Application of methanosphaeroides or combination of methanosphaeroides and asepsis rectum in preparation of medicine for preventing and treating enteritis
Through the use of methanosphere and rectal acobacterium, tryptophan is synthesized by using methanosphere and promote the metabolism of rectal acobacterium, and induce indole-3-pyruvate, which solves the problems of side effects of Crohn's disease treatment and insufficient intestinal regulation, and achieves effective relief of intestinal inflammation and improvement of intestinal health.
Patent Information
- Application Number
- CN202510345280.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-24
- Publication Date
- 2025-07-04
AI Technical Summary
In the prior art, the treatment methods of Crohn's disease have great side effects and are difficult to cure. There is insufficient research on the function of archaea in the intestine, especially the connection between methane spherobacteria and tryptophan is not clear, and the regulatory mechanism of intestinal probiotics has not been discussed in depth.
Methanosphaera stadtmanae and its metabolites were used in combination with Agathobacter rectalis to synthesize tryptophan through Methanespheric bacteria, promote the growth and metabolism of Abdominal rectalis, and produce metabolites such as indole-3-pyruvate to alleviate intestinal inflammation.
Significantly alleviates the symptoms of enteritis, reduces the expression of pro-inflammatory cytokines, promotes intestinal health, improves intestinal barrier function, and reduces pathological damage to Crohn's disease.
Smart Images

Figure CN120241797A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microorganisms, and in particular to the application of Methanosphaera or its combination with Bacteroides rectus in the preparation of drugs for preventing and treating enteritis. Background Art
[0002] Crohn's Disease (CD) is a chronic, relapsing inflammatory bowel disease, mainly manifested as abdominal pain, diarrhea and weight loss, which seriously affects the quality of life of patients. At present, the clinical treatment methods for CD mainly include anti-inflammatory drugs, immunosuppressants and biological agents, etc., but these methods often have side effects and are difficult to cure. In recent years, intestinal flora dysregulation has been considered to be closely related to the occurrence and development of CD, and regulating the intestinal microecology has become a new direction for the treatment of CD.
[0003] Existing studies mainly focus on the roles of intestinal bacteria, viruses and fungi. However, the functional research on archaea in the intestine is not sufficient. Methanosphaera stadtmanae (M. stadtmanae), as an archaeon in the human intestine, is known to produce methane during metabolism, but its specific function in the intestine has not been clarified. Tryptophan, as an essential amino acid, its metabolites play an important role in regulating intestinal immunity and maintaining intestinal barrier function. However, the existing technology has not found the connection between M. stadtmanae and tryptophan, nor is there any mechanism research on M. stadtmanae and intestinal probiotics. Summary of the Invention
[0004] The purpose of the present invention is to overcome the deficiencies of the existing technology and provide the application of Methanosphaera in the preparation of drugs for preventing and / or treating enteritis.
[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:
[0006] In the first aspect, the present invention provides the application of Methanosphaera stadtmanae and / or its metabolites in the preparation of drugs for preventing and / or treating enteritis.
[0007] The present invention discovers that Methanosphaera stadtmanae has the ability to de novo synthesize tryptophan and can significantly relieve enteritis.
[0008] Furthermore, the metabolites of Methanosphaera stadtmanae contain tryptophan.
[0009] In a specific embodiment of the present invention, the strain number of the Methanosphaera stadtmanae is CCAM 456, DSMZ 3091 or ATCC 43021.
[0010] In a second aspect, the present invention provides a composition, which contains a Methanosphaera component and probiotics that metabolize tryptophan;
[0011] The Methanosphaera component includes Methanosphaera stadtmanae and / or the metabolites of Methanosphaera stadtmanae.
[0012] Methanosphaera stadtmanae can effectively promote the growth and metabolism of probiotics that metabolize tryptophan in the intestine (such as Agathobacter rectalis), enabling the latter to utilize tryptophan to generate the metabolite indole-3-pyruvate, thereby further contributing to the alleviation of intestinal inflammation.
[0013] Furthermore, the metabolites of Methanosphaera stadtmanae contain tryptophan.
[0014] Furthermore, the probiotics that metabolize tryptophan include Agathobacter rectalis.
[0015] In a specific embodiment of the present invention, the strain number of the Methanosphaera stadtmanae is CCAM 456, DSMZ 3091 or ATCC 43021, and the strain number of the Agathobacter rectalis is ATCC 33656.
[0016] In a third aspect, the present invention provides the application of the composition in the preparation of a drug for preventing and / or treating enteritis.
[0017] Furthermore, the drug is a drug for preventing and / or treating intestinal injury.
[0018] Even further, the drug is a drug for promoting the growth and metabolism of probiotics that metabolize tryptophan in the intestine.
[0019] Even further, the probiotics that metabolize tryptophan in the intestine include Agathobacter rectalis.
[0020] Furthermore, the drug is a drug for reducing pro-inflammatory cytokines.
[0021] Furthermore, the pro-inflammatory cytokines include at least one of IL-1α, IL-1β, IL-6, IL-17a, IL-22, and IL-18.
[0022] Further, the drug is a drug that increases the content of tryptophan metabolites.
[0023] Furthermore, the tryptophan metabolites include indole-3-pyruvic acid.
[0024] In a fourth aspect, the present invention provides a microbial drug containing the composition described above.
[0025] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0026] The present invention discovers that Methanosphaera stadtmanae has the ability to de novo synthesize tryptophan and can significantly relieve enteritis. At the same time, co-culturing this strain with the intestinal probiotic Agathobacter rectalis can effectively promote the growth and metabolism of the intestinal probiotic Agathobacter rectalis, enabling the latter (Agathobacter rectalis) to utilize tryptophan and generate the tryptophan metabolite indole-3-pyruvic acid, thereby further relieving intestinal inflammation. Description of the Drawings
[0027] Figure 1 Diagrams of experiments to verify the de novo tryptophan synthesis ability of M. stadtmanae. Among them, A is the culture process of M. stadtmanae in a medium without exogenous tryptophan addition; B is the relationship between tryptophan concentration and culture time after M. stadtmanae is cultured under the condition of no exogenous tryptophan addition; C is the tryptophan concentration of M. stadtmanae cultured for 48 h under the condition of no exogenous tryptophan addition; D is the culture process of M. stadtmanae in a medium with or without exogenous tryptophan addition; E is the process of the tryptophan synthesis-related gene cluster of M. stadtmanae; F is the change in the amount of M. stadtmanae bacteria (OD 600 detection) in the medium with or without exogenous tryptophan addition; G is the expression level of the tryptophan synthesis-related gene cluster after M. stadtmanae is cultured in a medium with or without exogenous tryptophan addition.
[0028] Figure 2Experimental diagrams are provided to verify that M. stadtmanae provides tryptophan to assist the growth and metabolite synthesis of A. rectalis. Among them, A shows the culture process of A. rectalis in media with tryptophan deficiency (Tryptophan-Deficient), low concentration of tryptophan (Tryptophan-Low), and high concentration of tryptophan (Tryptophan-High); B shows the growth of A. rectalis in media with different tryptophan concentrations detected by OD 600 ; C shows the gene cluster process related to tryptophan metabolism of A. rectalis; D shows the expression levels of genes related to tryptophan metabolism of A. rectalis after cultivation in media with different tryptophan concentrations; E shows the tryptophan content in the culture supernatant of A. rectalis cultured for 48 h in different groups; F shows the indolepyruvic acid content in the culture supernatant of A. rectalis cultured for 48 h in different groups; G shows the culture process of A. rectalis in media with tryptophan deficiency (Tryptophan-Deficient), supernatant of M. stadtmanae medium (Supernatant of M. stadtmanae), and co-culture of A. rectalis and M. stadtmanae (Co-culture of A. rectalis and M. stadtmanae); H shows the growth of A. rectalis in media with different tryptophan concentrations detected by OD 600 ; I shows the expression levels of genes related to tryptophan metabolism of A. rectalis after cultivation in media with different tryptophan concentrations; J shows the tryptophan content in the culture supernatant of A. rectalis cultured for 48 h in different groups; K respectively shows the indolepyruvic acid content in the culture supernatant of A. rectalis cultured for 48 h in different groups.
[0029] Figure 3 To verify the synergistic effect of M. stadtmanae and A. rectalis in improving the TNBS-induced mouse colitis model. C57BL / 6 mice were divided into four groups: control group (Control), A. rectalis group, M. stadtmanae group, and M. stadtmanae + A. rectalis group. A shows the construction process of the TNBS-induced mouse colitis model; B shows the colon length of the TNBS-induced mouse colitis model; C shows the body weight change of mice in the TNBS-induced mouse colitis model; D shows the HE staining and histological scoring of the colon tissue of mice in the TNBS-induced mouse colitis model; E shows the GO pathway enrichment analysis of mice in the TNBS-induced mouse colitis model; F shows the differential analysis of the transcriptome heat map of mice in the TNBS-induced mouse colitis model; G shows the KEGG pathway enrichment analysis of mice in the TNBS-induced mouse colitis model.
[0030] Figure 4 To verify that M. stadtmanae and A. rectalis synergistically improve the colitis model in DSS mice. C57BL / 6 mice were divided into four groups: control group (Control), A. rectalis group, M. stadtmanae group, and M. stadtmanae + A. rectalis group. A shows the construction process of the colitis model in DSS mice; B shows the colon length of the colitis model in DSS mice; C shows the change in body weight of the mice in the colitis model in DSS mice; D shows the HE staining and histological scoring of the colon tissue of the mice in the colitis model in DSS mice; E shows the differential analysis of the transcriptome heat map of the colitis model in DSS mice; F shows the GO pathway enrichment analysis of the mice in the colitis model in DSS mice; G shows the KEGG pathway enrichment analysis of the mice in the colitis model in DSS mice.
[0031] Figure 5 To verify that M. stadtmanae and A. rectalis synergistically improve IL10 - / - colitis model in mice. C57BL / 6 mice were divided into four groups: control group (Control), A. rectalis group, M. stadtmanae group, and M. stadtmanae + A. rectalis group. A shows the construction process of the IL10 - / - colitis model in mice; B shows the colon length of the IL10 - / - colitis model in mice; C shows the change in body weight of the mice in the IL10 - / - colitis model in mice; D shows the HE staining and histological scoring of the colon tissue of the mice in the IL10 - / - colitis model in mice; E shows the expression of inflammatory factors in the colon tissue of the mice at the transcriptional level.
[0032] Figure 6 To verify that IPyA improves the colitis model in TNBS mice. Among them, A shows the flow chart for constructing the colitis model in TNBS mice treated with IPyA; B shows the colon length of the colitis model in TNBS mice; C shows the change in body weight of the mice in the colitis model in TNBS mice; D shows the HE staining and histological scoring of the colon tissue of the mice in the colitis model in TNBS mice; E shows the expression of inflammatory factors in the mice in the colitis model in TNBS mice. Detailed implementation manners
[0033] To better illustrate the purpose, technical solution, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Other materials, reagents, etc. used in the embodiments can be obtained from commercial channels without special instructions.
[0034] The strain numbers of Methanosphaera stadtmanae (hereinafter referred to as M. stadtmanae) of the present invention are CCAM 456, DSMZ 3091 or ATCC 43021, and it can be obtained from the China Center for Anaerobic Microorganisms Culture Collection (CCAM), the German Collection of Microorganisms and Cell Cultures (DSMZ) or the American Type Culture Collection (ATCC).
[0035] The strain number of Agathobacter rectalis (hereinafter referred to as A. rectalis) of the present invention is ATCC 33656, and it is purchased from Mingzhou Biotechnology Co., Ltd.
[0036] Example 1 verifies the de novo synthesis ability of tryptophan in M. stadtmanae
[0037] I. Experimental method
[0038] 1. Anaerobically culture M. stadtmanae in DSMZ Medium 322 without exogenous tryptophan addition at 37 °C for 48 h. The control group is cultured with exogenous addition of 100 mg / L tryptophan under the same conditions ( Figure 1 A).
[0039] 2. Genome and transcriptional expression analysis: Analyze the whole genome of M. stadtmanae cultured in step 1, and at the same time perform transcriptional expression sequencing on M. stadtmanae in the logarithmic growth phase, and use RT-qPCR to detect the annotated tryptophan synthesis-related gene clusters (trpE, trpG, trpC, trpF, trpB1, trpA, trpD) and their expression levels ( Figure 1 D and Figure 1 E).
[0040] Two-step qPCR amplification is carried out by HiScript III RT SuperMix for qPCR. Pre-denature at 95 °C for 5 min, and then enter 40 cycles, 95 °C for 10 s, 60 °C for 30 s. The primers are shown in Table 1.
[0041] Table 1
[0042] Target gene Forward primer Reverse primer trpA GTGGCAGGAGATCCTGACTATG TGCACGAATGTCTGCATTTTGA trpB1 TTGGTGTTGAAGCAGCAGGT TGTTCTGGTCCAACTCCAGG trpC ACCTGCAAGTCCATCAAAAGGA TCCACTAGCATTATTAACAGCAGC trpD TGCTCTTAGAATGAAAGGTGAAAC GCTCCACCAGCACTAGCAATA trpE ACTGATGGTGAAATATTCCAAGCTG TGGCCTTGTACCTGCAATAGG trpF TCAGTACCATAATGGACAACGTCT TTGTTCCACCAGTTAGGCCA trpG GCCATATTATACTATCACCAGGTCC CCTTGGTGTCCTAAACATACACC
[0043] 3. Tryptophan concentration detection: After the culture in step 1 is completed, centrifuge the culture supernatant at 8000 rpm / min for 5 min, take the supernatant, precipitate the protein with methanol, the volume ratio of the supernatant to methanol is 1:1, filter to obtain the sample of the supernatant to be measured, and detect the tryptophan concentration with a liquid chromatography-mass spectrometry (LC-MS).
[0044] After the supernatant sample to be tested is pre-cooled at 4°C, 50 μL of the supernatant sample to be tested is mixed with 250 μL of Folch solution (chloroform: methanol = 2:1, v / v), vortexed for 3 min (2000 rpm), left to stand at -20°C for 30 min to induce phase separation, then centrifuged at 12000 g for 5 min at 4°C, and the lower organic phase is collected. The remaining aqueous phase is extracted again, and the two organic phases are combined and evaporated to dryness under gentle air flow at 37°C in a nitrogen blower. The residue is redissolved in 1 mL of methanol, filtered through a 0.22 μm polytetrafluoroethylene filter membrane, and transferred to an LC-MS injection vial.
[0045] An Agilent 1290 Infinity II system is used with a C18 chromatographic column, and the column temperature is maintained at 30°C. Mobile phase A is 0.1% (w / v) formic acid aqueous solution (positive ion mode) or 5 mM ammonium acetate aqueous solution (negative ion mode), mobile phase B is 100% methanol, the flow rate is kept constant at 0.3 mL / min, and the injection volume is 5 μL.
[0046] The gradient elution program is as follows: 0 - 1 min, 5% (v / v) mobile phase B, 95% (v / v) mobile phase A; 1 - 8 min, the concentration of mobile phase B linearly increases to 95% (v / v), and the corresponding concentration of mobile phase A is 5% (v / v); 8 - 10 min, maintain 95% (v / v) mobile phase B, 5% (v / v) mobile phase A; 10.1 - 12 min, return to the initial conditions for equilibration. Quantification is carried out by the multiple reaction monitoring (MRM) mode, and the specific conditions include nebulizing gas flow, drying gas flow, and ion source temperature, etc.
[0047] II. Experimental Results
[0048] 1. When cultured for 48 h without adding exogenous tryptophan, M. stadtmanae can continue to grow ( Figure 1 B), and an increase in the tryptophan concentration in the supernatant is detected by LC-MS ( Figure 1 C).
[0049] 2. The RT-qPCR results show that under the condition of lacking exogenous tryptophan supplementation, the expression level of the trp gene cluster of M. stadtmanae is significantly up-regulated compared with the condition of supplementing exogenous tryptophan (p < 0.05), indicating that tryptophan does not affect the growth of M. stadtmanae ( Figure 1 F), and the tryptophan synthesis ability of M. stadtmanae increases in the case of tryptophan deficiency ( Figure 1 G). The above results show that M. stadtmanae can autonomously synthesize tryptophan without exogenous tryptophan.
[0050] Example 2 verifies that M. stadtmanae provides tryptophan to assist the growth and metabolite synthesis of A. rectalis
[0051] I. Experimental methods
[0052] 1. Culture conditions of A. rectalis( Figure 2 A): Inoculate A. rectalis into DSMZ Medium 322 with tryptophan deficiency (Tryptophan-Deficient), low concentration of tryptophan (Tryptophan-Low), and high concentration of tryptophan (Tryptophan-High) respectively, and culture anaerobically at 37 °C for 48 h. The concentration of tryptophan in the low-concentration tryptophan medium is 300 ng / mL, and the concentration of tryptophan in the high-concentration tryptophan medium is 6000 ng / mL.
[0053] 2. Growth detection: Detect OD 600 respectively representing the bacterial amounts of A. rectalis after culturing in each group of step 1.
[0054] 3. Detection of indole-3-pyruvic acid (IPyA) concentration: Detect the concentration of IPyA in the culture supernatant of each group by liquid chromatography-tandem triple quadrupole mass spectrometry (LC-MS / MS). The method is shown in Example 1.
[0055] 4. Culture conditions of A. rectalis( Figure 2 G): Inoculate A. rectalis into DSMZ Medium 322 with tryptophan deficiency (Tryptophan-Deficient), supplemented with the supernatant of M. stadtmanae (Supernatant of M. stadtmanae, adding the culture supernatant of M. stadtmanae without exogenous tryptophan in Example 1. In this group, the volume ratio of the DSMZ Medium 322 medium without exogenous tryptophan to the culture supernatant of M. stadtmanae without exogenous tryptophan is 1:2), and co-cultured with M. stadtmanae (Co-culture of A. rectalis and M. stadtmanae, the inoculation amounts of A. rectalis and M. stadtmanae are the same), and culture anaerobically at 37 °C for 48 h.
[0056] 5. Growth detection: Use qPCR to measure the expression level of the ArAT gene of A. rectalis after culturing in each group of step 4. The primer sequences are ACGGAAAGTGGTTGGCATCT and CCGCATTAGCACAA TGCACA, and the qPCR procedure is the same as that in Example 1.
[0057] 6. Detection of indole-3-pyruvic acid (IPyA) concentration: The concentration of IPyA in the culture supernatants of each group in Step 1 was detected by liquid chromatography-tandem triple quadrupole mass spectrometry (LC-MS / MS). The method is shown in Example 1.
[0058] II. Experimental Results
[0059] 1. Effect of tryptophan on the growth of A. rectalis: As Figure 2 shown in B, A. rectalis could not grow in an environment completely lacking tryptophan, indicating that A. rectalis is a tryptophan auxotroph and needs to obtain tryptophan from the external environment to maintain growth. In an environment with low concentrations of tryptophan, A. rectalis could only maintain transient proliferation (about 24 h), followed by growth arrest; while under high-concentration tryptophan conditions, the growth of A. rectalis was significantly promoted and it was able to continuously proliferate. This phenomenon shows that A. rectalis can utilize exogenous tryptophan to maintain its own growth, but it does not have the ability to de novo synthesize tryptophan itself.
[0060] 2. Detection of the tryptophan metabolite IPyA of A. rectalis: As Figure 2 shown in C, the expression level of the ArAT gene was detected to verify whether A. rectalis would metabolize tryptophan during growth. The results showed that the presence of tryptophan significantly upregulated the expression of ArAT ( Figure 2 D). At the same time, it was detected in the culture medium supernatant that the growth of A. rectalis was accompanied by the consumption of tryptophan ( Figure 2 E), and the corresponding tryptophan metabolite indole-3-pyruvic acid IPyA was produced ( Figure 2 F).
[0061] 3. Effect of M. stadtmanae on the growth of A. rectalis: A. rectalis could not grow in an environment completely lacking tryptophan; A. rectalis grew in an environment supplemented with the supernatant of M. stadtmanae (low concentration of tryptophan), but A. rectalis could only maintain transient proliferation (about 24 h), followed by growth arrest; under the co-culture conditions with M. stadtmanae, A. rectalis could continuously grow and proliferate through the tryptophan derived from M. stadtmanae ( Figure 2 H).
[0062] 4. IPyA detection: Detect the gene expression level of ArAT to verify whether A. rectalis metabolizes tryptophan during growth. The results show that the tryptophan produced by M. stadtmanae significantly upregulates the expression of ArAT ( Figure 2 I). At the same time, in the culture medium supernatant, a large amount of tryptophan metabolite IPyA was detected in the co-culture group of A. rectalis and M. stadtmanae ( Figure 2 J and Figure 2 K).
[0063] Example 3 verifies that M. stadtmanae alone or in synergy with A. rectalis improves the TNBS / DSS / IL10 - / - mouse colitis model
[0064] I. Experimental methods
[0065] 1. Animal model: Male C57BL / 6 mice aged 6 - 8 weeks were selected, randomly grouped (n = 10), and treated as follows:
[0066] Control group: PBS was gavaged at 200 μL / rat / every 2 days;
[0067] M. stadtmanae group: M. stadtmanae bacterial suspension was gavaged to mice at 200 μL / 1×10 7 CFU / rat / every 2 days for a total of 14 days of gavage;
[0068] A. rectalis group: A. rectalis bacterial suspension was gavaged to mice at 200 μL / 1×10 7 CFU / rat / every 2 days for a total of 14 days of gavage;
[0069] Combined group: M. stadtmanae bacterial suspension and A. rectalis bacterial suspension were gavaged to mice. The gavage bacterial concentration for each bacterium was 200 μL / 1×10 7 CFU / rat / every 2 days for a total of 14 days of gavage.
[0070] 2. Apply 1% (w / v) trinitrobenzenesulfonic acid (TNBS) to the back skin of mice, and induce colitis in each group of mice in step 1 by rectal instillation of 2.5% (w / v) trinitrobenzenesulfonic acid (TNBS) at 100 μL / rat for 4 consecutive days ( Figure 3 A), to construct a TNBS mouse colitis model;
[0071] Each group of mice in step 1 was given 2% (w / v) dextran sulfate sodium aqueous solution (DSS) to drink for 7 days, and colitis was detected 3 days after stopping DSS ( Figure 4 A), to construct a DSS mouse colitis model;
[0072] IL10 in each group in Step 1 - / - Mice were fed a diet containing piroxicam (200 mg / kg) for 9 days, then a normal diet for 5 days, and enteritis was detected ( Figure 5 A), and an IL10 - / - mouse enteritis model was constructed.
[0073] 3. Index detection:
[0074] (1) Record the body weight changes and colon lengths of mice in each group;
[0075] (2) Perform hematoxylin-eosin (HE) staining and histological scoring on the colon tissues of mice in each group;
[0076] (3) Detect gene expression by transcriptome sequencing, and detect the expression of inflammatory factors in colon tissues by RT-qPCR. The primers are shown in Table 2, and the qPCR procedure is the same as in Example 1.
[0077] Table 2
[0078]
[0079]
[0080] (4) Detect the expression level of IPyA in the serum of TNBS mice by LC-MS / MS.
[0081] Serum sample processing uses pre-cooled methanol precipitation method: Take 100 μL of serum and add 500 μL of 80% (v / v) methanol solution pre-cooled to -20 °C. After vortex mixing for 5 min, centrifuge at 4 °C and 15000 g for 10 min. The supernatant is filtered through a 0.22 μm nylon filter membrane and stored at -80 °C for later measurement. The instrument detection conditions are shown in Example 1.
[0082] II. Experimental results
[0083] 1. In the DSS mouse enteritis model of the M. stadtmanae group ( Figure 4 C), the weight loss of mice was significantly alleviated.
[0084] In the DSS mouse enteritis model treated with the combination group ( Figure 4 C) and the IL10 - / - mouse enteritis model ( Figure 5 C), the weight loss of mice was significantly alleviated.
[0085] In the DSS mouse enteritis model of the M. stadtmanae group ( Figure 4 B), the colon length of mice was closer to normal.
[0086] In the TNBS mouse enteritis model treated with the combination groupFigure 3 B), DSS-induced murine colitis model( Figure 4 B) and IL10 - / - Murine colitis model( Figure 5 B) had a more normal murine colon length.
[0087] The TNBS-induced murine colitis model in the M. stadtmanae group( Figure 3 D), DSS-induced murine colitis model( Figure 4 D) and IL10 - / - Murine colitis model( Figure 5 D) had a significantly lower histological score in the murine colon tissue, showing a lesser degree of histopathological damage (p < 0.05).
[0088] The TNBS-induced murine colitis model treated with the combination group( Figure 3 D), DSS-induced murine colitis model( Figure 4 D) and IL10 - / - Murine colitis model( Figure 5 D) had a significantly lower histological score in the murine colon tissue, showing a lesser degree of histopathological damage (p < 0.05).
[0089] 2. The inflammatory factor expression pathway in the colon tissue was reduced.
[0090] The expression of inflammatory factors in the colon tissue of the TNBS-induced murine colitis model in the M. stadtmanae treatment group was reduced( Figure 3 E), the expression of inflammatory factors in the colon tissue of the DSS-induced murine colitis model was reduced( Figure 4 E), IL10 - / - The expression of inflammatory factors in the colon tissue of the murine colitis model was reduced( Figure 5 E).
[0091] The inflammatory factor expression pathway in the colon tissue of the TNBS-induced murine colitis model treated with the combination group was reduced( Figure 3 E, Figure 3 F and Figure 3 G), the expression of inflammatory factors in the colon tissue of the DSS-induced murine colitis model was reduced( Figure 4 E, Figure 4 F and Figure 4 G), IL10 - / - The expression of inflammatory factors in the colon tissue of the murine colitis model was reduced( Figure 5 E).
[0092] 3. When the amount of colonized bacteria was similar in each group( Figure 3 H), the concentration of IPyA in the serum increased significantly in the combined gavage group( Figure 3 I).
[0093] The above results indicate that M. stadtmanae can alleviate the symptoms of enteritis alone, suggesting that it has certain therapeutic effects itself. However, when M. stadtmanae acts synergistically with A. rectalis, the effect is more significant.
[0094] Example 4 verifies the improvement of the TNBS-induced mouse enteritis model by IPyA
[0095] I. Experimental methods
[0096] Animal grouping and treatment: Male C57BL / 6J mice aged 6 - 8 weeks were randomly grouped (n = 10) and treated as follows for 14 days:
[0097] (1) Control group: Normal drinking water;
[0098] (2) Low - concentration IPyA group: Drinking water containing IPyA (0.08 mg / 100 mL);
[0099] (3) High - concentration IPyA group: Drinking water containing IPyA (8 mg / 100 mL).
[0100] 2. Induce and construct the TNBS - induced mouse enteritis model according to the method of Example 3, and continuously observe for 4 days ( Figure 6 A).
[0101] 3. Index detection:
[0102] (1) Record the body weight changes and colon length of mice in each group;
[0103] (2) Perform HE staining and histological scoring on the colon tissues of mice in each group;
[0104] (3) Detect the expression of inflammatory factors in colon tissues by RT - qPCR.
[0105] II. Experimental results
[0106] 1. The body weight of mice in the high - concentration IPyA group showed no change compared with the control group and the low - concentration group ( Figure 6 C).
[0107] 2. The colon length in the high - concentration IPyA group was significantly increased compared with the control group and the low - concentration group ( Figure 6 B)
[0108] 3. HE staining in the high - concentration IPyA group showed that the degree of inflammation was significantly reduced compared with the control group and the low - concentration group, showing less histopathological damage ( Figure 6 D).
[0109] 4. The expression levels of IL-1α, IL-17a, and IL-22 in the high-concentration IPyA group were significantly downregulated compared with those in the control group and the low-concentration group (p < 0.05). Figure 6 E).
[0110] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. Use of Methanosphaera stadtmanae and / or its metabolites in the preparation of a medicament for preventing and / or treating enteritis.
2. The application according to claim 1, wherein The metabolite of Methanosphaera stadtmanae contains tryptophan.
3. A composition, characterized in that, The composition contains a Methanosphaera component and probiotics that metabolize tryptophan; The Methanosphaera component includes Methanosphaera stadtmanae and / or the metabolite of Methanosphaera stadtmanae.
4. The composition according to claim 3, wherein The metabolite of Methanosphaera stadtmanae contains tryptophan.
5. The composition according to claim 3, wherein The probiotics that metabolize tryptophan include Agathobacter rectalis.
6. Use of the composition according to any one of claims 3 to 5 in the preparation of a medicament for preventing and / or treating enteritis.
7. The application according to claim 6, characterized in that, The medicament is a medicament that promotes the growth and metabolism of probiotics that metabolize tryptophan in the intestine.
8. The application according to claim 6, characterized in that, The medicament is a medicament that increases the content of tryptophan metabolites.
9. The application according to claim 8, wherein The tryptophan metabolites include indole-3-pyruvic acid.
10. A microbial drug, characterized in that, The microbial medicament contains the composition according to any one of claims 3 to 5.