reaction system (200 μL) and procedure: 0.5 μL each of sg-1, sg-2, sg-3, and sg-4 with a concentration of 100 μM were taken, 2 μL of scaffold primer was added, 100 μL of 2x Q5 PCR mix, and finally the system was made up to volume with 96 μL of ddH2O to form a complete PCR reaction system. The procedure was as follows: pre-denaturation at 98 °C for 2 min (1 cycle); then denaturation at 98 °C for 20 s, annealing at 60 °C for 20 s, and extension at 72 °C for 15 s (30 cycles); then final extension at 72 °C for 2 min (1 cycle); and finally storage at 4 °C for an indefinite period (1 cycle).

[0086] Prepare a 2% agarose gel and use it after it solidifies. After the PCR reaction, use a 10 μL pipette to aspirate 5 μL from 200 μL of the PCR product, add 1 μL of 6× loading buffer, gently flick the tube wall to mix it evenly, and then load the sample. Use 4 μL of DL 1000 DNA marker as a control. Electrophoresis was carried out in 0.5× TBE buffer at a voltage of 125 V for 30 min. After electrophoresis, observe and photograph it on an ultraviolet irradiation table. After seeing the target band, recover the remaining 190 μL of the PCR product and measure its concentration.

[0087] (2) In vitro transcription to synthesize 4gRNA

[0088] The above DNA recovery product was subjected to in vitro transcription according to the following system (total volume 20 μL): no more than 6 μL (3 μg) of the PCR recovery product, 8 μL of RNA free water, 2 μL of 10x transcription buffer, 2 μL of rNTP Mix, 0.5 μL of 1 mM DTT, 0.5 μL of Rnasin, and 1 μL of T7 RNA Polymerase.

[0089] After mixing the above reaction system, carry out in vitro transcription at 37 °C for 2 h. Then add 1 μL of Dnase and react at 37 °C for 15 min to remove the DNA template. Finally, take 1 μL of the final product and perform 2% agarose gel electrophoresis to detect the in vitro transcription effect.

[0090] (3) Purify 4gRNA

[0091] Add 80 μL of RNA iso to the above 20 μL reaction product and mix well by shaking. Then add 20 μL of chloroform, shake well to emulsify, and let it stand at room temperature for 5 min. At this time, the organic phase and the inorganic phase can be seen to separate. After centrifugation at 12000 rpm at 4 °C for 15 min, carefully aspirate the supernatant (RNA layer) into a new centrifuge tube.

[0092] Add an equal volume of isopropanol to a new centrifuge tube, gently invert to mix, and let stand at -20°C for more than 2 h. Then centrifuge at 12,000 rpm at 4°C for 10 min, discard the supernatant, and a white precipitate can be seen at the bottom of the centrifuge tube at this moment. Add 500 μL of 80% ethanol for rinsing, discard the supernatant, centrifuge again at 12,000 rpm at 4°C for 5 min, aspirate and remove the residual ethanol, place in a ventilated place to dry for 10 min, and finally add 10 μL of RNA-free water to dissolve the precipitate.

[0093] Aspirate 1 μL of the product for electrophoresis, and use a nanodrop to detect the concentration and absorbance of the RNA product, ensuring that the concentration is above 400 ng / μL and the 260 / 280 ratio is between 1.8 and 2.0. Finally, add 2.5 μL of Cas9 protein, mix well, and store at -80°C for later use.

[0094] (II) Microinjection to construct mab21l1 gene knockout zebrafish

[0095] Perform breeding the night before injection. Pair male and female fish at a ratio of 1:1 and place them in a breeding box filled with water, separated by a partition between the male and female. Prepare the injection plate.

[0096] Before injection, place the injection needle under the microscope, cut it with a blade at a suitable thickness for opening the needle. Take 0.5 μL of the purified sgRNA+Cas9 protein mixture in the above (1)-(3) and fill it into the injection needle under the microscope using a disposable syringe. Transfer the injection needle to the needle holder and adjust the droplet size to a diameter of 0.1 mm.

[0097] Open the partition in the fish mating box for breeding. After the fish lay eggs for 10-15 min, collect the fish eggs onto the injection plate for injection. It should be noted that the injection should be completed before the embryo enters the two-cell stage (within about 45 min after egg laying). After injection, transfer the embryos into a 10 cm dish and culture them in an incubator at 28.5°C.

[0098] Six hours after injection, pick out unfertilized embryos and dead embryos under the microscope. At 3 dpf after injection, randomly pick some fish to extract genomic DNA for knockout efficiency identification ( Figure 3A ). Observe the subsequent eye phenotypes at 3 dpf. The results show that after microinjecting and knocking out the mab21l1 gene in zebrafish, the eye development is deformed ( Figure 3B ), indicating that the mab21l1 gene plays an important role in the eye development process of zebrafish.

[0099] Example 3. mab21l1 mRNA can rescue the eye malformation of knockout zebrafish

[0100] Construction of the mab21l1 mRNA rescue zebrafish model in this example includes (i) in vitro transcription and synthesis of zebrafish mab21l1 mRNA and (ii) microinjection to construct the mab21l1 rescue zebrafish. The specific steps are as follows:

[0101] (i) In vitro transcription and synthesis of zebrafish mab21l1 mRNA

[0102] (1) Construction of the zebrafish mab21l1 overexpression vector

[0103] Extract total RNA from zebrafish and reverse transcribe it into cDNA. Use the cDNA as a template for PCR amplification to obtain the zebrafish mab21l1 cDNA sequence. The specific amplification system is as follows: 2 μL of z-mab21l1-Fw with a concentration of 10 μM (primer sequence: aactttggcagatcggtaccatgatcgccgcccaggcc), 2 μL of z-mab21l1-Rv with a concentration of 10 μM (primer sequence: cctgaacctgatccagaaccgagtttctccaagcttttagggtt), 1 μL of cDNA, 25 μL of 2x Q5 PCRmix, and 20 μL of ddH2O.

[0104] After mixing the above PCR reaction system, perform amplification according to the following program: first pre-denature at 98 °C for 2 min (1 cycle); then denature at 98 °C for 20 s, anneal at 60 °C for 20 s, and extend at 72 °C for 90 s (35 cycles); then perform a final extension at 72 °C for 10 min (1 cycle); finally, store at 4 °C for an infinite time (1 cycle).

[0105] Prepare a 1% agarose gel and use it after it solidifies. After the PCR reaction, use a 10 μL pipette to aspirate 5 μL from 50 μL of the PCR product, add 1 μL of 6×loading buffer, gently flick the tube wall to mix it evenly, and then load the sample. Use 4 μL of DL 2000 DNA marker as a control. Electrophorese in 0.5×TBE buffer at a voltage of 125 V for 30 min. After electrophoresis, observe and take pictures on the ultraviolet irradiation table. After seeing the target band, recover the remaining 45 μL of the PCR product and measure its concentration.

[0106] Mix the above DNA product with the linearized PXT7 vector ( Figure 4A ) according to the following reaction system: 10 μL of 2×Hieff Universal Enzyme Premix, (4000 / concentration) μL of linearized vector, (1080 / concentration) μL of mab21l1 DNA product, supplemented with ddH2O to 20 μL; subject the above system to homologous recombination at 50 °C for 5 min, then transform the recombinant product into DH5α and plate (ampicillin resistance), pick single colonies for colony PCR identification after 16 h, select positive bacterial liquid for sanger sequencing (dideoxy sequencing method), and correct sequences indicate successful vector construction( Figure 4B ), and subsequent preservation of the strain and plasmid extraction.

[0107] (2) In vitro transcription to synthesize mab21l1 mRNA

[0108] Use MEGAscript TM T7 transcription kit to transcribe the above vector plasmid into mRNA for standby in vitro, and the specific steps are not elaborated here. Prepare 1% agarose gel and use it after solidification. After in vitro transcription, use a 10 μL pipette to aspirate 1 μL from the above in vitro transcription product, add 1 μL of 6×loading buffer, flick the tube wall to mix it evenly and then load the sample, and use 4 μL of DL 2000 DNA marker as a control. Electrophorese at a voltage of 125 V for 30 min in 0.5×TBE buffer. After electrophoresis, observe and take pictures on the ultraviolet irradiation table. The 1080 bp electrophoretic product is the target mRNA band( Figure 4C ).

[0109] (II) Microinjection to construct mab21l1 rescued zebrafish

[0110] The microinjection method is similar to the above-mentioned construction steps of knockout zebrafish and will not be elaborated here. In particular, after injecting 4 gRNA to knockout the mab21l1 gene of zebrafish, perform a rescue experiment by secondary injection (completed before the two-cell stage) of mab21l1 mRNA to observe the eye phenotypes of zebrafish. The results show that after the rescue experiment, the proportion of small eyes in zebrafish is significantly reduced( Figure 4D ), indicating that mab21l1 can rescue the small eye malformation of zebrafish.

[0111] Example 4. Overexpression of MAB21L1 gene promotes the expression of PAX6, a key factor for human eye development

[0112] (I) Construction of a human MAB21L1 gene overexpression vector

[0113] Total RNA of human lens epithelial cells was extracted and reverse-transcribed into cDNA. Using the cDNA as a template, PCR amplification was performed with the following primer sequences (Table 2) to obtain the human MAB21L1 cDNA sequence. The specific amplification system and PCR reaction procedure were the same as in Example 3(1) and will not be repeated here.

[0114] Table 2. Primer sequences of human MAB21L1

[0115] Primer name Primer sequence h-MAB21L1-Fw acgcGTCGACATGATTGCGGCCCAGGCCAA h-MAB21L1-Rv cgcGGATCCttaAAGTTTTTCCAAACTTTTCGGG

[0116] After the above DNA products were identified by agarose gel electrophoresis, purified and recovered, they were mixed with the vector ( Figure 5A ) according to the following system: 1 μg DNA product / vector, 1 μL SalⅠ endonuclease, 1 μL BamHⅠ endonuclease, 5 μL cutsmart buffer, and made up to 50 μL with ddH2O; the system was digested at 37 °C for 3 h.

[0117] After the above digested products were purified and recovered by agarose gel electrophoresis, they were mixed according to the following system: 50 ng linearized vector after digestion, 15 ng DNA product after digestion, 1 μL T4 ligase, 2 μL 10× ligase buffer, and made up to 20 μL with ddH2O. Then the ligation reaction was carried out at 16 °C for 16 h.

[0118] After that, the ligation products were transformed into DH5α and plated (kanamycin resistance). After 16 h, single colonies were picked for colony PCR identification, and positive bacterial solutions were selected for sanger sequencing. If the sequence was correct, it indicated that the vector construction was successful ( Figure 5B ), and subsequent preservation of the strain and plasmid extraction (as an overexpression vector) were carried out.

[0119] (2) Construction of a stable transfected cell line of human lens epithelial cells overexpressing MAB21L1

[0120] (1) Resuscitation of human lens epithelial cells (SRA01 / 04): The cells in the liquid nitrogen tank were taken out and transferred to a 37 °C water bath, and the cryopreservation tube was gently shaken. When there was still a small amount of crystal in the tube, it was taken out, disinfected with 75% ethanol, and transferred to a laminar flow hood; all the cell suspension in the cryopreservation tube was transferred to a 15 mL centrifuge tube containing 4 mL of complete medium; centrifuged at 1000 rpm for 5 min, and the centrifuge tube was disinfected with 75% ethanol and transferred to the laminar flow hood; the supernatant was discarded, and the cell pellet was resuspended with complete medium; the complete medium in the six-well plate was aspirated, and the SRA01 / 04 cells were transferred to a six-well plate culture dish and placed in a cell incubator.

[0121] (2) Plasmid transfection: When the density of SRA01 / 04 cells reaches 60%-70%, transfect the plasmid constructed in step (i) into SRA01 / 04 cells. After 8 h, change the medium and continue culturing.

[0122] (3) Subculture of SRA01 / 04: When SRA01 / 04 grows to an appropriate density, aspirate the SRA01 / 04 medium, add 1 mL of PBS per well, let it stand for 2 min, and then aspirate the PBS; add 0.5 mL of trypsin per well and incubate at 37 °C for 1 min. Add 1.5 mL of complete medium per well to terminate the digestion, and then gently pipette up and down the cell pellet to ensure that all cells become single cells under a microscope. Transfer the cell suspension to a 15 mL centrifuge tube, centrifuge at 1000 rpm for 5 min. After disinfecting the centrifuge tube with 75% ethanol, transfer it to a laminar flow hood. Discard the supernatant, add the corresponding volume of SRA01 / 04 medium to the cell pellet, and transfer SRA01 / 04 to a new six-well plate culture dish at a ratio of 1 well: 3 wells - 1 well: 6 wells.

[0123] (4) Screening of G418-resistant clones: First, screen the plasmid-transfected SRA01 / 04 with G418 antibiotic for two weeks, and then use a flow cytometer to sort out GFP-positive cells for expansion culture. Subsequently, use qPCR and western blot to detect the expression level of MAB21L1 in the cells. The results show that the expression level of MAB21L1 increased by 40 - 50 times ( Figure 5C ), indicating the successful construction of the stable transfection strain.

[0124] (III) Detection of the expression levels of key factors related to eye development

[0125] Extract the RNA and protein of the SRA01 / 04-NC stable transfection strain and the SRA01 / 04-MAB21L1 overexpression stable transfection strain respectively, and perform qPCR and western blot detection. The results show that after overexpressing MAB21L1, the expression level of the key factor PAX6 related to human eye development is up-regulated ( Figure 5D ), indicating that MAB21L1 can promote the expression of PAX6.

[0126] Example 5. Knockdown of the MAB21L1 gene inhibits the expression of the key factor PAX6 in human eye development

[0127] (I) Construction of a human MAB21L1 gene knockdown vector

[0128] First, design and synthesize two shRNAs (short hairpin RNAs) specifically targeting the human MAB21L1 gene (as shown in Table 3):

[0129] Table 3. shRNA sequences targeting the human MAB21L1 gene

[0130]

[0131] Dilute the synthesized single-stranded oligonucleotide DNA above to a final concentration of 100 μM. Pipette 10 μL of the upstream and downstream primers respectively, mix well by pipetting up and down, and put them into a PCR tube. Anneal them into double strands according to the following program: 95 °C for 30 s, 72 °C for 2 min, 37 °C for 2 min, 25 °C for 2 min.

[0132] Mix the vector ( Figure 6A ) according to the following system: 1 μg of PLKO.1 vector, 1 μL of ECORⅠ endonuclease, 1 μL of AgeⅠ endonuclease, 5 μL of cutsmart buffer, and make up to 50 μL with ddH2O. Incubate at 37 °C for 3 h for digestion.

[0133] After purifying and recovering the above digestion product by gel electrophoresis, mix it according to the following system: 50 ng of the digested linearized vector, 5 ng of the annealed double-stranded shRNA oligo, 1 μL of T4 ligase, 2 μL of 10× ligase buffer, and make up to 20 μL with ddH2O. Then carry out the ligation reaction at 16 °C for 16 h.

[0134] Then transform the ligation product into stbl3 Escherichia coli and plate it (ampicillin resistance). After 16 h, pick a single colony for colony PCR identification, and select the positive bacterial liquid for sanger sequencing. If the sequence is correct, it indicates that the vector construction is successful ( Figure 6B ), and then preserve the strain and extract the plasmid.

[0135] (2) Lentivirus packaging and determination of virus titer for the human MAB21L1 gene knockdown vector

[0136] (1) Virus packaging. Extract high-purity and endotoxin-free lentiviral vector and its auxiliary packaging element vector plasmid. Use PEI transfection reagent to co-transfect the constructed lentiviral vector and its auxiliary packaging element vector plasmid into HEK-293T cells. Add Enhancing buffer 10 - 12 h after transfection, change to fresh medium 8 h later, continue to culture for 48 h, then collect the cell supernatant rich in lentiviral particles, concentrate it to obtain a high-titer lentiviral concentrate, and store it at -80 °C for later use.

[0137] (2) Titer determination. The 293T cells were cultured until the logarithmic growth phase, and the cell culture before infection was grown to a confluence density of 30-50%. At the time of infection, the virus solution stored in the -80 °C refrigerator was thawed in an ice bath, and gradient diluted with cell culture medium containing 10% FBS (medium: polybrene = 1000:1) and gradient infected the cells. Three days after infection, the number of fluorescent cells in each well was observed under a fluorescence microscope, and the virus titer was obtained by multiplying the number of cells expressing fluorescence by the corresponding dilution factor.

[0138] (III) Construction of a stable transfected cell line of human lens epithelial cells with knockdown of MAB21L1

[0139] When the density of SRA01 / 04 cells grew to 60%-70%, the lentivirus constructed in step (II) was infected into SRA01 / 04 at a concentration of MOI = 100, and the medium was changed after 8 h and continued to be cultured. After infection, SRA01 / 04 was screened with puromycin for two weeks. Subsequently, the expression level of MAB21L1 in the cells was detected by qPCR and western Blot. The results showed that the expression level of MAB21L1 was decreased ( Figure 6C ), indicating that the construction of the stable transfected cell line was successful.

[0140] (IV) Detection of the expression levels of key factors related to eye development

[0141] RNA and proteins were respectively extracted from the SRA01 / 04-PLKO.1 stable transfected cell line and the SRA01 / 04-sh1 and SRA01 / 04-sh2 knockdown stable transfected cell lines, and qPCR and western Blot detections were respectively performed. The results showed that after knockdown of MAB21L1, the expression level of the key factor PAX6 related to human eye development was down-regulated ( Figure 6D ), indicating that the inhibition of MAB21L1 expression would inhibit the expression of PAX6.

[0142] Example 6. Knockout of the MAB21L1 gene inhibits the expression of the key factor PAX6 for human eye development

[0143] (I) Construction of a human MAB21L1 gene knockout vector

[0144] (1) First, three sgRNAs specifically targeting the human MAB21L1 gene were designed (according to Table 4), restriction enzyme sites were added to both sides of them, and single-stranded DNA oligos were synthesized, and annealing was performed to generate double-stranded DNA oligos (annealing program: 95 °C for 30 s, 72 °C for 2 min, 37 °C for 2 min, 25 °C for 2 min).

[0145] Table 4. 4gRNA sequences targeting the human MAB21L1 gene

[0146]

[0147] (2) Mix the puro-scramble-gRNA vector ( Figure 7A right) as follows: 1 μg of puro-scramble-gRNA vector, 1 μL of BsmBI endonuclease, 5 μL of cutsmart buffer, and make up to 50 μL with ddH2O. Incubate at 37 °C for 3 h for digestion and recovery. The recovered product is ligated with the annealed DNA oligo (ligation system: 50 ng of linearized vector after digestion, 15 ng of DNA product after digestion, 1 μL of T4 ligase, 2 μL of 10× ligase buffer, and make up to 20 μL with ddH2O. Then carry out the ligation reaction at 16 °C for 16 h.). Then transform into the stbl3 strain. After 16 h, pick a single colony for Sanger sequencing verification. If the sequence is correct, it indicates successful vector construction ( Figure 7B ), and then preserve the strain and extract the plasmid.

[0148] (II) Construction of a human lens epithelial cell line with knockout of the MAB21L1 gene

[0149] (1) Transfection. When the density of SRA01 / 04 cells grows to 60%-70%, co-transfect the 4 constructed puro-scramble-gRNA vectors in step (I) and the Cas9-Blast vector ( Figure 7A left) into SRA01 / 04 cells. Three days after transfection, sort the GFP-positive cells into a 96-well plate by flow cytometry, with one GFP-positive single cell in each well, and expand the culture to a six-well plate.

[0150] (2) Verification. Extract the genomic DNA of the cells in the six-well plate. Using this genomic DNA as a template, perform a PCR amplification reaction with the primers in Table 5. The reaction system is: 2 μL of h-MAB21L1-KO-Fw with a concentration of 10 μM, 2 μL of h-MAB21L1-KO-Rv with a concentration of 10 μM, 1 μL of genomic DNA, 25 μL of 2×Q5 PCR mix, and 20 μL of ddH2O. The reaction program is: pre-denaturation at 98 °C for 2 min (1 time), denaturation at 98 °C for 20 s, annealing at 60 °C for 20 s, extension at 72 °C for 60 s (35 times), then final extension at 72 °C for 10 min (1 time), and finally store at 4 °C for an infinite time (1 time). Purify and recover the obtained PCR product for Sanger sequencing. After comparison with the normal human MAB21L1 gene, it was found that among 9 cell lines, one had a large fragment deletion and 7 had frameshift mutations ( Figure 7C ), confirming the successful construction of a human lens epithelial cell line with knockout of the MAB21L1 gene.

[0151] Table 5. Primers for identification of knockout of the human MAB21L1 gene

[0152] Primer name Primer sequence h-MAB21L1-KO-Fw ATGATTGCGGCCCAGGCCAA h-MAB21L1-KO-Rv TCTCGGATTCTCAGTTTCACTTCGC

[0153] (III) Detecting the expression levels of key factors related to eye development

[0154] Extract the RNA and protein of SRA01 / 04-Cas9 cell line and SRA01 / 04-KO cell line respectively, and perform qPCR and western blot detection. The results show that after knocking out the MAB21L1 gene, the expression level of the key factor PAX6 related to human eye development is down-regulated ( Figure 7D ), indicating that knocking out the MAB21L1 gene inhibits the expression of PAX6.

[0155] Example 7. Construction of MAB21L1 R51W Mutated human lens epithelial cell line

[0156] (I) Construction of MAB21L1 R51W Mutation vector

[0157] (1) First, design three specific sgRNAs targeting human MAB21L1 R51W mutation, add restriction enzyme sites to both sides and synthesize single-stranded DNA oligo, and anneal to produce double-stranded DNA oligo (annealing program: 95°C for 30 s, 72°C for 2 min, 37°C for 2 min, 25°C for 2 min).

[0158] Table 6. 4gRNA sequences targeting the R51 site of human MAB21L1 gene

[0159]

[0160] (2) Synthesize the Donor of MAB21L1 R51W (i.e., SSODN-1 and SSODN-2, and the MAB21L1 sequences they target on the genome are as Figure 8C shown), and perform endotoxin removal treatment:

[0161] Table 7. Donor SSODN sequences targeting human MAB21L1 R51W site

[0162]

[0163] (3) The gRNA-Cas9 vector ( Figure 8A)Mix evenly according to the following system: 1 μg gRNA-Cas9 vector, 1 μL BbsI endonuclease, 5 μL cutsmart buffer, make up to 50 μL with ddH2O, perform digestion at 37 °C for 3 h and recover. The recovered product is ligated with the annealed DNA oligo (ligation system: 50 ng linearized vector after digestion, 15 ng DNA product after digestion, 1 μL T4 ligase, 2 μL 10× ligase buffer, make up to 20 μL with ddH2O. Then perform ligation reaction at 16 °C for 16 h.) and transform into stbl3 strain. After 16 h, pick a single colony for Sanger sequencing verification. If the sequence is correct, it indicates successful vector construction Figure 8B ), and then preserve the strain and extract the plasmid later.

[0164] (II) Construction of MAB21L1 R51W Mutated human lens epithelial cell line

[0165] (1) Transfection. When the density of SRA01 / 04 cells grows to 60%-70%, co-transfect the 4 gRNA vectors constructed in step (I) and SSODN into SRA01 / 04 cells at a ratio of 1:4. Three days after transfection, sort GFP-positive cells into a 96-well plate by flow cytometry, with one GFP-positive single cell in each well, and expand the culture to a six-well plate.

[0166] (2) Verification. Extract the genomic DNA of the cells in the six-well plate. Using this genomic DNA as a template, perform PCR amplification reaction with the primers shown in Table 5. The reaction system is: 2 μL of h-MAB21L1-KO-Fw with a concentration of 10 μM, 2 μL of h-MAB21L1-KO-Rv with a concentration of 10 μM, 1 μL of genomic DNA, 25 μL of 2×Q5 PCR mix, and 20 μL of ddH2O. The reaction program is: pre-denaturation at 98 °C for 2 min (1 time), denaturation at 98 °C for 20 s, annealing at 60 °C for 20 s, extension at 72 °C for 60 s (35 times), then final extension at 72 °C for 10 min (1 time), and finally store at 4 °C for an infinite time (1 time). Purify and recover the obtained PCR product for Sanger sequencing (as Figure 8D shown), and after comparison with the normal human MAB21L1 gene, it is found that the cell line has an R51W mutation, confirming that the R51W human lens epithelial cell line with point mutation of MAB21L1 is successfully constructed.

[0167] Example 8. MAB21L1 R51W Mutation does not affect the binding of MAB21L1-MEIS2

[0168] The potential transcription factors of PAX6 and the binding proteins of MAB21L1 were analyzed by bioinformatics methods. Figure 9 A). After taking the intersection, it was shown that MAB21L1 had the binding ability with the transcription factor MEIS2 of PAX6. Figure 9 B). The docking results showed that the mutation at the R51W site did not affect the binding ability between the MAB21L1 protein and the MEIS2 protein. Figure 9 C). Prodigy analysis showed that the binding energy between MAB21L and MEIS2 was -10.3 kcal / mol, and the dissociation constant was 2.8e-08 M, indicating that the MAB21L1 protein had a strong binding force with the MEIS2 protein. Subsequently, experiments were conducted to verify the above bioinformatics results. Exogenous CoIP experiments were carried out in 293T cells respectively. Figure 9 D), and endogenous CoIP experiments were carried out in human lens epithelial cell line (SRA01 / 04), human corneal epithelial cell line (HCE) and human retinal epithelial cell line (ARPE). Figure 9 E), and the results all showed that both the wild-type protein of MAB21L1 and the R51W mutant protein of MAB21L1 could bind to MEIS2.

[0169] Example 9. MAB21L1 R51W The stability of the mutant protein was reduced

[0170] The effect of the mutation at the R51W site on the MAB21L1 protein was analyzed by bioinformatics methods. The results showed that this site participated in the formation of a salt bridge network together with the E49 site and the E115 site. E49 and R51 fixed the large loop between β4 and α4 through the interaction with E115, thus stabilizing the large loop. Figure 10 A). Salt bridges can improve the thermal stability of proteins. When the R51 site mutates, the thermal stability of the protein decreases. Subsequently, the above bioinformatics analysis results were verified by the cycloheximide (CHX) experiment. The results showed that when the synthesis of nascent proteins was inhibited with 200 μM CHX, the wild-type MAB21L1 protein showed significant degradation after 4 h, while the MAB21L1 R51W protein showed significant degradation after 2 h. Figure 10 B), confirming that the stability of the MAB21L1 R51W mutant protein was reduced and it was more easily degraded.

[0171] Example 10. MAB21L1 R51W The mutant protein was easily degraded through the ubiquitin-proteasome pathway

[0172] Inhibiting the ubiquitin-proteasome pathway using MG132 and the lysosomal autophagy pathway using chloroquine (CQ) to explore the R51W protein degradation pathway of MAB21L1. The results showed that when the ubiquitin-proteasome pathway was inhibited using 200 μM CHX + 20 μM MG132, the degradation of MAB21L1 protein and MAB21L1 R51W mutant protein was inhibited ( Figure 10 C). When the lysosomal pathway was inhibited using 200 μM CHX + 20 μM CQ, there was no significant change in the degradation of MAB21L1 protein and MAB21L1 R51W mutant protein ( Figure 10 D). The above results indicate that the R51W mutant protein of MAB21L1 is easily degraded through the ubiquitin-proteasome pathway.

[0173] In summary, through extensive and in-depth research, the present invention for the first time discovered that a mutation at position 151 of the MAB21L1 gene (corresponding to position R51 of the protein) can lead to congenital anophthalmia / microphthalmia. At the same time, using zebrafish as a model organism, by constructing a mab21l1 gene knockout zebrafish model and an mRNA rescue model, it was further confirmed that Mab21l1 plays an important role in zebrafish eye development, and its deletion can lead to a microphthalmia phenotype in zebrafish. Subsequently, by constructing overexpression / knockdown / knockout / R51W point mutation models of human lens epithelial cells, combined with bioinformatics and CoIP experiments, etc., the specific molecular mechanism of MAB21L1 regulating eye development was explored. The results showed that the MAB21L1 protein can bind to the transcription factor MEIS2 of PAX6, promoting the expression of PAX6, a known key regulator of eye development. And the R51W mutation at the MAB21L1 site can lead to the disruption of the protein salt bridge network, reduced its stability, and is more easily degraded by the ubiquitin–proteasome system. Therefore, the present invention confirmed that MAB21L1 is a key regulatory gene for human eye development, and the mutation at the R51W site of its protein can lead to the loss of function of this protein, affecting human eye development and ultimately resulting in congenital anophthalmia / microphthalmia.

[0174] The above description of the embodiments is for the convenience of those of ordinary skill in the art to understand and use the invention. Those skilled in the art can obviously make various modifications to these embodiments easily and apply the general principles described herein to other embodiments without creative labor. Therefore, the present invention is not limited to the above embodiments, and the improvements and modifications made by those skilled in the art without departing from the scope of the present invention according to the disclosure of the present invention should be within the protection scope of the present invention.

[0175] SEQ.ID.No.18 (Amino acid sequence of MAB21L1):

[0176] MIAAQAKLVYHLNKYYNEKCQARKAAIAKTIREVCKVVSDVLKEVEVQEPRFISSLNEMDNRYEGLEVISPTEFEVVLYLNQMGVFNFVDDGSLPGCAVLKLSDGRKRSMSLWVEFITASGYLSARKIRSRFQTLVAQAVDKCSYRDVVKMVADTSEVKLRIRDRYVVQITPAFKCTGIWPRSAAHWPLPHIPWPGPNRVAEVKAEGFNLLSKECHSLAGKQSSAESDAWVLQFAEAENRLQMGGCRKKCLSILKTLRDRHLELPGQPLNNYHMKTLVSYECEKHPRESDWDESCLGDRLNGILLQLISCLQCRRCPHYFLPNLDLFQGKPHSALENAAKQTWRLAREILTNPKSLEKL

[0177] The primer sequences of the related genes are shown in Table 8 below:

[0178] Table 8. qPCR primers

[0179] GENE Forward primer(5’→3’) Reverse primer(5’→3’) PAX6 CTGAGGAATCAGAGAAGACAGGC ATGGAGCCAGATGTGAAGGAGG MAB21L1 ACTACAACGAAAAATGCCAAGC TCCTTCAGTACGTCGGAAACTA MEIS2 GAAAAGGTCCACGAACTGTGC CTTTCATCAATGACGAGGTCGAT CRYAA GCGAGGGCCTTTTTGAGTATG GGTCGGATCGAACCTCAGAGA CRYAB CCTGAGTCCCTTCTACCTTCG CACATCTCCCAACACCTTAACTT GAPDH ACCCAGAAGACTGTGGATGG TCAGCTCAGGGATGACCTTG

Claims

1. An application of a congenital anophthalmia / microphthalmia-related protein MAB21L1, characterized in that: The amino acid sequence of the congenital anophthalmia / microphthalmia-related protein MAB21L1 is shown in SEQ.ID.No.18; the applications include: preparing a kit for screening congenital anophthalmia / microphthalmia, preparing a drug for treating / rescuing congenital anophthalmia / microphthalmia, screening a drug for treating / rescuing congenital anophthalmia / microphthalmia, and constructing an animal model of congenital anophthalmia / microphthalmia.

2. A drug for treating congenital anophthalmia / microphthalmia caused by MAB21L1 gene mutation or deletion, characterized in that: The active ingredient of the drug is any one of a PAX6 gene expression promoter, a MAB21L1 protein stabilizer or a MAB21L1-MEIS2 conjugate stabilizer.

3. A drug for treating congenital anophthalmia / microphthalmia caused by MAB21L1 gene mutation or deletion according to claim 2, characterized in that: The drug also includes pharmaceutically acceptable excipients.

4. A method for constructing a zebrafish model of ocular malformation, characterized in that: The zebrafish model of ocular malformation is constructed by knocking out the mab21l1 gene of zebrafish; the ocular malformation is congenital anophthalmia / microphthalmia.

5. The method for constructing a zebrafish model of eye developmental malformation according to claim 4, characterized in that: The steps of the construction method are: 1) According to the primers shown in SEQ.ID.No.1 to 4 and the scaffoldprimer shown in SEQ.ID.No.5, four oligonucleotides targeting the zebrafish mab21l1 gene were synthesized, PCR amplified and in vitro transcribed to synthesize gRNA, and purified; 2) The four gRNAs obtained in step 1) are mixed with the Cas9 protein and injected into zebrafish embryos before the two-cell stage, and a zebrafish model with eye developmental deformity is obtained after culture.

6. A method for constructing a zebrafish model for rescuing ocular malformation, characterized in that: The mab21l1 gene of zebrafish with eye developmental deformity is rescued by mab21l1 mRNA, and the construction method comprises the following steps: 1) According to the primers shown in SEQ.ID.No.1 to 4 and the scaffoldprimer shown in SEQ.ID.No.5, four oligonucleotides targeting the zebrafish mab21l1 gene were synthesized, PCR amplified and in vitro transcribed to synthesize gRNA, and Cas9 protein was added after purification for later use; 2) The zebrafish mab21l1 cDNA sequence was obtained by amplifying the zebrafish cDNA, and the zebrafish mab21l1 overexpression vector was obtained by homologous recombination of the mab21l1 cDNA sequence with the linearized overexpression vector PXT7, and the overexpression vector was transcribed in vitro into mab21l1 mRNA for later use; 3) Injecting the product obtained in 1) above into zebrafish embryos, and injecting the mab21l1 mRNA described in 2) again before the two-cell stage, and obtaining a zebrafish model rescued by the mab21l1 gene after culturing, i.e., a zebrafish model rescued by eye developmental malformation.

7. A method for constructing a human lens epithelial cell model with overexpression of MAB21L1 gene, characterized in that: The construction method is as follows: 1) obtaining MAB21L1 cDNA of human lens epithelial cells according to cDNA amplification of human lens epithelial cells, and connecting the MAB21L1 cDNA with a linearized PIRES overexpression vector to obtain an overexpression vector of the MAB21L1 gene; 2) Transfecting the overexpression vector in 1) into human lens epithelial cells, subculturing, and obtaining a human lens epithelial cell model with overexpression of the MAB21L1 gene.

8. A method for constructing a human lens epithelial cell model with knockdown of the MAB21L1 gene, characterized in that: The construction method comprises the following steps: 1) According to the primer sequences shown in SEQ.ID.No.6-9, an oligonucleotide sequence specifically targeting the MAB21L1 gene of human lens epithelial cells was synthesized, and the oligonucleotide sequence was annealed by PCR to form a double strand, and then connected with the linearized PLKO.1 vector to obtain a MAB21L1 knockdown vector; 2) The knockdown vector obtained in 1) is packaged with a lentiviral vector auxiliary vector, and human lens epithelial cells are infected to construct a human lens epithelial cell model with knockdown of the MAB21L1 gene.

9. A method for constructing a human lens epithelial cell model with MAB21L1 gene knocked out, characterized in that: The steps of the construction method include: 1) According to the primer sequences described in SEQ.ID.No.10-13, oligonucleotides targeting the MAB21L1 gene of human lens epithelial cells were synthesized, annealed into double strands by PCR, and then connected to the linearized puro-scramble-gRNA vector; 2) The puro-scramble-gRNA vector and Cas9-blast vector connected in 1) were co-transfected into human lens epithelial cells, single clones were selected and genomic DNA was identified to obtain a human lens epithelial cell model with MAB21L1 gene knockout.

10. A MAB21L1 R51W A method for constructing a site-mutated human lens epithelial cell model, characterized in that: The steps of the construction method include: 1) According to the primer sequences described in SEQ.ID.No.13-15, oligonucleotides targeting the vicinity of site 151 of the MAB21L1 gene in human lens epithelial cells were synthesized, annealed into double strands by PCR, and connected to the linearized gRNA-Cas9-EGFP vector; 2) Chemically synthesizing short single-stranded oligonucleotides as described in SEQ.ID.No.16-17, which can be used as homologous recombination repair donors to produce MAB21L1 on the human genome R51W Point mutations; 3) The gRNA-Cas9-EGFP vector connected in 1) and the short single-stranded oligonucleotide described in 2) were co-transfected into human lens epithelial cells, and monoclonal clones were selected and genomic DNA was identified to obtain MAB21L1 R51W Human lens epithelial cell model with site mutations.

Images