Compounds and methods for reducing MECP2 expression

Abstract

The present disclosure provides oligomeric compounds, methods and pharmaceutical compositions for reducing the amount or activity of methyl CpG binding protein 2 (MECP2) RNA and, in some cases, the amount of MECP2 protein in a cell or animal. Such oligomeric agents, oligomeric compounds, methods and pharmaceutical compositions are useful for improving at least one symptom or sign of a neurodevelopmental disease or condition. Such neurodevelopmental diseases or disorders include MECP2 repetition syndrome. Such symptoms or markers include autism, dyspepsia, dyskinesia, hypomyotonia, overall retardation of development, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory tract infection, epileptic encephalopathy, and early death.

Description

[0001] Sequence Listing

[0002] This application is submitted with a sequence listing in electronic format. The sequence listing is provided as a file named BIOL0429SEQ.xml, created on September 11, 2023, and is 118 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety. Technical Field

[0003] The present disclosure provides oligomeric compounds, methods, and pharmaceutical compositions for reducing the amount or activity of methyl CpG binding protein 2 (MECP2) RNA in a cell or animal, and in some cases, reducing MECP2 protein in a cell or animal. Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions can be used to improve at least one symptom or hallmark of a neurodevelopmental disease or condition. Such neurodevelopmental diseases or conditions include MECP2 duplication syndrome. Such symptoms or hallmarks include autism, intellectual disability, motor dysfunction, hypotonia, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and early death. Background Art

[0004] Methyl CpG binding protein 2 (MECP2) is located on chromosome Xq28 and plays a fundamental role in epigenetics, controlling chromatin state and the expression of thousands of genes (Chahrour et al., Science, 2008, 320:1224-1229; Nan et al., Nature, 1998, 393:386-389; Jones et al., Nat. Genet., 1998, 19:187-191). MECP2 duplication syndrome, caused by overexpression of MECP2, is characterized by autism, intellectual disability, motor dysfunction, hypotonia, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and early death, usually in males (Ramocki et al., Am J Med Genet A, 2010, 152A:1079-1088).

[0005] Currently there is a lack of acceptable options for treating such neurological disorders. Accordingly, it is an object herein to provide compounds and pharmaceutical compositions for the treatment of such diseases and disorders. Summary of the Invention

[0006] Certain embodiments of the oligomerizing agents, oligomeric compounds, and pharmaceutical compositions described herein can be used to reduce or inhibit MECP2 expression in cells or animals. In certain embodiments, MECP2 RNA or protein levels can be reduced in cells or animals. The present disclosure also provides methods for treating MECP2 duplication syndrome. DETAILED DESCRIPTION

[0007] It should be understood that the foregoing general description and the following detailed description are exemplary and illustrative only and not restrictive. In this document, unless otherwise specifically stated, the use of the singular includes the plural. As used herein, unless otherwise specified, the use of "or" means "and / or". In addition, the use of the term "including" and other forms such as "includes" and "included" is not restrictive. In addition, unless otherwise specifically stated, terms such as "element" or "component" cover elements and components that each include one unit and elements and components that include more than one subunit.

[0008] The section headings used in this article are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, articles, books, papers, and GenBank, ENSEMBL, and NCBI reference sequence records, are hereby expressly incorporated herein by reference in their entirety for the portions of documents discussed herein.

[0009] definition

[0010] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications, as well as other data, referred to throughout this disclosure are incorporated herein by reference in their entirety.

[0011] Unless otherwise stated, the following terms have the following meanings:

[0012] As used herein, "2'-deoxynucleoside" means a nucleoside comprising a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, the 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside and comprises a 2'-β-D-deoxyribosyl sugar moiety having a β-D ribosyl configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, the 2'-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

[0013] As used herein, "2'-MOE" refers to an OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-MOE sugar moiety" or "2'-O-methoxyethyl sugar moiety" or "2'-MOE ribosyl sugar moiety" refers to a sugar moiety having an OCH2CH2OCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, a 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" means O-methoxyethyl.

[0014] As used herein, "2'-MOE nucleoside" means a nucleoside comprising a 2'-MOE sugar moiety.

[0015] As used herein, "5-methylcytosine" means cytosine modified with a methyl group attached to the 5 position. 5-Methylcytosine is a modified nucleobase.

[0016] As used herein, "improvement" with respect to treatment means an improvement in at least one symptom or marker relative to the same symptom or marker in the absence of treatment. In certain embodiments, the improvement is a reduction in the severity or frequency of the symptom or marker or a delayed onset or slowing of the severity or frequency of the symptom or marker. In certain embodiments, the symptom or marker is one or more of the following: autism, intellectual disability, motor dysfunction, hypotonia, overall developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and early death. The progression or severity of an indicator can be determined by subjective or objective measurements known to those skilled in the art.

[0017] As used herein, "cell targeting moiety" means a conjugate moiety or portion of a conjugate moiety that is capable of binding to one or more specific cell types.

[0018] As used herein, "cerebrospinal fluid" or "CSF" means the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" means a prepared or manufactured fluid that has certain properties similar to cerebrospinal fluid (e.g., osmotic pressure, pH, and / or electrolytes) and is biocompatible with CSF.

[0019] As used herein, "chirality controlled" with respect to an internucleoside linkage means that the chirality at that bond is enriched for a particular stereochemical configuration.

[0020] As used herein, "chirality enriched" with respect to a group means a plurality of molecules having the same molecular formula, wherein if a specific chiral center is stereoatactic as defined herein, the number or percentage of molecules containing a specific stereochemical configuration at a specific chiral center within the group is greater than the number or percentage of molecules expected to contain the same specific stereochemical configuration at the same specific chiral center within the group. A group of chirality-enriched molecules having multiple chiral centers within each molecule may contain one or more stereoatactic chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is an oligomeric compound comprising a modified oligonucleotide. In certain embodiments, the chiral center is located at the phosphorus atom of the bond between thiophosphate nucleosides. In certain embodiments, the chiral center is located at the phosphorus atom of the bond between methylsulfonylphosphoramidate nucleosides.

[0021] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved under physiological conditions, for example, in a cell, animal, or human body.

[0022] As used herein, " complementary " about oligonucleotide means that when the core base sequence of oligonucleotide and the core base sequence of other nucleic acid are compared in opposite directions, at least 70% of the core base of this oligonucleotide and the core base of another nucleic acid or its one or more districts can hydrogen bond to each other. " complementary region " about the district of oligonucleotide means that when the core base sequence of oligonucleotide and the core base sequence of other nucleic acid are compared in opposite directions, at least 70% of the core base of this district and the core base of another nucleic acid or its one or more districts can hydrogen bond to each other.Complementary core base means the core base that can form hydrogen bond to each other.Complementary core base pair includes adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Unless otherwise indicated, certain modified nucleobases paired with unmodified nucleobases or with other modified nucleobases are known in the art and are not considered to be complementary nucleobases as defined herein. For example, inosine can be paired with adenosine, cytosine or uracil, but is not considered to be complementary to them. Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at each nucleoside. On the contrary, some mispairings are tolerated. As used herein, "complete complementarity" or "100% complementarity" with respect to oligonucleotides means that the oligonucleotide is complementary to another oligonucleotide or nucleic acid at each nucleobase at the shorter of the two oligonucleotides, or if the oligonucleotides are of the same length, then complementary to another oligonucleotide or nucleic acid at each nucleoside.

[0023] As used herein, the "complementary region" with respect to an oligonucleotide is the series of nucleobases of the oligonucleotide that is complementary to a second oligonucleotide or to the target nucleic acid.

[0024] As used herein, "conjugate group" means a group of atoms that is directly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0025] As used herein, "conjugate linker" means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

[0026] As used herein, "conjugate moiety" means a group of atoms that alters one or more properties of a molecule, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance, compared to the same molecule lacking the conjugate moiety.

[0027] As used herein, "consecutive" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "consecutive nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

[0028] As used herein, a "deoxy region" refers to a region of 5 to 12 consecutive nucleotides, wherein at least 70% of the nucleosides contain a β-D-2'-deoxyribosyl sugar moiety. In certain embodiments, the deoxy region is the gap of a gapmer. In certain embodiments, the deoxy region supports RNase H activity.

[0029] As used herein, "diluent" means a component of a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, the diluent in the injected composition can be a liquid, such as aCSF, PBS, or saline solution.

[0030] As used herein, "double-stranded" with respect to a region or oligonucleotide refers to a duplex formed by complementary strands of nucleic acids (including but not limited to oligonucleotides) that hybridize to each other. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule that have folded onto themselves (e.g., a hairpin structure).

[0031] As used herein, "duplex" or "duplex region" means a structure formed by two oligonucleotides or portions thereof that are hybridized to each other.

[0032] As used herein, "gap body" means a modified oligonucleotide comprising an internal region between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically different from the one or more nucleosides comprising the external region, and wherein the modified oligonucleotide supports RNase H cleavage. The internal region may be referred to as a "gap", and the external region may be referred to as a "wing". In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides in the internal region and is counted from the 5' end of the internal region. Unless otherwise indicated, a "gap body" refers to a sugar motif. In certain embodiments, the internal region is a "deoxy region". In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap comprises a 2'-substituted nucleoside at position 1, 2, 3, 4, or 5, and the remainder of the nucleosides in the gap are 2'-β-D-deoxynucleosides. As used herein, the term "MOE spacer" refers to a spacer having a gap comprising a 2'-β-D-deoxynucleoside and a wing comprising a 2'-MOE nucleoside. As used herein, the term "mixed wing spacer" refers to a spacer having a wing comprising a modified nucleoside comprising at least two different sugar modifications. Unless otherwise indicated, a spacer may comprise one or more modified internucleoside bonds and / or modified nucleobases, and such modifications do not necessarily follow the sugar-modified spacer pattern.

[0033] As used herein, a "hotspot" is a series of nucleobases on a target nucleic acid that is susceptible to the action of an oligomerizing agent, oligomeric compound, modified oligonucleotide, antisense compound, or antisense agent to reduce the amount or activity of the target nucleic acid.

[0034] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0035] As used herein, "internucleoside bond" is a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, "modified internucleoside bond" means any internucleoside bond except a phosphodiester internucleoside bond. "Phosphorothioate internucleoside bond" or "PS internucleoside bond" is a modified internucleoside bond in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside bond is replaced by a sulfur atom. As used herein, "connected nucleosides" are nucleosides connected in a continuous sequence (i.e., without additional nucleosides between the connected nucleosides).

[0036] As used herein, "linker nucleoside" means a nucleoside that directly or indirectly connects an oligonucleotide to a conjugate portion. A linker nucleoside is located within the conjugate linker of an oligomeric compound. Linker nucleosides are not considered to be part of the oligonucleotide portion of an oligomeric compound, even if they are continuous with the oligonucleotide.

[0037] As used herein, "mismatch" or "non-complementary" means that a nucleobase of a first nucleic acid sequence is not complementary to a corresponding nucleobase of a second nucleic acid sequence or a target nucleic acid when the first and second nucleic acid sequences are aligned in opposite orientations.

[0038] As used herein, "motif" means the pattern of unmodified and / or modified sugar moieties, nucleobases and / or internucleoside linkages in an oligonucleotide.

[0039] As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety.

[0040] As used herein, "non-bicyclic modified sugar moiety" means a sugar moiety that contains modifications, such as substituents, that do not form a bridge between two atoms of the sugar to form a second ring.

[0041] As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U) or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U or G that can pair with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase. Universal bases are modified nucleobases that can pair with any of the five unmodified nucleobases.

[0042] As used herein, "nucleobase sequence" means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage modifications.

[0043] As used herein, a "nucleobase sequence" with reference to a SEQ ID NO refers only to the nucleobase sequence provided in such SEQ ID NO, and therefore, unless otherwise indicated, includes compounds in which each sugar moiety and each internucleoside linkage is independently modified or unmodified, regardless of the presence or absence of the modifications indicated in the referenced SEQ ID NO.

[0044] As used herein, "nucleoside" means a compound or fragment of a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each independently unmodified or modified.

[0045] As used herein, "oligomeric compound" means an oligonucleotide and optionally one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0046] The term "oligoduplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of the oligomeric duplex can be referred to as a "duplex oligomeric compound."

[0047] As used herein, "oligonucleotide" means a chain of nucleosides connected via internucleoside bonds, wherein each nucleoside and internucleoside bond can be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 connected nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not comprise any nucleoside modifications or internucleoside modifications. An oligonucleotide can be paired with a second oligonucleotide that is complementary to the oligonucleotide, or it can be unpaired. A "single-stranded oligonucleotide" is an unpaired oligonucleotide. A "double-stranded oligonucleotide" is an oligonucleotide that is paired with a second oligonucleotide.

[0048] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administration to an animal. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, a sterile buffered solution, or sterile artificial cerebrospinal fluid.

[0049] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of a compound. Pharmaceutically acceptable salts retain the desired biological activity of the parent compound and do not impart undesirable toxicological effects.

[0050] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0051] As used herein, unless otherwise indicated, "RNA" means RNA transcripts and includes pre-mRNA and mature mRNA.

[0052] As used herein, "RNAi agent" means an antisense agent that acts at least in part through RISC or Ago2 to modulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and / or terminal groups. In certain embodiments, RNAi agents modulate the amount and / or activity of a target nucleic acid. The term RNAi agent does not include antisense agents that act through RNase H.

[0053] As used herein, "RNase H agent" means an antisense agent that acts through RNase H to modulate a target nucleic acid and / or a protein encoded by the target nucleic acid. In certain embodiments, the RNase H agent is single-stranded. In certain embodiments, the RNase H agent is double-stranded. The RNase H compound may contain a conjugate group and / or a terminal group. In certain embodiments, the RNase H agent modulates the amount and / or activity of the target nucleic acid. The term RNase H agent does not include antisense agents that act primarily through RISC / Ago2.

[0054] As used herein, "single-stranded" refers to a nucleic acid (including but not limited to an oligonucleotide) that is unpaired and not part of a duplex. Single-stranded compounds are capable of hybridizing with complementary nucleic acids to form a duplex, at which point they are no longer single-stranded.

[0055] As used herein, in the context of a group of molecules with the same molecular formula, "stereoatactic" or "stereoatactic chiral center" means a chiral center that is not controlled during synthesis or enriched after synthesis for a specific absolute stereochemical configuration. When the stereochemical configuration of a chiral center is the result of a synthetic method designed to control the stereochemical configuration, the stereochemical configuration is considered to be random. For example, in a group of molecules comprising a stereoatactic chiral center, the number of molecules with the (S) configuration of the stereoatactic chiral center can be, but not necessarily, the same as the number of molecules with the (R) configuration of the stereoatactic chiral center ("racemic"). In certain embodiments, the stereoatactic chiral center is not racemic because, for example, due to the effect of an achiral reagent near the enriched stereochemistry of the adjacent sugar moiety, one absolute configuration dominates after synthesis. In certain embodiments, the stereoatactic chiral center is located at the phosphorus atom of the stereoatactic phosphorothioate or methylsulfonylphosphoramidate nucleoside bond.

[0056] As used herein, "subject" means a human or non-human animal. The terms "subject," "animal," and "individual" are used interchangeably. In certain embodiments, the subject is a human.

[0057] As used herein, "sugar moiety" means an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" means a 2'-OH (H) ribosyl sugar moiety as found in RNA ("unmodified RNA sugar moiety"), or a 2'-H (H) deoxyribosyl sugar moiety as found in DNA ("unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or sugar surrogate.

[0058] As used herein, "symptom or sign" means any physical characteristic or test result that indicates the presence or extent of a disease or condition. In certain embodiments, the symptom is obvious to the subject or to a medical professional examining or testing the subject. In certain embodiments, the sign is obvious during invasive diagnostic testing (including but not limited to postmortem testing). In certain embodiments, the sign is obvious on a brain MRI scan. In certain embodiments, symptoms and signs include autism, intellectual disability, motor dysfunction, low muscle tone, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and early death.

[0059] As used herein, "target nucleic acid" and "target RNA" mean the nucleic acid that an oligomeric compound is designed to affect. Unless otherwise indicated, target RNA means RNA transcripts, and includes pre-mRNA and mature mRNA.

[0060] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0061] As used herein, "terminal group" means a chemical group or radical of atoms that is covalently attached to the terminus of an oligonucleotide.

[0062] As used herein, "treating" means ameliorating a disease or condition in a subject by administering an oligomeric compound, oligomeric duplex, or antisense agent as described herein. In certain embodiments, treatment of a subject improves symptoms relative to the same symptoms in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of symptoms, or delays the onset of symptoms, slows the progression of symptoms, or slows the severity or frequency of symptoms.

[0063] As used herein, a "therapeutically effective amount" means an amount of an agent or composition that provides a therapeutic benefit to an animal. For example, a therapeutically effective amount improves the symptoms of a disease.

[0064] As used herein, "antisense activity" means any detectable and / or measurable change attributable to hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid, as compared to the level of the target nucleic acid or target protein in the absence of the antisense compound. In certain embodiments, antisense activity is modulation of splicing of a target pre-mRNA.

[0065] As used herein, "antisense agent" means an antisense compound and optionally one or more additional features, such as, a sense compound.

[0066] As used herein, "antisense compound" means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.

[0067] As used herein, "sense compound" means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.

[0068] As used herein, "antisense oligonucleotide" means an oligonucleotide capable of hybridizing to a target nucleic acid and having at least one antisense activity, including the oligonucleotide portion of an antisense compound. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0069] As used herein, "sense oligonucleotide" means an oligonucleotide capable of hybridizing to an antisense oligonucleotide, including the oligonucleotide portion of a sense compound.

[0070] Certain embodiments

[0071] The present disclosure provides the following non-limiting numbered examples:

[0072] Example 1. A modified oligonucleotide according to the following chemical structure:

[0073]

[0074] (SEQ ID NO: 19) or a pharmaceutically acceptable salt thereof.

[0075] Embodiment 2. The modified oligonucleotide according to embodiment 1, wherein the modified oligonucleotide is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium and magnesium.

[0076] Embodiment 3. The modified oligonucleotide according to embodiment 1, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

[0077] Example 4. A modified oligonucleotide according to the following chemical structure:

[0078]

[0079] (SEQ ID NO: 19).

[0080] Example 5. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbols: G es m C e o A eo A eo m C eo A ds T ds T ds T ds T ds m C ds A ds G ds T ds T ds T eo m C eo A es G es m C e (SEQ ID NO: 19), wherein

[0081] A = adenine nucleobase,

[0082] m C=5-methylcytosine nucleobase,

[0083] G = guanine nucleobase,

[0084] T = thymine nucleobase,

[0085] e=2'-MOE sugar moiety,

[0086] d = 2'-β-D-deoxyribosyl sugar moiety,

[0087] s = phosphorothioate internucleoside linkage, and

[0088] o = phosphodiester internucleoside linkage.

[0089] Embodiment 6. A population of modified oligonucleotides according to embodiment 1, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0090] Example 7. A pharmaceutical composition comprising the modified oligonucleotide according to Example 1 and a pharmaceutically acceptable diluent.

[0091] Example 8. The pharmaceutical composition of Example 7, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0092] Embodiment 9. The pharmaceutical composition of embodiment 8, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate-buffered saline or the artificial cerebrospinal fluid.

[0093] Embodiment 10. A population of modified oligonucleotides according to embodiment 2, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0094] Embodiment 11. A pharmaceutical composition comprising the modified oligonucleotide according to embodiment 2 and a pharmaceutically acceptable diluent.

[0095] Embodiment 12. The pharmaceutical composition according to embodiment 11, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0096] Embodiment 13. The pharmaceutical composition of embodiment 12, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate-buffered saline or the artificial cerebrospinal fluid.

[0097] Embodiment 14. A population of modified oligonucleotides according to embodiment 4, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0098] Embodiment 15. A pharmaceutical composition comprising the modified oligonucleotide according to embodiment 4 and a pharmaceutically acceptable diluent.

[0099] Embodiment 16. The pharmaceutical composition of embodiment 15, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0100] Embodiment 17. The pharmaceutical composition of embodiment 16, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate-buffered saline or the artificial cerebrospinal fluid.

[0101] Embodiment 18. The population of oligomeric compounds according to embodiment 5, wherein all of the phosphorothioate internucleoside linkages of the oligomeric compounds are stereorandom.

[0102] Example 19. A pharmaceutical composition comprising the oligomeric compound according to Example 5 and a pharmaceutically acceptable diluent.

[0103] Embodiment 20. The pharmaceutical composition of embodiment 19, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0104] Embodiment 21. The pharmaceutical composition of embodiment 20, wherein said pharmaceutical composition consists essentially of said oligomeric compound and said phosphate buffered saline or said artificial cerebrospinal fluid.

[0105] Embodiment 22. A pharmaceutical composition comprising the population according to embodiment 6 and a pharmaceutically acceptable diluent.

[0106] Embodiment 23. The pharmaceutical composition of embodiment 22, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0107] Embodiment 24. A pharmaceutical composition comprising the population according to embodiment 10 and a pharmaceutically acceptable diluent.

[0108] Embodiment 25. The pharmaceutical composition of embodiment 24, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0109] Embodiment 26. A pharmaceutical composition comprising the population according to embodiment 14 and a pharmaceutically acceptable diluent.

[0110] Embodiment 27. The pharmaceutical composition of embodiment 26, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0111] Embodiment 28. A pharmaceutical composition comprising the population according to embodiment 18 and a pharmaceutically acceptable diluent.

[0112] Embodiment 29. The pharmaceutical composition of embodiment 28, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0113] Embodiment 30. A method comprising administering to a subject the modified oligonucleotide of any one of embodiments 1 to 4, the oligomeric compound of embodiment 5, the population of any one of embodiments 6, 10, 14 and 18, or the pharmaceutical composition of any one of embodiments 7 to 9, 11 to 13, 15 to 17 and 19 to 29.

[0114] Embodiment 31. The method of embodiment 30, wherein the subject suffers from a disease or disorder associated with MECP2.

[0115] Embodiment 32. The method of embodiment 31, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

[0116] Example 33. The method of Example 31 or Example 32, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

[0117] Embodiment 34. A method of treating a disease or condition associated with MECP2, comprising administering to a subject having or at risk of developing a disease or condition associated with MECP2 a therapeutically effective amount of the modified oligonucleotide of any one of embodiments 1 to 4, the oligomeric compound of embodiment 5, the population of any one of embodiments 6, 10, 14 and 18, or the pharmaceutical composition of any one of embodiments 7 to 9, 11 to 13, 15 to 17 and 19 to 29; and thereby treating the disease or condition associated with MECP2.

[0118] Embodiment 35. The method of embodiment 34, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

[0119] Example 36. The method of Example 34 or Example 35, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

[0120] Embodiment 37. The method of any one of embodiments 34 to 36, wherein at least one symptom or marker of the disease or condition associated with MECP2 is ameliorated.

[0121] Embodiment 38. The method of embodiment 37, wherein the symptom or sign is autism, intellectual disability, motor dysfunction, hypotonia, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, or early death.

[0122] Embodiment 39. The method of any one of embodiments 34 to 38, wherein the disease or disorder associated with MECP2 is associated with elevated levels of MECP2 in the subject.

[0123] Embodiment 40. The method of any one of embodiments 34 to 39, wherein administration of said modified oligonucleotide, said oligomeric compound, said population or said pharmaceutical composition reduces epileptic seizures, reduces or delays cognitive impairment, reduces or delays intellectual disability, reduces or delays symptoms of autism, reduces anxiety, or alleviates gastrointestinal symptoms in said subject; or improves said subject's motor function, motor development, muscle tone, cognitive development, speech or social skill development.

[0124] Embodiment 41. The method of any one of embodiments 31 to 40, wherein the subject is human.

[0125] Embodiment 42. A method of reducing the expression of MECP2 in a cell, comprising contacting the cell with the modified oligonucleotide of any one of embodiments 1 to 4, the oligomeric compound of embodiment 5, the population of any one of embodiments 6, 10, 14 and 18, or the pharmaceutical composition of any one of embodiments 7 to 9, 11 to 13, 15 to 17 and 19 to 29.

[0126] Embodiment 43. The method of embodiment 42, wherein the cell is a neuron.

[0127] Embodiment 44. The method of embodiment 42 or embodiment 43, wherein the cells are human cells.

[0128] Embodiment 45. Use of the modified oligonucleotide of any one of embodiments 1 to 4, the oligomeric compound of embodiment 5, the population of any one of embodiments 6, 10, 14 and 18, or the pharmaceutical composition of any one of embodiments 7 to 9, 11 to 13, 15 to 17 and 19 to 29 for treating a disease or disorder associated with MECP2.

[0129] Embodiment 46. Use of the modified oligonucleotide of any one of embodiments 1 to 4, the oligomeric compound of embodiment 5, the population of any one of embodiments 6, 10, 14 and 18, or the pharmaceutical composition of any one of embodiments 7 to 9, 11 to 13, 15 to 17 and 19 to 29 in the manufacture of a medicament for treating a disease or condition associated with MECP2.

[0130] Embodiment 47. The use according to embodiment 45 or embodiment 46, wherein the disease or disorder is associated with elevated levels of MECP2.

[0131] Embodiment 48. The use according to any one of embodiments 45 to 47, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

[0132] Compound No. 1435454

[0133] In certain embodiments, compound No. 1435454 is characterized as having GCAACATTTTCAGTTTCAGC (SEQ ID wherein each nucleoside in nucleosides 1 to 5 and 16 to 20 (from 5' to 3') is a 2'-MOE nucleoside, and each nucleoside in nucleosides 6 to 15 is a 2'-β-D-deoxynucleoside, wherein the internucleoside linkage between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 is a phosphodiester internucleoside linkage, the internucleoside linkage between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 is a phosphorothioate internucleoside linkage, and wherein each cytosine is 5-methylcytosine.

[0134] In certain embodiments, Compound No. 1435454 is represented by the following chemical symbol: G es m C eo A eo A eo m C eo A ds T d s T ds T ds T ds m C ds A ds G ds T ds T ds T eo m C eo A es G es m C e (SEQ ID NO: 19), wherein

[0135] A = adenine nucleobase,

[0136] m C=5-methylcytosine nucleobase,

[0137] G = guanine nucleobase,

[0138] T = thymine nucleobase,

[0139] e=2'-MOE sugar moiety,

[0140] d = 2'-β-D-deoxyribosyl sugar moiety

[0141] s = phosphorothioate internucleoside linkage, and

[0142] o = phosphodiester internucleoside linkage.

[0143] In certain embodiments, Compound No. 1435454 is represented by the following chemical structure:

[0144]

[0145] (SEQ ID NO: 19)

[0146] Structure 1. Compound 1435454.

[0147] In certain embodiments, the oligomeric compound comprises a pharmaceutically acceptable salt of the modified oligonucleotide represented by Structure 1 comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0148] In certain embodiments, the sodium salt of Compound No. 1435454 is represented by the following chemical structure:

[0149]

[0150] (SEQ ID NO: 19).

[0151] Structure 2. Sodium salt of compound 1435454.

[0152] I. Certain oligonucleotides

[0153] In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, which are composed of connected nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or can be modified oligonucleotides. The modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, the modified oligonucleotides comprise at least one modified nucleoside (comprising modified sugar moieties and / or modified core bases) and / or at least one modified internucleoside bond. Some modified nucleosides and modified internucleoside bonds suitable for use in modified oligonucleotides are described below.

[0154] A. Certain modified nucleosides

[0155] Modified nucleosides include modified sugar moieties, modified core bases, or both modified sugar moieties and modified core bases. In certain embodiments, modified nucleosides including the following modified sugar moieties and / or the following modified core bases can be incorporated into modified oligonucleotides.

[0156] 1. Certain sugar moieties

[0157] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring having one or more substituent groups, wherein no substituent group bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be located at any position of the furanosyl group, including but not limited to substituents at the 2', 3', 4', and / or 5' positions.

[0158] In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent group at the 2' position. Examples of substituent groups suitable for the 2' position of the non-bicyclic modified sugar moiety include, but are not limited to, -F, -OCH3 ("Ome" or "O-methyl"), and -O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridged 2'-substituent group selected from the group consisting of F, OCH3, and OCH2CH2OCH3. In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridged 2'-substituent group selected from the group consisting of F, OCH3, and OCH2CH2OCH3.

[0159] In certain embodiments, the modified furanosyl sugar moiety and the nucleoside incorporating such modified furanosyl sugar moiety are further defined by isomeric configurations. For example, in addition to the naturally occurring β-D-deoxyribosyl configuration, the 2'-deoxyfuranosyl sugar moiety can be in seven isomeric configurations. Such modified sugar moieties are described in, for example, WO 2019 / 157531. The 2'-modified sugar moiety has an additional stereocenter at the 2' position relative to the 2'-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations. Unless otherwise stated, the 2'-modified sugar moieties described herein are in β-D-ribosyl isomeric configurations.

[0160] 2. Certain modified nucleobases

[0161] In certain embodiments, the modified oligonucleotide comprises one or more nucleosides comprising unmodified nucleobases. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides comprising modified nucleobases. Examples of modified nucleobases include 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises one or more nucleosides that do not comprise nucleobases, which are referred to as abasic nucleosides. In certain embodiments, the modified oligonucleotide comprises one or more inosine nucleosides (i.e., nucleosides comprising hypoxanthine nucleobases). "Unmodified nucleobases" are adenine (A), thymine (T), cytosine (C), uracil (U) or guanine (G). Modified nucleobases are atomic groups that can pair with at least one other nucleobase except unmodified A, T, C, U or G. 5-methylcytosine is an example of a modified nucleobase. Universal bases are modified nucleobases that can pair with any of the five unmodified nucleobases.

[0162] In certain embodiments, the modified adenine has structure (I):

[0163]

[0164] Where: R 2A R is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 thioalkyl or substituted C1-C6 thioalkyl, C1-C6 alkoxy or substituted C1-C6 alkoxy; 6A It is H, N(R a )(R b ), oxo, acetyl, formyl or o-phenyl; Y 7A is N, and R 7A is absent or is a C1-C6 alkyl group; or Y 7A is C, and R 7A Selected from H, C1-C6 alkyl or CN(R a )(R b );Y 8A is N, and R 8A Does not exist, or Y 8A is C, and R 8A is selected from H, halogen, OH, C1-C6 alkyl or substituted C1-C6 alkyl; R a and R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl or together form a 5-7 membered heterocyclic ring; excluding Y 7A This is the case of N; Y 8A It is C, R 8A It's H, R 2A is H, and R6A It is NH2 (unmodified adenine).

[0165] In certain embodiments, the unmodified guanine has structure (II):

[0166]

[0167] where R 2G It is N(R a )(R b );R 6G is oxo, and R 1G It's H or R 6G is selected from O-C1-C6 alkyl or S-C1-C6 alkyl, and R 1G Does not exist; Y 7G is N, and R 7A is absent or is a C1-C6 alkyl group; or Y 7G is C, and R 7G Selected from H, C1-C6 alkyl or CN(R a )(R b );Y 8G is N, and R 8G Does not exist, or Y 8G is C, and R 8G is selected from H, halogen, OH, C1-C6 alkyl or substituted C1-C6 alkyl; R a and R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl or together form a 5-7 membered heterocyclic ring; excluding Y 7G This is the case of N; Y 8G It is C, R 8G It's H, R 2G is NH2, and R 6G Y = O (unmodified guanosine).

[0168] In certain embodiments, the modified thymine or modified uracil has structure (III):

[0169]

[0170] Where: X is selected from O or S, and R 5U Selected from H, OH, halogen, O-C1-C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C12 alkenyl; wherein if each X is O, then R 5U Not H or CH3 (unmodified uracil and unmodified thymine, respectively).

[0171] In certain embodiments, the modified cytosine has structure (IV):

[0172]

[0173] Wherein: X is selected from O or S; R 4C It is N(R a )(R b );R 5C Selected from H, OH, halogen, O-C1-C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 Alkenyl; R a and R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl or together form a 5-7 membered heterocyclic ring; excluding X being O, R 4C is NH2, and R 5C This is the case of H (unmodified cytosine).

[0174] In certain embodiments, the modified nucleobase of the modified oligonucleotide is selected from the group consisting of: a 5-substituted pyrimidine, a 6-azapyrimidine, an alkyl or alkynyl substituted pyrimidine, an alkyl substituted purine, and N-2, N-6, and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from the group consisting of: 5-methylcytosine, hypoxanthine, 1-methylpseudouridine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C□C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouridine), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy 5-bromo), 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, hybrid bases, size-expanded bases, and fluorinated bases. Additional modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenthiazine-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include nucleobases in which the purine or pyrimidine base is replaced by other heterocycles (e.g., 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone). Additional nucleobases include those disclosed in Englisch, U. et al., Angew. Chem. Int. Ed. 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., eds., CRC Press, 1993, 273-288; and nucleobases disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke ST, ed., CRC Press, 2008, 163-166 and 442-443.

[0175] Publications that teach the preparation of certain of the above modified nucleobases, as well as other modified nucleobases, include, but are not limited to, Manoharan et al., US 2003 / 0158403; Manoharan et al., US 2003 / 0175906; Dinh et al., US4,845,205; Spielvogel et al., US5,130,302; Rogers et al., US5,134,066; Bischofberger et al., US5,175,273; Urdea et al., US5,367,066; Benner et al., US5,432,272; Matteucci et al., US5,434,257; Gmeiner et al., US5,457,187; Cook et al., US5,459,255; Froehler et al., US5,484,908; Matteucci et al., US5,502,177; Hawkins et al., US5,525,711; Haralambidis et al., US5,552,540; Cook et al., US5, 587,469; Froehler et al., US5,594,121; Switzer et al., US5,596,091; Cook et al., US5,614,617; Froehler et al., US5,645,985; Cook et al., US5,681,941; Cook et al., US5,811,534; Cook et al., US5,750,692; Cook et al., US5,948,903; Cook et al., US5,587,470; Cook et al., US5,457,191; Matteucci et al., US5,763,588; Froehler et al., US5,830,653; Cook et al., US5,808,027; Cook et al., US6,166,199; and Matteucci et al., US6,005,096.

[0176] In certain embodiments, each nucleobase of the modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, m C or hypoxanthine.

[0177] 3. Certain modified internucleoside linkages

[0178] The naturally occurring internucleoside bond of RNA and DNA is a 3' to 5' phosphodiester bond. In certain embodiments, the nucleosides of a modified oligonucleotide can be linked together using one or more modified internucleoside bonds. The two main types of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside bonds include, but are not limited to, phosphates, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S") and phosphorodithioates ("HS-P=S"), which contain a phosphodiester bond ("P=O") (also referred to as an unmodified or naturally occurring bond). Modified internucleoside bonds can be used to alter, typically increase, the nuclease resistance of an oligonucleotide compared to a naturally occurring phosphate bond. In certain embodiments, internucleoside bonds with chiral atoms can be prepared as racemic mixtures or as individual enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside bonds are well known to those skilled in the art.

[0179] Representative internucleoside bonds with chiral centers include, but are not limited to, phosphorothioates. Modified oligonucleotides comprising internucleoside bonds with chiral centers can be prepared as a group of modified oligonucleotides comprising stereo-random internucleoside bonds, or as a group of modified oligonucleotides comprising phosphorothioate bonds in a specific stereochemical configuration. In certain embodiments, the group of modified oligonucleotides comprises phosphorothioate internucleoside bonds, wherein all phosphorothioate internucleoside bonds in the phosphorothioate internucleoside bonds are stereo-random. Such modified oligonucleotides can be produced using a random selection synthesis method that causes the stereochemical configuration of each phosphorothioate bond. Nevertheless, each single phosphorothioate of each single oligonucleotide molecule has a definite stereoconfiguration. In certain embodiments, the group of modified oligonucleotides is enriched with modified oligonucleotides comprising one or more specific phosphorothioate internucleoside bonds in a specific, independently selected stereochemical configuration. In certain embodiments, the specific configuration of a specific phosphorothioate bond is present in at least 65% of the molecules in the group. In certain embodiments, the specific configuration of a specific phosphorothioate bond is present in at least 70% of the molecules in the group. In certain embodiments, the specific configuration of a specific phosphorothioate bond is present in at least 80% of the molecules in the group. In certain embodiments, the specific configuration of a specific phosphorothioate bond is present in at least 90% of the molecules in the group. In certain embodiments, the specific configuration of a specific phosphorothioate bond is present in at least 99% of the molecules in the group. The group of such chiral enriched modified oligonucleotides can be produced using synthetic methods known in the art, for example, the method described in the following documents: Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014) and WO 2017 / 015555. In certain embodiments, the group of modified oligonucleotides is enriched with at least one modified oligonucleotide of the indicated phosphorothioate in (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioate each comprise one or more of the following formulae, wherein "B" represents a nucleobase:

[0180]

[0181] Unless otherwise stated, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or in a specific stereochemical configuration.

[0182] B. Certain motifs

[0183] In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises one or more modified nucleosides comprising a modified core base. In certain embodiments, the modified oligonucleotide comprises one or more modified internucleoside bonds. In such embodiments, the modified, unmodified and differently modified sugar moieties, core bases and / or internucleoside bonds of the modified oligonucleotide define a pattern or motif. Unless otherwise indicated, the patterns of sugar moieties, core bases and internucleoside bonds are each independent of one another. Therefore, the modified oligonucleotide can be described by its sugar motif, core base motif and / or internucleoside bond motif (as used herein, the core base motif describes the modification of the sequence of the core base independent of the core base).

[0184] 1. Certain sugar motifs

[0185] In certain embodiments, the oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar moieties arranged in a defined pattern or sugar motif along the oligonucleotide or a region thereof. In some cases, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0186] In certain embodiments, the modified oligonucleotide comprises a deoxy region. In certain embodiments, each nucleoside in the deoxy region is a 2'-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5 to 12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides. In certain embodiments, at least one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides in the deoxy region comprise a modified sugar moiety.

[0187] In certain embodiments, the deoxygenated region is flanked by the 5' region on the 5' side and by the 3' region on the 3' side, the 5' region being composed of connected 5' region nucleosides, and the 3' region being composed of connected 3' region nucleosides; wherein the most 3' end nucleoside of the 5' region is a modified nucleoside, and the most 5' end nucleoside of the 3' region is a modified nucleoside. At least one nucleoside in the 5' region comprises a modified sugar moiety; and at least one nucleoside in the 3' region comprises a modified sugar moiety. These three regions (5' region, deoxygenated region, and 3' region) form a continuous sequence of nucleosides. In certain embodiments, the sugar moiety of the most 3' end nucleoside in the 5' region and the sugar moiety of the most 5' end nucleoside in the 3' region are each different from the sugar moiety of the corresponding adjacent nucleoside in the deoxygenated region, thereby defining the boundary between the 5' region, the deoxygenated region, and the 3' region. In certain embodiments, each nucleoside in the 5' region and each nucleoside in the 3' region comprise a modified sugar moiety. In certain embodiments, the nucleosides in the 5' region comprise the same sugar modification. In certain embodiments, the nucleosides in the 5' region comprise two or more different sugar modifications. In certain embodiments, the nucleosides in the 3' region comprise the same sugar modification. In certain embodiments, the nucleosides in the 3' region comprise two or more different sugar modifications.

[0188] In certain embodiments, the 5' region and the 3' region of the modified oligonucleotide each comprise 1 to 8 nucleosides. In certain embodiments, the 5' region comprises 1 to 7 nucleosides. In certain embodiments, the 5' region comprises 1 to 6 nucleosides. In certain embodiments, the 5' region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 3' region comprises 1 to 7 nucleosides. In certain embodiments, the 3' region comprises 1 to 6 nucleosides. In certain embodiments, the 3' region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides.

[0189] In certain embodiments, modified oligonucleotide comprises the district with spacer motif or is made up of the district with spacer motif, and this district is limited by two external districts or " wing " and central or inner district or " gap ".The three districts (5 ' wing, gap and 3 ' wing) of spacer motif form continuous nucleoside sequence, and at least some of the sugar moieties in the sugar moiety of the nucleoside of wherein each wing in wing are different from at least some of the sugar moieties in the sugar moiety of the nucleoside of gap.Specifically, the sugar moiety of the nucleoside closest to the gap (the most 3 ' end nucleoside of 5 ' wing and the most 5 ' end nucleoside of 3 ' wing) of at least each wing is different from the sugar moiety of adjacent gap nucleoside, thereby defining the boundary between wing and gap (i.e. wing / gap junction).In certain embodiments, the sugar moiety in gap is identical to each other.In certain embodiments, gap comprises one or more nucleosides, and these one or more nucleosides have the sugar moiety different from the sugar moiety of one or more other nucleoside of gap.In certain embodiments, the sugar motifs of two wings are identical to each other (symmetrical spacer). In certain embodiments, the sugar motif of the 5' wing is different from the sugar motif of the 3' wing (asymmetric spacer).

[0190] In certain embodiments, the wings of a spacer comprise 1 to 6 nucleosides. In certain embodiments, each nucleoside of each wing of a spacer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a spacer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a spacer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a spacer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a spacer comprise a modified sugar moiety.

[0191] In certain embodiments, the gap of a spacer comprises 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gap of a spacer comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a spacer comprises a modified sugar moiety.

[0192] In certain embodiments, the spacer is a deoxy spacer. In certain embodiments, the nucleoside on the gap side of each wing / gap junction comprises a 2'-deoxyribosyl sugar moiety, and the nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside in the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside in each wing of the spacer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside in the gap of the spacer comprises a modified sugar moiety. In certain embodiments, one nucleoside in the gap comprises a modified sugar moiety, and each remaining nucleoside in the gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside in the gap of the spacer comprises a 2'-Ome sugar moiety.

[0193] In this article, the length (number of nucleosides) of the three regions of the spacer can be provided using the notation [number of nucleosides in the 5' wing]–[number of nucleosides in the gap]–[number of nucleosides in the 3' wing]. Therefore, the 3-10-3 spacer is composed of 3 nucleosides connected in each wing and 10 nucleosides connected in the gap. In the case where this nomenclature is followed by a specific modification, the modification is a modification in each sugar moiety of each wing, and the gap nucleosides include a 2'-β-D-deoxyribosyl sugar moiety. Therefore, the 5-10-5MOE spacer is composed of 5 2'-MOE nucleosides connected in the 5' wing, 10 2'-β-D-deoxynucleosides connected in the gap, and 5 2'-MOE nucleosides connected in the 3' wing. The 5-8-5MOE spacer is composed of 5 2'-MOE nucleosides connected in the 5' wing, 8 2'-β-D-deoxynucleosides connected in the gap, and 5 2'-MOE nucleosides connected in the 3' wing.

[0194] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE spacer.

[0195] In certain embodiments, the modified oligonucleotide has a sugar motif from 5' to 3': eeeeeddddddddddeeeee; wherein each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE ribosyl sugar moiety.

[0196] 2. Certain nucleobase motifs

[0197] In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or region thereof. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine, and all of the other nucleobases in the modified oligonucleotide are unmodified nucleobases.

[0198] In certain embodiments, the oligonucleotide with a spacer motif comprises a nucleoside comprising a modified core base. In certain embodiments, a nucleoside comprising a modified core base is positioned in the central gap of the oligonucleotide with a spacer motif. In certain embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety.

[0199] 3. Certain internucleoside linkage motifs

[0200] In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside bonds arranged in a defined pattern or motif along the oligonucleotide or its region. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside bond (P=O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate internucleoside bond (P=S). In certain embodiments, each internucleoside bond of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside bond and a phosphodiester internucleoside bond. In certain embodiments, each phosphorothioate internucleoside bond is independently selected from stereoatactic phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0201] In certain embodiments, the sugar motif of the modified oligonucleotide is a spacer, and the internucleoside bonds in the gap are all modified. In certain such embodiments, some or all of the internucleoside bonds in the internucleoside bonds in the wing are unmodified phosphodiester internucleoside bonds. In certain embodiments, the terminal internucleoside bond is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a spacer, and the internucleoside bond motif comprises at least one phosphodiester internucleoside bond in at least one wing, wherein the at least one phosphodiester bond is not a terminal internucleoside bond, and the remaining internucleoside bonds are thiophosphate internucleoside bonds. In certain such embodiments, all thiophosphate bonds in the thiophosphate bond are stereoatactic. In certain embodiments, the group enrichment of modified oligonucleotide comprises modified oligonucleotides of such internucleoside bond motifs.

[0202] In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif of (from 5' to 3')soooossssssssssooss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0203] C. Population of modified oligonucleotides

[0204] A population of modified oligonucleotides (wherein all modified oligonucleotides in the population of modified oligonucleotides have the same molecular formula) can be a stereo-random population or a chirally enriched population. In a stereo-random population, all chiral centers of all chiral centers in the modified oligonucleotides are stereo-random. In a chirally enriched population, at least one specific chiral center in the modified oligonucleotides of the population is not stereo-random. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in β-D ribosyl sugar moieties, and all thiophosphate internucleoside bonds in the thiophosphate internucleoside bonds are stereo-random. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched in both β-D ribosyl sugar moieties and at least one specific thiophosphate internucleoside bond in a specific stereochemical configuration.

[0205] D. Nucleobase sequence

[0206] In certain embodiments, oligonucleotide (unmodified or modified oligonucleotide) is further described by its core base sequence.In certain embodiments, oligonucleotide has the core base sequence complementary to the second oligonucleotide or the reference nucleic acid (such as, target nucleic acid) through identification.In some such embodiments, the district of oligonucleotide has the core base sequence complementary to the second oligonucleotide or the reference nucleic acid (such as, target nucleic acid) through identification.In certain embodiments, the district of oligonucleotide or the core base sequence of total length and the second oligonucleotide or nucleic acid (such as, target nucleic acid) at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary.

[0207] II. Certain oligomeric compounds

[0208] In certain embodiments, oligomeric compounds are provided herein, which are composed of oligonucleotides (modified or unmodified) and optional one or more conjugate groups and / or terminal groups. The conjugate group is composed of one or more conjugate moieties and a conjugate linker connecting the conjugate moiety to the oligonucleotide. The conjugate group can be attached to either end or both ends of the oligonucleotide and / or attached to any internal position. In certain embodiments, the conjugate group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate group attached to either end or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3' end and / or 5' end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0209] A. Certain conjugate groups

[0210] In certain embodiments, the oligonucleotide is covalently attached to one or more conjugate groups. In certain embodiments, the conjugate group alters one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0211] In certain embodiments, the conjugation of one or more carbohydrate moieties to modified oligonucleotide can change one or more characteristics of modified oligonucleotide. In certain embodiments, carbohydrate moieties are attached to the modified subunit of modified oligonucleotide. For example, the ribose of one or more ribonucleotide subunits of modified oligonucleotide can be replaced by another part (for example, a non-carbohydrate (preferably cyclic) carrier attached with a carbohydrate ligand). The ribose of the subunit has been referred to as ribose replacement modified subunit (RRMS) in this article through the ribonucleotide subunit so replaced, which is a modified sugar moiety. Annular carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be heteroatoms, such as nitrogen, oxygen, sulfur. Annular carrier can be a monocyclic ring system, or can contain two or more rings, such as fused rings. Annular carrier can be a completely saturated ring system, or it can contain one or more double bonds. In certain embodiments, modified oligonucleotide is a spacer.

[0212] In certain embodiments, the conjugate group confers new properties to the attached oligonucleotide, for example, a fluorophore or reporter group that enables detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been previously described, for example, cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, for example, hexyl-S-tritylthiol (Manoharan et al., Ann. N. Am. Am., 1994, 3, 1053-1060), and oligomers such as thioether ... Y Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, for example, dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids, for example, di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973) or an adamantaneacetic acid palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740) or a GalNAc cluster (e.g., WO 2014 / 179620).

[0213] In certain embodiments, the conjugate group can be selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0214] In certain embodiments, the conjugate group can be selected from any of the following: C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0215] In certain embodiments, the conjugate group has the structure:

[0216]

[0217] 1. Conjugate part

[0218] Conjugate moieties include, but are not limited to, intercalators, reporters, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, bile acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0219] In certain embodiments, the conjugate portion comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepam, Indomethacin, barbiturates, cephalosporins, sulfonamides, antidiabetic drugs, antibacterial drugs, or antibiotics.

[0220] 2. Conjugate linker

[0221] The conjugate moiety is attached to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly attached to the oligonucleotide via a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbon chain, or an oligomer of repeating units, such as ethylene glycol, nucleoside, or amino acid units.

[0222] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0223] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0224] In certain embodiments, the conjugate linker (including the conjugate linker described above) is a bifunctional linking portion, for example, a bifunctional linking portion known in the art that can be used to attach the conjugate portion to a compound (such as, an oligonucleotide provided herein). Generally speaking, the bifunctional linking portion comprises at least two functional groups. One of the functional groups is selected to be bound to a specific site on the compound, and the other functional group is selected to be bound to the conjugate group. Examples of the functional groups used in the bifunctional linking portion include, but are not limited to, an electrophilic reagent for reacting with a nucleophilic group and a nucleophilic reagent for reacting with an electrophilic group. In certain embodiments, the bifunctional linking portion comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl and alkynyl.

[0225] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), 4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid succinimidyl ester (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C2-C 10 Alkynyl, where a non-limiting list of preferred substituents includes hydroxy, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halo, alkyl, aryl, alkenyl, and alkynyl.

[0226] In certain embodiments, the conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, the conjugate linker comprises 1-5 linker nucleosides. In certain embodiments, the conjugate linker comprises 1-3 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise a modified sugar moiety. In certain embodiments, the linker nucleoside is unmodified. In certain embodiments, the linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from the group consisting of uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, the nucleoside is cracked from the oligomeric compound after the nucleoside arrives at the target tissue. Therefore, the nucleoside is typically connected to one another and to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, the nucleoside is typically cracked from the oligomeric compound by a cleavable bond.

[0227] Herein, linker nucleosides are not considered to be part of an oligonucleotide. Therefore, in the embodiment in which the oligomeric compound comprises an oligonucleotide consisting of a specified number or range of connected nucleosides and / or a specified complementarity percentage with a reference nucleic acid, and the oligomeric compound further comprises a conjugate group containing a conjugate linker (the conjugate linker comprises a linker nucleoside), those linker nucleosides are not counted in the length of the oligonucleotide and are not used to determine the complementarity percentage of the oligonucleotide with the reference nucleic acid. For example, the oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides; and (2) a conjugate group comprising 1 to 10 linker nucleosides that are continuous with the nucleosides of the modified oligonucleotide. The total number of nucleosides connected continuously in such an oligomeric compound exceeds 30. Alternatively, the oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and not containing a conjugate group. The total number of nucleosides connected continuously in such an oligomeric compound does not exceed 30. Unless otherwise stated, the conjugate linker comprises no more than 10 linker nucleosides. In certain embodiments, the conjugate linker comprises no more than 5 linker nucleosides. In certain embodiments, the conjugate linker comprises no more than 3 linker nucleosides. In certain embodiments, the conjugate linker comprises no more than 2 linker nucleosides. In certain embodiments, the conjugate linker comprises no more than 1 linker nucleoside.

[0228] In certain embodiments, it is necessary to crack the conjugate group from the oligonucleotide. For example, in some cases, the oligomeric compound comprising a specific conjugate portion is better absorbed by a specific cell type, but once the oligomeric compound has been absorbed, it is necessary to crack the conjugate group to release unconjugated or parent oligonucleotide. Therefore, some conjugate linkers may include one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group comprising at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group with one, two, three, four or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cracked in a cell or subcellular compartment (such as a lysosome). In certain embodiments, the cleavable moiety is selectively cracked by an endogenous enzyme (such as a nuclease).

[0229] In certain embodiments, the cleavable bond is selected from one or both esters of amides, esters, ethers, phosphodiester, phosphate, carbamate and disulfide. In certain embodiments, the cleavable bond is one or both esters of phosphodiester. In certain embodiments, the cleavable portion comprises phosphate or phosphodiester. In certain embodiments, the cleavable portion is the phosphate bond between the oligonucleotide and the conjugate portion or the conjugate group.

[0230] In certain embodiments, the cleavable moiety comprises one or more joint nucleosides or is made up of one or more joint nucleosides.In certain such embodiments, the one or more joint nucleosides are connected to each other and / or to the remainder of the oligomeric compound by a cleavable bond.In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds.In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside, which is attached to the 3' end or 5' end nucleoside of the oligonucleotide by a phosphate internucleoside bond, and is covalently attached to the remainder of the conjugate joint or conjugate part by a phosphate bond or a phosphorothioate bond.In certain such embodiments, the cleavable moiety is a 2'-deoxyadenosine.

[0231] 3. Cell targeting moiety

[0232] In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula:

[0233]

[0234] wherein n is 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

[0235] In some embodiments, n is 1, j is 1, and k is 0. In some embodiments, n is 1, j is 0, and k is 1. In some embodiments, n is 1, j is 1, and k is 1. In some embodiments, n is 2, j is 1, and k is 0. In some embodiments, n is 2, j is 0, and k is 1. In some embodiments, n is 2, j is 1, and k is 1. In some embodiments, n is 3, j is 1, and k is 0. In some embodiments, n is 3, j is 0, and k is 1. In some embodiments, n is 3, j is 1, and k is 1.

[0236] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethering ligand. In certain embodiments, the cell targeting moiety comprises two tethering ligands covalently attached to a branching group. In certain embodiments, the cell targeting moiety comprises three tethering ligands covalently attached to a branching group.

[0237] In certain embodiments, the cell targeting moiety targets neurons. In certain embodiments, the cell targeting moiety targets neurotransmitter receptors. In certain embodiments, the cell targeting moiety targets neurotransmitter transporters. In certain embodiments, the cell targeting moiety targets GABA transporters. See, e.g., WO 2011 / 131693, WO 2014 / 064257.

[0238] In certain embodiments, the conjugate group comprises a cell targeting moiety with affinity for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, the conjugate group described herein comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof may be any antibody or fragment thereof known in the art, including but not limited to the antibodies or fragments thereof described in the following documents: WO 1991 / 004753; WO2 013 / 103800; WO 2014 / 144060; WO 2016 / 081643; WO 2016 / 179257; WO 2016 / 207240; WO 2017 / 221883; WO 2018 / 129384; WO 2018 / 124121; WO 2019 / 151539; WO2020 / 132584; WO 2020 / 028864; US7,208,174; US9,034,329; and US10,550,188. In certain embodiments, the fragment of the anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv.

[0239] In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the protein or peptide capable of binding to TfR1 can be any protein or peptide known in the art, including but not limited to those described in the following documents: WO 2019 / 140050; WO 2020 / 037150; WO 2020 / 124032; and US10,138,483.

[0240] In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the aptamer capable of binding to TfR1 can be any aptamer known in the art, including but not limited to the aptamers described in the following documents: WO2013 / 163303; WO 2019 / 033051; and WO 2020 / 245198.

[0241] B. Certain terminal groups

[0242] In certain embodiments, the oligomeric compound comprises one or more terminal groups. Examples of terminal groups include, but are not limited to, conjugate groups, blocking groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides. In certain such embodiments, the oligomeric compound comprises a stable 5'-phosphate. Stable 5'-phosphates include, but are not limited to, 5'-phosphonates, including but not limited to 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-connected nucleosides or sugar moieties. In certain such embodiments, the 2'-connected group is an abasic sugar moiety.

[0243] III. Antisense activity

[0244] In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of hybridizing to a target nucleic acid, thereby producing at least one antisense activity; such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, an antisense agent has antisense activity when it reduces or inhibits the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, an antisense agent selectively affects one or more target nucleic acids. Such antisense agents comprise a nucleobase sequence that hybridizes with one or more target nucleic acids to produce one or more desired antisense activities and does not hybridize with one or more non-target nucleic acids, or does not hybridize with one or more non-target nucleic acids in a manner that produces a large amount of undesirable antisense activity.

[0245] In some antisense activities, hybridization of an antisense agent or a portion of an antisense agent with a target nucleic acid results in the recruitment of proteins that crack the target nucleic acid. For example, some antisense agents result in RNase H-mediated cracking of the target nucleic acid. RNase H is a cellular endonuclease that cracks and cuts the RNA strand of an RNA:DNA duplex. The DNA in this RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, described herein are antisense agents comprising antisense oligomeric compounds that comprise enough "DNA-like" spacer antisense oligonucleotides to trigger RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of the spacer are tolerated.

[0246] In certain antisense activities, an antisense agent or a portion of an antisense agent is loaded into an RNA-induced silencing complex (RISC), ultimately leading to the cracking of the target nucleic acid. For example, certain antisense agents cause the target nucleic acid to be cracked by the AGO protein (Argonaute). The antisense agent loaded into the RISC is an RNAi agent. The RNAi agent can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).

[0247] In certain embodiments, the hybridization of antisense agents or a portion thereof with a target nucleic acid does not result in the recruitment of proteins that crack the target nucleic acid. In certain embodiments, the hybridization of antisense agents or a portion thereof with a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, the hybridization of antisense agents or a portion thereof with a target nucleic acid results in the inhibition of the binding interactions between the target nucleic acid and a protein or other nucleic acids. In certain embodiments, the hybridization of antisense agents or a portion thereof with a target nucleic acid results in a change in the translation of the target nucleic acid.

[0248] Antisense activity can be observed directly or indirectly. In certain embodiments, observation or detection of antisense activity involves observation or detection of changes in the amount of target nucleic acid or a protein encoded by such a target nucleic acid, changes in the ratio of splice variants of the nucleic acid or protein, and / or changes in the phenotypic characteristics of a cell or animal.

[0249] IV. Certain target nucleic acids

[0250] In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from the group consisting of mature mRNA and pre-mRNA, including intronic regions, exonic regions, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron.

[0251] A. MECP2

[0252] In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is a MECP2 nucleic acid. In certain embodiments, the MECP2 nucleic acid has the nucleobase sequence set forth in SEQ ID NO: 1 (GenBank Accession No. NC_000023.11 truncated from nucleosides 154019001 to 154101000) or SEQ ID NO: 2 (GenBank Accession No. NM_004992.3). In certain embodiments, contacting a cell with an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of MECP2 RNA, and in certain embodiments, reduces the amount of MECP2 protein. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent consists of a modified oligonucleotide and a conjugate group.

[0253] In certain embodiments, contacting a cell with an oligomeric compound, oligoduplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of MECP2 RNA in the cell. In certain embodiments, contacting a cell with an oligomeric compound, oligoduplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of MECP2 protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, contacting a cell from a subject with an oligomeric compound, oligoduplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 improves one or more symptoms or hallmarks of a neurodegenerative disease or condition associated with MECP2. In certain embodiments, the neurodegenerative disease or condition associated with MECP2 is MECP duplication syndrome. In certain embodiments, the symptom or hallmark is any one of autism, intellectual disability, motor dysfunction, hypotonia, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and early death.

[0254] In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents complementary to SEQ ID NO: 1 or SEQ ID NO: 2 are capable of reducing the in vitro detectable amount of MECP2 RNA in a standard cell assay by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents complementary to SEQ ID NO: 1 or SEQ ID NO: 2 are capable of reducing the in vitro detectable amount of MECP2 protein by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds, oligomeric duplexes, or antisense agents complementary to SEQ ID NO: 1 or SEQ ID NO: 2 are capable of reducing the in vitro detectable amount of MECP2 RNA in a standard cell assay by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0255] In some embodiments, the oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of MECP2 protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of MECP2 RNA in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectable amount of MECP2 protein in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0256] B. Certain target nucleic acids in certain tissues

[0257] In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is the brain and spinal cord. In certain embodiments, the target nucleic acid is expressed in a pharmacologically relevant cell. In certain embodiments, the pharmacologically relevant cell is a MECP2 expressing cell. In certain embodiments, the pharmacologically relevant cell is a neuron or a glial cell. In certain embodiments, the pharmacologically relevant cell is a neuronal cell. In certain embodiments, the pharmacologically relevant cell is an astrocyte, an oligodendrocyte, or a microglia.

[0258] IV. Certain methods and uses

[0259] Certain embodiments provided herein relate to methods for reducing or inhibiting MECP2 expression or activity, which can be used to treat, prevent, or ameliorate a disease or condition associated with overexpression of MECP2 in a subject by administering an oligomeric compound, oligomeric duplex, or antisense agent (any of which comprises a modified oligonucleotide having a nucleobase sequence complementary to a MECP2 nucleic acid). In certain embodiments, the disease or condition associated with overexpression of MECP2 is a neurodegenerative disease or condition. In certain embodiments, the neurodegenerative disease or condition is MECP2 duplication syndrome.

[0260] In certain embodiments, the method comprises administering to the subject an oligomeric compound, oligomeric duplex, or antisense agent (any of which has a nucleobase sequence complementary to a MECP2 nucleic acid). In certain embodiments, the subject has or is at risk for MECP2 duplication syndrome.

[0261] In certain embodiments, a method of treating a neurodegenerative disease or condition associated with MECP2 comprises administering to a subject a therapeutically effective amount of an oligomeric compound, oligomeric duplex, or antisense agent, any of which has a nucleobase sequence complementary to MECP2, thereby treating the subject. In certain embodiments, the subject suffers from or is at risk of suffering from a neurodegenerative disease or condition associated with MECP2. In certain embodiments, the disease or condition is associated with elevated levels of MECP2 in the subject.

[0262] In certain embodiments, the subject has or is at risk for MECP2 duplication syndrome. In certain embodiments, at least one symptom or hallmark of a neurodegenerative disease or condition associated with MECP2 duplication syndrome is ameliorated. Exemplary symptoms or hallmarks include, but are not limited to, autism, intellectual disability, motor dysfunction, hypotonia, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and early death.

[0263] In certain embodiments, methods for reducing the expression of a MECP2 nucleic acid (e.g., RNA) or reducing the expression of a MECP2 protein in a cell comprise administering to a subject an oligomeric compound, oligoduplex, or antisense agent (any of which has a nucleobase sequence complementary to MECP2), thereby inhibiting the expression of a MECP2 nucleic acid in the subject. In certain embodiments, administration of an oligomeric compound, oligoduplex, or antisense agent inhibits the expression of MECP2 in the brain or spinal cord of the subject. In certain embodiments, the subject suffers from or is at risk of suffering from a neurological disease or disorder associated with MECP2. In certain embodiments, the subject suffers from or is at risk of suffering from a MECP2 duplication syndrome.

[0264] In certain embodiments, the method of inhibiting the expression of MECP2 nucleic acid in a cell comprises contacting the cell with an oligomeric compound, an oligomeric duplex, or an antisense agent (any of which has a nucleobase sequence complementary to MECP2), thereby inhibiting the expression of MECP2 nucleic acid in the cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell is a neuron or a glial cell (e.g., an astrocyte, an oligodendrocyte, a microglia). In certain embodiments, the cell is obtained from a subject, e.g., a subject suffering from or at risk of developing a disease or condition associated with MECP2. In certain embodiments, the cell is in a subject suffering from a disease or condition associated with MECP2 (such as, MECP2 duplication syndrome).

[0265] In certain embodiments, the method of reducing the expression of MECP2 (e.g., MECP2 RNA) or reducing the expression of MECP2 protein in a cell comprises contacting the cell with an oligomeric compound, an oligomeric duplex, or an antisense agent, any of which has a nucleobase sequence complementary to ATN1. In certain embodiments, the subject suffers from or is at risk for MECP2 duplication syndrome (MDS). In certain embodiments, the subject suffers from MDS. In certain embodiments, the cell is a neuron or a glial cell. In certain embodiments, the cell is a human cell.

[0266] Certain embodiments relate to oligomeric compounds, oligomeric duplexes, or antisense agents, any of which have a nucleobase sequence complementary to a MECP2 nucleic acid, for use in treating a disease or condition associated with elevated MECP2 signaling or overexpression of MECP2. In certain embodiments, the disease or condition is MECP2 duplication syndrome. In certain embodiments, the oligomeric compounds, oligomeric duplexes, or antisense agents are for use in ameliorating a symptom or marker of a disease or condition associated with MECP2 duplication syndrome. In certain embodiments, the symptom or marker is selected from autism, intellectual disability, motor dysfunction, hypotonia, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and early death. In certain embodiments, the oligomeric compounds, modified oligonucleotides, oligomeric duplexes, or antisense agents are for use in reducing MECP2 expression in a subject.

[0267] Certain embodiments relate to oligomeric compounds, oligomeric duplexes, or antisense agents, any of which comprises a modified oligonucleotide having a nucleobase sequence complementary to a MECP2 nucleic acid, for use in the manufacture or preparation of a medicament for treating a disease associated with MECP2. In certain embodiments, the disease is MECP2 duplication syndrome. In certain embodiments, the oligomeric compounds, oligomeric duplexes, or antisense agents are used in the manufacture or preparation of a medicament for ameliorating a symptom or marker associated with MECP2 duplication syndrome. In certain embodiments, the symptom or marker is selected from autism, intellectual disability, motor dysfunction, hypotonia, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and early death. In certain embodiments, the oligomeric compounds, oligomeric duplexes, or antisense agents are used in the manufacture or preparation of a medicament for use in reducing MECP2 expression in a subject.

[0268] In any of the methods or uses described herein, the oligomeric compound, oligomeric duplex, or antisense agent can be any oligomeric compound, oligomeric duplex, or antisense agent described herein.

[0269] V. Certain pharmaceutical compositions

[0270] In certain embodiments, pharmaceutical compositions comprising one or more oligomeric compounds are described herein. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the one or more oligomeric compounds are each composed of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises a sterile saline solution and one or more oligomeric oligomeric compounds or consists of a sterile saline solution and one or more oligomeric oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and sterile water or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and phosphate buffered saline (PBS) or consists of one or more oligomeric compounds and phosphate buffered saline. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF") or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid.

[0271] In certain embodiments, the pharmaceutical composition comprises an oligomeric compound and a PBS. In certain embodiments, the pharmaceutical composition consists of an oligomeric compound and a PBS. In certain embodiments, the pharmaceutical composition consists essentially of an oligomeric compound and a PBS. In certain embodiments, the PBS is pharmaceutical grade.

[0272] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and a PBS. In certain embodiments, the pharmaceutical composition is composed of a modified oligonucleotide and a PBS. In certain embodiments, the pharmaceutical composition is essentially composed of a modified oligonucleotide and a PBS. In certain embodiments, the PBS is pharmaceutical grade.

[0273] In certain embodiments, the pharmaceutical composition comprises an oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of an oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of an oligomeric compound and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0274] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and aCSF. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and aCSF. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and aCSF. In certain embodiments, the aCSF is pharmaceutical grade. In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, anhydrous sodium hydrogen phosphate, calcium chloride dihydrate, and magnesium chloride hexahydrate. The pH of the aCSF solution is adjusted to a range of about 7.1 to 7.3 or to about 7.2 using a suitable pH adjusting agent (e.g., an acid such as hydrochloric acid and a base such as sodium hydroxide).

[0275] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In certain embodiments, the excipient is selected from water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl cellulose and polyvinyl pyrrolidone.

[0276] In certain embodiments, the oligomeric compound can be mixed with pharmaceutically acceptable active and / or inert substances for the preparation of pharmaceutical compositions or formulations. The composition and formulation of the pharmaceutical composition depends on many criteria, including but not limited to the route of administration, the extent of the disease, or the dosage administered.

[0277] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds encompass any pharmaceutically acceptable salts of oligomeric compounds; esters of oligomeric compounds; or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more modified oligonucleotides are capable of (directly or indirectly) providing their biologically active metabolites or residues when administered to a subject (including a human subject). Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents of oligomeric compounds. In certain embodiments, pharmaceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium salts, potassium salts, calcium salts, and magnesium salts. In certain embodiments, prodrugs include one or more conjugate groups attached to oligonucleotides, wherein the conjugate groups are cleaved by endogenous nucleases in the body.

[0278] In certain embodiments, the oligomeric compound is lyophilized and isolated as a sodium salt. In certain embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of the oligomeric compound is mixed with PBS. In certain embodiments, the sodium salt of the oligomeric compound is mixed with aCSF. In certain embodiments, the sodium salt of the oligomeric compound is a sodium salt of a modified oligonucleotide.

[0279] Lipid moieties have been used in nucleic acid therapy in a variety of ways. In some such methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or liposome complexes (lipoplexes) made from a mixture of cationic lipids and neutral lipids. In some methods, DNA complexes with single or multiple cationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of medicaments to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of medicaments to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of medicaments to muscle tissue.

[0280] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0281] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules that are designed to deliver one or more agents comprising the oligomeric compounds provided herein to specific tissues or cell types. For example, in certain embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.

[0282] In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Some of such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which comprises 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant polysorbate 80. TM and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such cosolvent systems can be varied considerably without significantly changing their solubility and toxicity properties. In addition, the properties of the cosolvent components may be varied: for example, other surfactants may be used instead of polysorbate 80. TM ; The fraction size of polyethylene glycol may vary; other biocompatible polymers can replace polyethylene glycol, for example, polyvinylpyrrolidone; and other sugars or polysaccharides can replace glucose.

[0283] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hanks solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that contribute to solubility or serve as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Some pharmaceutical compositions for injection are present in unit dosage forms, such as in ampoules or in multidose containers. Some pharmaceutical compositions for injection are oily or aqueous vehicles containing suspensions, solutions, or emulsions, and may contain preparatons, such as suspending agents, stabilizers, and / or dispersants. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils, such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0284] Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds can be drawn or described in protonated (free acid) form, or ionized and associated with a cationic (salt) form, aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate bond of an oligonucleotide in an aqueous solution exists in equilibrium between the free acid, anionic, and salt forms. Unless otherwise specified, the compounds described herein are intended to include all such forms. In addition, some oligonucleotides have multiple such bonds, each of which is in equilibrium. Therefore, the oligonucleotide in solution exists in multiple forms at multiple locations, all in equilibrium. The term "oligonucleotide" is intended to include all such forms. The drawn structure necessarily depicts a single form. However, unless otherwise specified, such drawings are also intended to include corresponding forms. In this article, the structure depicting the free acid of a compound followed by the term "or its salt" or "or its pharmaceutically acceptable salt" explicitly includes all such forms that can be fully or partially protonated / deprotonated / associated with a cation or a combination of cations. In certain embodiments, one or more specific cations are identified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, a structure describing the free acid of a compound followed by the term "or a pharmaceutically acceptable salt thereof" expressly includes all such forms that may be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0285] In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution together with sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted to reach the desired pH with NaOH and / or HCl.

[0286] Certain specific dosages are described herein. The dosage can be in the form of dosage units. For clarity, the dosage (or dosage unit) of the modified oligonucleotide or oligomeric compound in milligrams represents the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As mentioned above, in aqueous solution, the free acid is in equilibrium with the anion and salt form. However, for the purpose of calculating dosage, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium acetate-free, anhydrous, free acid.

[0287] For example, when a modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with sodium ions. However, the mass of the protons is still included in the weight of the dose, and the mass of the sodium ions is not included in the weight of the dose. Thus, for example, a 10 mg dose or dosage unit of Compound No. 1435454 is equal to the number of fully protonated molecules weighing 10 mg. This is equivalent to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodium-degraded Compound No. 1435454.

[0288] In certain embodiments, where the modified oligonucleotide or oligomeric compound is in a solution containing sodium, potassium, calcium, and magnesium (such as aCSF), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with the sodium, potassium, calcium, and / or magnesium. However, the mass of the protons is still included in the weight of the dose, and the mass of the sodium, potassium, calcium, and magnesium ions is not included in the weight of the dose.

[0289] In certain embodiments, when an oligomeric compound comprises a conjugate group, the mass of the conjugate group is included in calculating the dose of such oligomeric compound. If the conjugate group also has an acid, the conjugate group is also assumed to be fully protonated for the purpose of calculating the dose.

[0290] Non-Limiting Disclosure and Incorporation by Reference

[0291] Each of the literature and patent publications listed herein is incorporated by reference in its entirety.

[0292] Although certain compounds, compositions and methods described herein have been specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to limit them. Each of the references, GenBank accession numbers, etc. cited in this application is incorporated herein by reference in its entirety.

[0293] Herein, descriptions of compounds having a nucleobase sequence of a SEQ ID NO "describe only the nucleobase sequence. Thus, in the absence of additional description, such descriptions of compounds by reference to the nucleobase sequence of a SEQ ID NO do not limit the presence or absence of sugar or internucleoside linkage modifications or additional substituents (such as conjugate groups). Further, in the absence of additional description, the nucleobases of the compounds having a nucleobase sequence of a SEQ ID NO "include such compounds having modified forms of the identified nucleobases as described herein.

[0294] The sequence listing accompanying this application identifies each sequence as "RNA" or "DNA" as needed; however, those skilled in the art will readily understand that such nomenclature as "RNA" or "DNA" used to describe modified oligonucleotides is arbitrary in some cases. For example, an oligonucleotide comprising a nucleoside comprising a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar moiety (2'-OH replaces one 2'-H of DNA) or as an RNA with a modified base (thymine (methylated uracil) replaces uracil of RNA); and certain nucleic acid compounds described herein comprise one or more nucleosides comprising a modified sugar moiety having a 2'-substituent that is neither OH nor H. Those skilled in the art will readily understand that labeling such nucleic acid compounds as "RNA" or "DNA" does not change or limit the description of such nucleic acid compounds. Therefore, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to cover nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleobases, unless otherwise indicated. As a further example and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including but not limited to such RNA base-containing compounds, such as, compounds having the sequence "AUCGAUCG" and compounds having some DNA bases and some RNA bases, such as, "AUCGATCG"; as well as compounds having other modified nucleobases, such as, "ATCGATCG"; m CGAUCG", where m C represents an oligomeric compound comprising a cytosine base comprising a methyl group at the 5-position). Finally, for clarity, unless otherwise indicated, the phrase "the nucleobase sequence of SEQ ID NO: X" refers only to the sequence of the nucleobases in that SEQ ID NO: X, without regard to any sugar or internucleoside linkage modifications also depicted in such SEQ ID.

[0295] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β (such as for sugar anomers), or as (D) or (L) (such as for amino acids, etc.). Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Unless otherwise indicated, compounds provided herein that are drawn or described with undefined stereochemistry include all such possible isomers, including their stereo-random and optically pure forms. Similarly, unless otherwise indicated, all cis- and trans-isomers and tautomeric forms of the compounds herein are also included. The oligomeric compounds described herein include chirally pure or enriched mixtures and racemic mixtures. For example, oligomeric compounds having multiple phosphorothioate internucleoside bonds include such compounds in which the chirality of the phosphorothioate internucleoside bonds is controlled or random. Unless otherwise stated, compounds described herein are intended to include the corresponding salt forms.

[0296] In this document, unless otherwise indicated, descriptions of compounds by chemical symbols (subscripts and / or superscripts indicating chemical modifications) do not refer to specific compound numbers, only include each indicated modification, and may include additional substituents, such as conjugate groups. For example, the chemical symbol "A es T ko m C ez G ds C" represents a compound wherein the first nucleoside comprises a 2'-MOE sugar moiety (indicated by an "e" subscript) and an unmodified adenine nucleobase linked to a second nucleoside via a phosphorothioate bond (indicated by an "s" subscript); the second nucleoside comprises a cEt sugar moiety (indicated by a "k" subscript) and an unmodified thymine nucleobase linked to a third nucleoside via a phosphodiester bond (indicated by an "o" subscript); the third nucleoside comprises a 2'-MOE sugar moiety and an unmodified thymine nucleobase linked to a third nucleoside via a phosphodiester bond (indicated by an "o" subscript); (represented by the "z" subscript) a 5-methyl modified cytosine nucleobase (represented by the "m" superscript) linked to a fourth nucleoside; the fourth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety (represented by the "d" subscript) and an unmodified guanine nucleobase linked to a fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound may comprise additional substituents, such as, a conjugate group.

[0297] Herein, where a specific compound is described by chemical symbols (e.g., with reference to a compound number), each nucleobase, sugar, and internucleoside linkage of such specific compound is modified only as indicated. Thus, in the context of a description of a particular compound having a specific compound number, "A es T ko m C ez G ds C" represents a compound wherein the first nucleoside comprises a 2'-MOE sugar moiety (indicated by the "e" subscript) and an unmodified adenine nucleobase linked to a second nucleoside via a phosphorothioate bond (indicated by the "s" subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the "k" subscript) and an unmodified thymine nucleobase linked to a third nucleoside via a phosphodiester bond (indicated by the "o" subscript); the third nucleoside comprises a 2'-MOE sugar moiety and an unmodified thymine nucleobase linked to a third nucleoside via a phosphodiester bond (indicated by the "o" subscript). The invention relates to a compound comprising a 5-methyl modified cytosine nucleobase (represented by an "m" superscript) linked to a fourth nucleoside by a 2'-β-D-deoxyribosyl sugar moiety (represented by a "z" subscript); the fourth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety (represented by a "d" subscript) and an unmodified guanine nucleobase linked to a fifth nucleoside by a phosphorothioate bond; and the fifth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound comprises no additional substituents.

[0298] Sugar, internucleoside linkage, and nucleobase modifications may be indicated herein within a nucleotide or nucleobase sequence (e.g., by superscript or subscript indications, as indicated above) or may be indicated in text accompanying the sequence (e.g., in separate text appearing within, above, or below the compound table).

[0299] Where a particular compound is depicted herein by a drawn chemical structure, each nucleobase, sugar, and internucleoside linkage of such a particular compound includes only the modifications indicated in the drawn chemical structure. However, one skilled in the art will appreciate that the drawn compound may exist in equilibrium between tautomeric forms and / or as salts in equilibrium with protonated or ionic forms. The drawn structures are intended to capture all such forms of such compounds.

[0300] While efforts have been made to accurately describe the compounds in the appended sequence listing, if there is any discrepancy between the description in this specification and the description in the appended sequence listing, the description in the specification rather than in the sequence listing is the accurate description.

[0301] The compounds described herein include variants in which one or more atoms are replaced by non-radioactive isotopes or radioactive isotopes of the indicated elements. For example, a compound herein containing a hydrogen atom encompasses each 1All possible deuterium substitutions of H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include, but are not limited to: 2 H or 3 H instead 1 H. 13 C or 14 C instead 12 C. 15 N instead 14 N. 17 O or 18 O instead 16 O, and 33 S. 34 S. 35 S or 36 S instead 32 In certain embodiments, non-radioactive isotope substitutions can impart novel properties to oligomeric compounds that are useful as therapeutic or research tools. In certain embodiments, radioactive isotope substitutions can render the compounds suitable for research or diagnostic purposes, such as imaging.

[0302] Examples

[0303] The following examples illustrate certain embodiments of the present disclosure and are not restrictive. In addition, when specific embodiments are provided, the inventors have considered the general application of those specific embodiments. For example, the disclosure of oligonucleotides with specific motifs provides reasonable support for additional oligonucleotides with identical or similar motifs. And, for example, when specific high-affinity modifications occur at specific positions, other high-affinity modifications at the same position are considered to be suitable, unless otherwise stated.

[0304] Example 1: Effect of a 5-10-5 MOE spacer complementary to human MECP2 RNA (in vitro, single dose)

[0305] Modified oligonucleotides complementary to human MECP2 nucleic acid were designed and tested for single-dose effects on MECP2 RNA in vitro.

[0306] The modified oligonucleotides in the table below are 5-10-5MOE spacers with mixed PO / PS bonds. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5' to 3'): eeeeeddddddddddeeeee; wherein each "e" represents a 2'-MOE ribosyl sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. The internucleoside bond motif for the modified oligonucleotides is (from 5' to 3'): sooooosssssssssooss; wherein each "s" represents a phosphorothioate internucleoside bond, and each "o" represents a phosphodiester bond. Each cytosine residue is 5-methylcytosine.

[0307] The modified oligonucleotides listed in the table below are 100% complementary to SEQ ID NO: 1 (the complementary sequence of GenBank Accession No. NC_000023.11 truncated from nucleosides 154019001 to 154101000), to SEQ ID NO: 2 (GenBank Accession No. NM_004992.3), or to both. "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. "Stop site" indicates the 3'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0308] A431 cells were treated with modified oligonucleotides at a concentration of 4,000 nM by free uptake at a density of 10,000 cells per well. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and MECP2 RNA levels were measured by quantitative real-time RT-PCR. MECP2 RNA levels were measured by human primer-probe set RTS37209 (forward sequence CAAGGCCAAACAGAGAGGA, designated herein as SEQ ID NO: 3; reverse sequence TTGTCAGAGCCCTACCCATA, designated herein as SEQ ID NO: 4; probe sequence AGAATAAAGGCAGCTGTTGTCTCTTCTCC, designated herein as SEQ ID NO: 5). MECP2 RNA levels were relative to those measured by The measurements were normalized to total RNA levels. The reduction in MECP2 RNA is presented in the table below as percent MECP2 RNA (% UTC) relative to the amount of MECP2 RNA in untreated control cells.

[0309] Table 1

[0310] Reduction of MECP2 RNA by 5-10-5MOE modified oligonucleotides with mixed PO / PS internucleoside linkages in A431 cells

[0311]

[0312] Example 2: Effects of modified oligonucleotides on human MECP2 (in vitro, multiple doses)

[0313] The modified oligonucleotides were tested at various doses in A431 cells. A431 cells plated at a density of 10,000 cells per well were treated with modified oligonucleotides at concentrations as shown in the table below by free uptake. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and MECP2 RNA levels were measured by quantitative real-time RTPCR. Human MECP2 primer-probe RTS37209 (described above) was used to measure RNA levels as described above. MECP2 RNA levels were relative to those as described by The measured total RNA content was normalized. The reduction of MECP2 RNA is presented in the table below as the percentage of MECP2 RNA relative to untreated control cells (%UTC). The half-maximal inhibitory concentration (IC) of the modified oligonucleotide was calculated using linear regression of the log / linear plot of the data in Excel. 50 ), which are also presented in the table below. Each experiment is presented in a separate table.

[0314] Table 2 Dose-dependent reduction of human MECP2 RNA in A431 cells by modified oligonucleotides

[0315]

[0316] Example 3: Effects of modified oligonucleotides on human MECP2 (in vitro, multiple doses)

[0317] The modified oligonucleotides were tested at various doses in SH-SY5Y cells. Compound No. 1435454 described above is a oligonucleotide having the nucleobase sequence (from 5' to 3') GCAACATTTTCAGTTTCAGC (SEQ ID wherein each nucleoside in nucleosides 1 to 5 and 16 to 20 (from 5' to 3') is a 2'-MOE nucleoside, and each nucleoside in nucleosides 6 to 15 is a 2'-β-D-deoxynucleoside, wherein the internucleoside linkage between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 16 to 17, and 17 to 18 is a phosphodiester internucleoside linkage, the internucleoside linkage between nucleosides 1 to 2, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 is a phosphorothioate internucleoside linkage, and wherein each cytosine is 5-methylcytosine.

[0318] Comparative compound No. 628785 (previously described in WO 2016 / 141145; WO 2016 / 141236; and described in Sztainberg et al., Nature 528(7580):123-126 (2015)) is a 5-10-5 MOE spacer having (from 5' to 3') the nucleobase sequence: GGTTTTTCTCCTTTATTATC (as SEQ ID NO:20 incorporated herein), wherein the sugar motif for Compound No. 628785 is (from 5' to 3'): eeeeeddddddddddeeeee; wherein each "e" represents a 2'-MOE ribosyl sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, wherein the internucleoside linkage motif is (from 5' to 3'): sooooosssssssssooss; wherein each "s" represents a phosphorothioate internucleoside linkage, and each "o" represents a phosphodiester linkage, and wherein each cytosine residue is 5-methylcytosine.

[0319] Comparative compound No. 912669 (previously described in Shao et al., Sci. Trans. Med. 13(583)(2021)) is a 5-10-5 MOE spacer having (from 5' to 3') the nucleobase sequence: TATGGTTTTTCTCCTTTATT (incorporated herein as SEQ ID NO: 21), wherein the sugar motif for compound No. 912669 is (from 5' to 3'): eeeeeddddddddddeeeee; wherein each "e" represents a 2'-MOE ribosyl sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, wherein the internucleoside linkage motif is (from 5' to 3'): sooooosssssssssooss, wherein each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester linkage, and wherein each cytosine residue is 5-methylcytosine.

[0320] Compound 628785 and compound 912669 are 100% complementary to SEQ ID NO: 1 (described above). In the table below, "Start Site" indicates the 5'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide, and "Stop Site" indicates the 3'-most nucleoside in the target nucleic acid sequence that is complementary to the modified oligonucleotide. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0321] Table 3

[0322]

[0323] SHSY5Y cells were plated at a density of 12,500 cells per well and differentiated for 10 days in a neuron basal culture medium supplemented with B27 (ThermoFisher), GlutaMAX (ThermoFisher) and 10 μM retinoic acid (Sigma). Differentiated SH-SY5Y cells were treated with modified oligonucleotides at concentrations shown in the following table by free uptake. After a 5-day treatment period, total RNA was isolated from cells and MECP2 RNA levels were measured in real time by quantitative RT-PCR. Human MECP2 primer-probe group RTS52360 (forward sequence GATCAATCCCCAGGGAAAAGC, designated herein as SEQ ID NO: 12; reverse sequence CCTCTCCCAGTTACCGTGAAG, designated herein as SEQ ID NO: 13; probe sequence CATTAGGGTCCAGGGATGTGTCGC, designated herein as SEQ ID NO: 14) was used to measure RNA levels as described above. MECP2 RNA levels were normalized relative to human GAPDH. Human GAPDH was amplified using human primer probe set RTS104 (GAAGGTGAAGGTCGGAGTC, designated herein as SEQ ID NO: 15; reverse sequence GAAGATGGTGATGGGATTTC, designated herein as SEQ ID NO: 16; probe sequence CAAGCTTCCCGTTCTCAGCC, designated herein as SEQ ID NO: 17).

[0324] The reduction of MECP2 RNA is presented in the table below as the percentage of MECP2 RNA (%UTC) relative to the amount of MECP2 RNA in untreated control cells. The half-maximal inhibitory concentration (IC) of each modified oligonucleotide was calculated using GraphPad Prism software. 50 ).

[0325] As shown in the table below, Compound No. 1435454 was more potent than Comparative Compound No. 628785 and Comparative Compound No. 912669 in this assay.

[0326] Table 4

[0327] Dose-dependent reduction of human MECP2 RNA in SH-SY5Y cells by modified oligonucleotides

[0328]

[0329] Example 4: Activity of modified oligonucleotides complementary to human MECP2 in transgenic mice

[0330] Use Mecp2 transgenic lines to Mecp2 Tg1 (Previously described in Collins AL et al., Human Molecular Genetics, Vol. 13, No. 21, November 1, 2004, pp. 2679-2689) The effects of the modified oligonucleotides described above on MECP2 RNA were determined.

[0331] MECP2 transgenic mice were divided into groups of 2 to 4 mice. Each mouse received a single ICV bolus injection of 350 μg or 500 μg of modified oligonucleotide as specified in the table below. A group of 2 to 4 mice received a single ICV bolus injection of PBS as a negative control.

[0332] Two weeks after treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and spinal cord for quantitative real-time RTPCR analysis of MECP2 RNA expression using human primer probe set RTS4253 (forward sequence TGAAGGAGTCTTCTATCCGATCTGT, designated herein as SEQ ID NO: 6; reverse sequence CACTTCCTTGACCTCGATGCT, designated herein as SEQ ID NO: 7; probe sequence AGACCGTACTCCCCATCAAGAAGCGC, designated herein as SEQ ID NO: 8) or human primer probe set RTS37209 (described above). MECP2 RNA levels were normalized to mouse GAPDH. Mouse GAPDH was amplified using primer probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT, designated herein as SEQ ID NO: 9; reverse sequence GGGTCTCGCTCCTGGAAGAT, designated herein as SEQ ID NO: 10; probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC, designated herein as SEQ ID NO: 11). Results are presented as percentage human MECP2 RNA (% control) relative to the amount of MECP2 RNA in PBS-treated animals. Each experiment is presented in a separate table.

[0333] Table 5

[0334] Reduction of human MECP2 RNA in MECP2 transgenic mice at a dose of 500 μg

[0335]

[0336] Table 6 Reduction of human MECP2 RNA in MECP2 transgenic mice at a dose of 500 μg

[0337]

[0338] Table 7 Reduction of human MECP2 RNA in MECP2 transgenic mice at a dose of 350 μg

[0339]

[0340] Example 5: Activity of modified oligonucleotides complementary to human MECP2 in transgenic mice (multiple doses)

[0341] MECP2 transgenic mice (described above) were divided into groups of 4 mice each. Each mouse received a single ICV bolus injection of various concentrations of modified oligonucleotides as defined in the table below. One group of 4 mice received PBS as a negative control.

[0342] Two weeks after treatment, mice were sacrificed and RNA was extracted from cortical brain tissue, spinal cord, hippocampus, and cerebellum for quantitative real-time RT-PCR analysis to measure the amount of MECP2 RNA using human primer probe set RTS4253 (described herein). MECP2 RNA levels were normalized to mouse GAPDH. Mouse GAPDH was amplified using primer probe set mGapdh-2 (described above). Results are presented as percentage human MECP2 RNA (% control) relative to the amount of MECP2 RNA in PBS-treated animals.

[0343] Table 8

[0344] Reduction of MECP2 RNA in MECP2 transgenic mice

[0345]

Claims

1. A modified oligonucleotide having the following chemical structure: (SEQ ID NO:19) or a pharmaceutically acceptable salt thereof.

2. The modified oligonucleotide according to claim 1, wherein the modified oligonucleotide is a pharmaceutically acceptable salt and comprises one or more cations selected from sodium, potassium, calcium, and magnesium.

3. The modified oligonucleotide according to claim 1, wherein the modified oligonucleotide is a sodium salt or a potassium salt.

4. A modified oligonucleotide having the following chemical structure: (SEQ ID NO:19).

5. An oligomeric compound comprising a modified oligonucleotide according to the following chemical symbols: G es m C eo A eo A eo m C eo A d s T ds T ds T ds T ds m C ds A ds G ds T ds T ds T eo m C eo A es G es m C e (SEQ ID NO:19), wherein A = adenine nucleobase, m C is 5-methylcytosine nucleobase, G = guanine nucleobase. T = thymine nucleobase. e = 2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

6. A group of the modified oligonucleotides according to claim 1, wherein all of the phosphorothioate internucleoside linkages in the modified oligonucleotides are atactic.

7. A pharmaceutical composition comprising the modified oligonucleotide according to claim 1 and a pharmaceutically acceptable diluent.

8. The pharmaceutical composition according to claim 7, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

9. The pharmaceutical composition according to claim 8, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate buffered saline or the artificial cerebrospinal fluid.

10. A group of the modified oligonucleotides according to claim 2, wherein all of the phosphorothioate internucleoside linkages in the modified oligonucleotides are atactic.

11. A pharmaceutical composition comprising the modified oligonucleotide according to claim 2 and a pharmaceutically acceptable diluent.

12. The pharmaceutical composition according to claim 11, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

13. The pharmaceutical composition according to claim 12, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate buffered saline or the artificial cerebrospinal fluid.

14. A group of the modified oligonucleotides according to claim 4, wherein all of the phosphorothioate internucleoside linkages in the modified oligonucleotides are atactic.

15. A pharmaceutical composition comprising the modified oligonucleotide according to claim 4 and a pharmaceutically acceptable diluent.

16. The pharmaceutical composition according to claim 15, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

17. The pharmaceutical composition according to claim 16, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate buffered saline or the artificial cerebrospinal fluid.

18. A group of the oligomeric compounds according to claim 5, wherein all of the phosphorothioate internucleoside linkages in the oligomeric compounds are atactic.

19. A pharmaceutical composition comprising the oligomeric compound according to claim 5 and a pharmaceutically acceptable diluent.

20. The pharmaceutical composition according to claim 19, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

21. The pharmaceutical composition according to claim 20, wherein the pharmaceutical composition consists essentially of the oligomeric compound and the phosphate buffered saline or the artificial cerebrospinal fluid.

22. A pharmaceutical composition comprising the group according to claim 6 and a pharmaceutically acceptable diluent.

23. The pharmaceutical composition according to claim 22, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

24. A pharmaceutical composition comprising the group according to claim 10 and a pharmaceutically acceptable diluent.

25. The pharmaceutical composition according to claim 24, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

26. A pharmaceutical composition comprising the group according to claim 14 and a pharmaceutically acceptable diluent.

27. The pharmaceutical composition according to claim 26, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

28. A pharmaceutical composition comprising the group according to claim 18 and a pharmaceutically acceptable diluent.

29. The pharmaceutical composition according to claim 28, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

30. A method comprising administering to a subject the modified oligonucleotide according to any one of claims 1 to 4, the oligomeric compound according to claim 5, the group according to any one of claims 6, 10, 14 and 18, or the pharmaceutical composition according to any one of claims 7 to 9, 11 to 13, 15 to 17 and 19 to 29.

31. The method according to claim 30, wherein the subject has a disease or disorder associated with MECP2.

32. The method according to claim 31, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

33. The method according to claim 31 or claim 32, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

34. A method of treating a disease or disorder associated with MECP2, comprising administering to a subject having or at risk of having a disease or disorder associated with MECP2 a therapeutically effective amount of the modified oligonucleotide according to any one of claims 1 to 4, the oligomeric compound according to claim 5, the group according to any one of claims 6, 10, 14 and 18, or the pharmaceutical composition according to any one of claims 7 to 9, 11 to 13, 15 to 17 and 19 to 29; and thereby treating the disease or disorder associated with MECP2.

35. The method according to claim 34, wherein the MECP2-related disease or disorder is a neurodevelopmental disease or disorder.

36. The method according to claim 34 or claim 35, wherein the MECP2-related disease or disorder is MECP2 duplication syndrome.

37. The method according to any one of claims 34 to 36, wherein at least one symptom or sign of the MECP2-related disease or disorder is improved.

38. The method according to claim 37, wherein the symptom or sign is autism, intellectual disability, motor dysfunction, hypotonia, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy or early death.

39. The method according to any one of claims 34 to 38, wherein the MECP2-related disease or disorder is associated with an elevated level of MECP2 in the subject.

40. The method according to any one of claims 34 to 39, wherein administering the modified oligonucleotide, oligomeric compound, the group or the pharmaceutical composition reduces seizures, reduces or delays cognitive impairment, reduces or delays intellectual disability, reduces or delays symptoms of autism, reduces anxiety or alleviates gastrointestinal symptoms of the subject; or improves motor function, motor development, muscle tone, cognitive development, speech or social skills development of the subject.

41. The method according to any one of claims 31 to 40, wherein the subject is a human.

42. A method of reducing the expression of MECP2 in a cell, comprising contacting the cell with a modified oligonucleotide according to any one of claims 1 to 4, an oligomeric compound according to claim 5, a group according to any one of claims 6, 10, 14 and 18, or a pharmaceutical composition according to any one of claims 7 to 9, 11 to 13, 15 to 17 and 19 to 29.

43. The method according to claim 42, wherein the cell is a neuron.

44. The method according to claim 42 or claim 43, wherein the cell is a human cell.

45. Use of a modified oligonucleotide according to any one of claims 1 to 4, an oligomeric compound according to claim 5, a group according to any one of claims 6, 10, 14 and 18, or a pharmaceutical composition according to any one of claims 7 to 9, 11 to 13, 15 to 17 and 19 to 29 for the treatment of an MECP2-related disease or disorder.

46. Use of a modified oligonucleotide according to any one of claims 1 to 4, an oligomeric compound according to claim 5, a group according to any one of claims 6, 10, 14 and 18, or a pharmaceutical composition according to any one of claims 7 to 9, 11 to 13, 15 to 17 and 19 to 29 in the manufacture of a medicament for the treatment of an MECP2-related disease or disorder.

47. The use according to claim 45 or claim 46, wherein the MECP2-related disease or disorder is associated with an elevated level of MECP2.

48. The use according to any one of claims 45 to 47, wherein the MECP2-related disease or disorder is MECP2 duplication syndrome.

Images