New target for tumor immunotherapy in immune cells and application thereof

Abstract

The invention provides a new target for tumor immunotherapy in immune cells and application of the new target. The invention discloses a novel signal channel closely related to tumor immunotherapy (tumor inhibition). The invention discloses a new mechanism participated by the signal channel and used for regulating and controlling tumor immunotherapy. The invention also discloses a preferable scheme and a preferable medicine for relieving / treating tumors.

Description

Technical Field

[0001] The present invention relates to the technical field of tumor immunotherapy; specifically, the present invention relates to a new target for tumor immunotherapy in immune cells and its application. Background Art

[0002] A tumor refers to a new growth formed by the hyperplasia of local tissue cells in the body under the action of internal factors such as gene mutations or external factors such as environmental factors. Because this new growth mostly presents as a mass-like protrusion occupying space, it is also called a neoplasm. Tumors are mainly divided into two categories: benign tumors and malignant tumors; according to the extent of invasion of the tumor, they are mainly divided into early-stage cancer, mid-stage cancer, and late-stage cancer; according to the different growth patterns of the tumor, they are mainly divided into carcinoma in situ, invasive carcinoma, and metastatic carcinoma.

[0003] The treatment of malignant tumors has always been a worldwide problem. In recent years, with the emergence of tumor immunotherapy methods, the treatment and prognosis survival of tumor patients have been improved to a certain extent. Tumor immunotherapy uses the body's own immune system to fight tumors and eliminate tumor cells to achieve the purpose of treating tumors. In particular, in recent years, immune checkpoint inhibitors targeting PD-1 and PD-L1 have shown good effects in tumor patients, and the survival period of some patients has been extended. However, tumor immunotherapy still faces huge challenges, that is: currently, less than 30% of tumor patients respond to immunotherapy. For the vast majority of cancer patients, tumor immunotherapy is not ideal, indicating that developing new immunotherapy targets is of great significance for further improving the prognosis of tumor patients.

[0004] CD8 + T cells are cytotoxic immune cells that play an anti-tumor immune role by directly killing tumor cells. Tumor-associated macrophages (TAMs) have powerful immunosuppressive functions and help tumor cells escape from immunity by inhibiting the proliferation and effector functions of cytotoxic immune cells. Studies have shown that the infiltration of T cells in solid tumors is not only positively correlated with the prognosis of patients, but also a key factor affecting the effect of tumor immunotherapy. On the contrary, the proportion of TAMs is negatively correlated with the prognosis of patients. Remodeling the tumor immunosuppressive microenvironment by targeting the immunosuppressive function of TAMs is beneficial to promoting tumor immunotherapy. Therefore, exploring new genes that regulate the immunosuppressive function of TAMs or activate CD8 + T cells will provide new targets for tumor immunotherapy and thus be conducive to the preparation and use of tumor immunotherapy drugs. Summary of the Invention

[0005] The purpose of the present invention is to provide a new target for tumor immunotherapy in immune cells and its application.

[0006] In the first aspect of the present invention, there is provided the use of CH25H or a down-regulator of the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing the same in the preparation of a tumor immunotherapy (tumor inhibition) drug.

[0007] In a preferred embodiment, the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway includes (from upstream to downstream): CH25H gene / protein, AMPKa gene / protein, STAT6 gene / protein, ARG1 gene / protein; preferably, it further includes their upstream and downstream regulatory genes / proteins or chemical molecules.

[0008] In another preferred embodiment, the CH25H causes the accumulation of 25-HC, and the 25-HC accumulates in tumor tissues and the microenvironment.

[0009] In another preferred embodiment, the high expression of CH25H in tumor tissues and the microenvironment is negatively correlated with the survival rate of tumor patients.

[0010] In another preferred embodiment, in the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway, the CH25H causes the accumulation of 25-HC, and the 25-HC activates the AMPKa-STAT6-ARG1 signaling pathway, enhancing the immunosuppressive function of TAM.

[0011] In another preferred embodiment, the base sequence of the CH25H is as shown in SEQ ID NO:1.

[0012] In another preferred embodiment, the tumor immunotherapy includes: reducing the immunosuppressive function of tumor-associated macrophages (TAM); preferably, the down-regulator inhibits CH25H, reduces the accumulation of 25-HC, and reduces the activation of the AMPKa-STAT6-ARG1 signaling pathway, thereby reducing the immunosuppressive function of tumor-associated macrophages (TAM) (promoting the infiltration of more immune cells in tumor tissues to achieve tumor immunotherapy).

[0013] In another preferred embodiment, the tumor immunotherapy includes: increasing the level of effector molecule expression of CD8 + T cells; preferably, the down-regulator inhibits CH25H, reduces the accumulation of 25-HC, thereby increasing the level of effector molecule expression of CD8 + T cells; preferably, the effector molecules include TNFα or IFNγ.

[0014] In another preferred embodiment, the tumor immunotherapy includes: increasing the proportion of effector CD8 + T and reducing the proportion of terminally exhausted CD8 +T cell ratio; preferably, the downregulator inhibits CH25H, reduces the accumulation of 25-HC, thereby increasing the proportion of effector CD8 + T cells and decreasing the proportion of terminally exhausted CD8 + T cells.

[0015] In another preferred embodiment, the tumor immunotherapy includes: increasing the amount of infiltrating immune cells in tumor tissues; or

[0016] In another preferred embodiment, the tumor immunotherapy includes: enhancing the anti-tumor effect of the immune checkpoint antibody anti-PD1.

[0017] In another preferred embodiment, the tumor immunotherapy includes: enhancing the anti-tumor activity of CD8 + T cells.

[0018] In another preferred embodiment, the downregulator includes those selected from: CH25H downregulators, downregulators of the interaction between 25-HC and AMPKa (preferably including the activation of AMPKa by 25-HC).

[0019] In another preferred embodiment, the downregulator includes: reagents for silencing, knocking down or knocking out the CH25H gene, reagents for inhibiting the protein activity of CH25H; more preferably, it includes: interfering molecules (such as siRNA, shRNA, miRNA, antisense nucleotides, etc.) that specifically interfere with the expression of the CH25H gene, CRISPR gene editing reagents (such as CRISPR / Cas9 reagents), homologous recombination reagents or site-directed mutagenesis reagents for the CH25H gene, and the reagents cause loss-of-function mutations in CH25H.

[0020] In another preferred embodiment, the downregulator is an interfering reagent for silencing the CH25H gene; preferably, the interfering reagent is siRNA or shRNA; more preferably, the siRNA is the siRNA formed by the sequences shown in SEQ ID NO:2 and SEQ ID NO:3; more preferably, the shRNA is the shRNA formed by the sequences shown in SEQ ID NO:4 and SEQ ID NO:5.

[0021] In another preferred embodiment, the CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing it is the CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 in tumor-associated macrophages or M2 macrophages.

[0022] In another aspect of the present invention, there is provided the use of a downregulator and an immune checkpoint inhibitor in the preparation of a medicament or a kit for inhibiting tumors, wherein the downregulator is CH25H or a downregulator of the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing the same; preferably, the immune checkpoint inhibitor includes: anti-PD1 antibody (anti-PD1), anti-PD-L1 antibody (anti-PD-L1), anti-CTLA4 antibody (anti-CTLA4), anti-TIGIT antibody (anti-TIGIT).

[0023] In another preferred embodiment, in the kit, the downregulator and the immune checkpoint inhibitor exist independently, for example, are independently placed in different containers and packaged in the kit.

[0024] In another preferred embodiment, the composition or the kit further includes a tumor chemotherapy drug; wherein, the chemotherapy drug includes at least one of Gemcitabine, Cisplatin, 5-Fluorouracil, Cyclophosphamide.

[0025] In another preferred embodiment, the composition or the kit further includes a cytokine; wherein, the cytokine includes at least one of IL-2, TNFα, IFNγ, IFNβ.

[0026] In another preferred embodiment, the composition or the kit further includes: a pharmaceutically acceptable carrier, excipient or auxiliary material.

[0027] In another preferred embodiment, the tumor includes (but is not limited to): colon cancer, melanoma, lymphoma, lung cancer, liver cancer, pancreatic cancer.

[0028] In another aspect of the present invention, there is provided the use of CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing the same for screening tumor immunotherapy drugs; preferably, the CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway is CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 in tumor-associated macrophages or M2 macrophages.

[0029] In another aspect of the present invention, there is provided a method for screening tumor immunotherapy drugs (including potential drugs), comprising: (1) contacting a candidate substance with a system containing the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway; (2) screening out substances that down-regulate the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway, and such substances are tumor immunotherapy drugs (including potential drugs); wherein the down-regulation includes: down-regulating CH25H, thereby reducing the accumulation of 25-HC, reducing the activation effect on the AMPKa-STAT6-ARG1 signaling pathway, and reducing the immunosuppressive function of TAM.

[0030] In another preferred embodiment, the down-regulation or reduction is a statistically (significant) down-regulation, for example, a down-regulation or reduction of 10%, 20%, 30%, 50%, 60%, 80%, 100% or a greater magnitude of down-regulation.

[0031] In another preferred embodiment, the increase is a statistically (significant) increase, for example, an increase of 10%, 20%, 30%, 50%, 60%, 80%, 100% or a greater magnitude of increase.

[0032] In another preferred embodiment, the down-regulation can also be referred to as inhibition, which is a statistical inhibition or down-regulation. Compared with the control or the baseline, it is inhibited or down-regulated by more than 10% or 20%, preferably inhibited or down-regulated by more than 40% or 50%, and more preferably inhibited or down-regulated by more than 80% or 100%.

[0033] In another preferred embodiment, step (1) includes: adding a candidate substance to a system containing the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway; step (2) includes: detecting the expression of CH25H, the accumulation of 25-HC, and the activation of AMPKa by 25-HC in the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway, and comparing with a control group, wherein the control group is a system containing the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway without adding the candidate substance; if the candidate substance down-regulates CH25H, reduces the accumulation of 25-HC, and reduces the activation effect on the AMPKa-STAT6-ARG1 signaling pathway, then the candidate substance is a tumor immunotherapy drug (including potential drugs).

[0034] In another preferred example, the method further includes: analyzing the effect of the candidate substance on the immune function of tumor-associated macrophages (TAMs). If the candidate substance inhibits CH25H, reduces the accumulation of 25-HC, and reduces the activation of the AMPKa-STAT6-ARG1 signaling pathway, thereby reducing TAM immunosuppression and enhancing the immune function of tumor-associated macrophages (TAMs), then it is a tumor immunotherapy drug.

[0035] In another preferred example, the method further includes: analyzing the effect of the candidate substance on the level of effector molecule expression in CD8 + T cells. If the candidate substance inhibits CH25H, reduces the accumulation of 25-HC, and thereby increases the level of effector molecule expression in CD8 + T cells, then it is a tumor immunotherapy drug; preferably, the effector molecule includes TNFα or IFNγ.

[0036] In another preferred example, the method further includes: analyzing the effect of the candidate substance on effector CD8 + T and terminally exhausted CD8 + T cells. If the candidate substance inhibits CH25H, reduces the accumulation of 25-HC, and thereby increases the proportion of effector CD8 + T cells and decreases the proportion of terminally exhausted CD8 + T cells, then it is a tumor immunotherapy drug.

[0037] In another preferred example, the method further includes: analyzing the effect of the candidate substance on the amount of immune cells infiltrating into the tumor tissue. If the candidate substance increases the amount of immune cells infiltrating into the tumor tissue, then it is a tumor immunotherapy drug.

[0038] In another preferred example, the method further includes: analyzing the effect of the candidate substance on the anti-tumor activity of CD8 + T cells. If the candidate substance enhances the anti-tumor activity of CD8 + T cells, then it is a tumor immunotherapy drug.

[0039] In another preferred example, the system containing the CH25H (-25-HC) - AMPKa-STAT6-ARG1 signaling pathway is selected from: a cell (culture) system, a subcellular (culture) system, a tissue (culture) system, or an animal system.

[0040] In another preferred example, the system is a tumor-associated macrophage or an M2-type macrophage system.

[0041] In another preferred example, the candidate substances include (but are not limited to): regulatory molecules designed against the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway, or its pathway proteins, or its upstream or downstream proteins or genes (such as but not limited to upregulators, interfering molecules, nucleic acid inhibitors, binding molecules (such as antibodies or ligands)), CRISPR constructs, small molecule compounds, and compounds from compound libraries.

[0042] In another aspect of the present invention, there is provided the use of CH25H or the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing the same in tumor-associated macrophages or M2 macrophages in the preparation of a diagnostic reagent for diagnosing or prognosticating tumors; preferably, the diagnosis or prognosis includes: judging the occurrence or progression of the tumor or judging whether it is suitable for a treatment regimen using a "downregulator of the CH25H or CH25H-(25-HC)AMPKa-STAT6-ARG1 signaling pathway" according to the expression or activity of CH25H or the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway in tumor-associated macrophages or M2 macrophages; if the CH25H protein is highly expressed, then this treatment regimen is applicable.

[0043] In another aspect of the present invention, there is provided the use of a reagent that specifically recognizes the expression or activity of CH25H or the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing the same in the preparation of a diagnostic reagent or diagnostic kit for diagnosing or prognosticating tumors; preferably, the diagnosis or prognosis includes: judging the occurrence or progression of the tumor or judging whether it is suitable for a treatment regimen using a "downregulator of the CH25H or CH25H-(25-HC)AMPKa-STAT6-ARG1 signaling pathway" according to the expression or activity of CH25H or the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway in tumor-associated macrophages or M2 macrophages; if the CH25H protein is highly expressed, then this treatment regimen is applicable.

[0044] In another preferred example, the diagnostic reagent includes those selected from: primers that specifically amplify the coding gene of the CH25H protein; probes that specifically recognize the coding gene of the CH25H protein or its transcript; or antibodies that specifically bind to the CH25H protein; reagents for specifically analyzing the two of 25-HC; reagents for specifically analyzing the activation of AMPKa; reagents for specifically analyzing the activation of AMPKa-STAT6-ARG1.

[0045] In another aspect of the present invention, there is provided a kit for diagnosing or prognosticating tumors, which kit contains: a diagnostic reagent for detecting the expression or activity of CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing the same.

[0046] In another preferred embodiment, the kit further includes: a nucleic acid extraction reagent, a polymerase chain reaction reagent, a western blot reagent, and / or an enzyme-linked immunosorbent assay reagent.

[0047] Other aspects of the present invention will be apparent to those skilled in the art from the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] The drawings are used to provide a further understanding of the present invention and constitute a part of the specification, and are used to explain the present invention together with the following specific embodiments.

[0049] Figure 1 : Tumor-associated macrophages and M2 macrophages highly express CH25H and accumulate 25-HC;

[0050] A: Results of WB detection of CH25H protein expression during the activation of M2 macrophages induced by IL4 combined with IL13;

[0051] B: Results of RT-qPCR and LC-MS / MS detection of Ch25h gene expression and 25-HC content in M2 macrophages;

[0052] C: Results of RT-qPCR and LC-MS / MS detection of Ch25h gene expression and 25-HC content in tumor-associated macrophages (TAM) and resting peritoneal macrophages (PEM) in Hepa1-6 liver cancer tissues;

[0053] D: Results of RT-qPCR detection of CH25H expression in macrophages or monocytes in tumor tissues and adjacent tissues of liver cancer patients;

[0054] E: Results of LC-MS / MS detection of 25-HC content in tumor tissues and adjacent tissues of liver cancer patients;

[0055] F: Results of single-cell sequencing database analysis of CH25H expression in each cell subset in ovarian cancer (OV) tissues;

[0056] G: Results of single-cell sequencing database analysis of CH25H expression in each myeloid cell subset in colon cancer (CRC), kidney cancer (KIDNEY) and endometrial cancer (UCEC) tissues.

[0057] Figure 2 : 25-HC accumulates in tumor tissues and the microenvironment;

[0058] A: Results of detecting the levels of various oxysterols in tumor tissues of MC38 tumor-bearing mice by LC-MS / MS;

[0059] B: Results of detecting the levels of various oxysterols in peripheral serum and tumor interstitial fluid (TIF) of MC38 tumor-bearing mice by LC-MS / MS;

[0060] C: Results of detecting the levels of various oxysterols in tumor tissues of B16F10 tumor-bearing mice by LC-MS / MS;

[0061] D: Results of detecting the levels of various oxysterols in peripheral serum and tumor interstitial fluid (TIF) of B16F10 tumor-bearing mice by LC-MS / MS.

[0062] Figure 3 : High expression of CH25H in tumor tissues is negatively correlated with the survival rate of tumor patients;

[0063] Results of analyzing the correlation between the expression of CH25H in tumor tissues and the survival rate of tumor patients through The Cancer Genome Atlas (TCGA). Among them, tumor patients include colon cancer (COADREAD), lymphoma (AML), lung cancer (LUSC), and pancreatic cancer (PAAD).

[0064] Figure 4 : 25-HC enhanced the immunosuppressive functions of TAM and M2 macrophages;

[0065] A: LC-MS / MS detection of 25-HC content in Ch25h - / - induced by IL4 combined with IL13 and wild-type (WT) M2 macrophages;

[0066] B: RT-qPCR detection of gene Ch25h - / - and the expression of genes Ch25h, Arg1, and Mrc1 in WT-M2 macrophages;

[0067] C: WB detection of the expression of transcription factor STAT6 and phosphorylated STAT6 (Tyr641) proteins during the process of inducing Ch25h - / - by IL4 combined with IL13 and WT-M2 macrophages;

[0068] D: RT-qPCR detection of the expression of Arg1 gene in Ch25h - / - induced by MC38 and LLC conditioned medium and WT-TAM;

[0069] E: Results of RT-qPCR detection of Arg1 gene expression in M2 macrophages induced by 25-HC combined with IL4 and IL13;

[0070] F: Ch25h - / - and WT-M2 macrophages inhibiting CD8 + T cell proliferation results;

[0071] G: Ch25h - / - and WT-TAM inhibiting CD8 + T cell proliferation results;

[0072] H: Results of RT-qPCR detection of Arg1 gene expression in Ch25h - / - and WT-M2 macrophages induced by 25-HC combined with IL4 and IL13.

[0073] Figure 5 : 25-HC inhibited the effector function of CD8 + T lymphocytes and promoted their exhaustion;

[0074] A: Results of flow cytometry detection of the effector molecule TNFα produced by CD8 + T cells activated by anti-CD3 / CD28 antibodies at different concentrations of 25-HC;

[0075] B: Results of flow cytometry detection of the effector molecule IFNγ produced by CD8 + T cells activated by anti-CD3 / CD28 antibodies at different concentrations of 25-HC;

[0076] C: Results of RT-qPCR detection of CH25H expression in CD8 + T cells activated by anti-CD3 / CD28 antibodies at different times;

[0077] D: Results of Western blot detection of CH25H expression in CD8 + T cells activated by anti-CD3 / CD28 antibodies at different times;

[0078] E: Results of flow cytometry detection of effector T cells (TNFα + / + IFNγ - / - CD8 + T cells) and exhausted T cells (PD1 + IFNγ + ) produced in the later stage of activation of CD8 + TIM3 + ) by anti-CD3 / CD28 antibodies in Ch25h

[0079] Figure 6: More immune cells infiltrate into the tumor tissues of CH25H gene-deficient mice;

[0080] A: Growth curve results of subcutaneous transplanted tumors of MC38 tumor cells in Ch25h - / - and WT mice;

[0081] B: Results of detecting the 25-HC content in MC38 tumor tissues of Ch25h - / - and WT mice by LC-MS / MS;

[0082] C: Results of detecting the TAM phenotype in MC38 tumor tissues of Ch25h - / - and WT mice by flow cytometry (where CD206 + represents M2 macrophages and iNOS + represents M1 macrophages);

[0083] D: Results of detecting the proportions of CD4 - / - and CD8 + T lymphocytes in MC38 tumor tissues of Ch25h + and WT mice by flow cytometry;

[0084] E: Results of detecting the proportion of CD3 - / - T lymphocytes in MC38 tumor tissues of Ch25h + and WT mice by immunofluorescence;

[0085] F: Results of detecting the proliferation of CD4 - / - and CD8 + T lymphocytes in MC38 tumor tissues of Ch25h + and WT mice by flow cytometry;

[0086] G: Results of detecting the proportions of IFNg - / - CD8 + T and TNFa + CD8 + T lymphocytes in MC38 tumor tissues of Ch25h + and WT mice by flow cytometry;

[0087] H: Results of detecting the proportions of CD45 - / - immune cells and CD8 + T lymphocytes, as well as the number of CD3 + T lymphocytes per gram of tumor tissue in B16 tumor tissues of Ch25h + and WT mice by flow cytometry.

[0088] Figure 7 : CH25H gene-deficient mice enhance the anti-tumor effect of the immune checkpoint antibody anti-PD1;

[0089] A: Growth curve results of subcutaneous xenograft tumors established with MC38 tumor cells in Ch25h - / - and WT mice and treated with the immune checkpoint inhibitor anti-PD1;

[0090] B: Growth curve results of subcutaneous xenograft tumors established with B16 tumor cells in Ch25h - / - and WT mice and treated with the immune checkpoint inhibitor anti-PD1.

[0091] Figure 8 , CD8 T cells with Ch25h knockout + have stronger anti-tumor activity

[0092] A: Results of tumor growth curves of MC38 tumor-bearing mice (CD45.2 background) treated with adoptive transfer of CTLs cells from WT and Ch25h - / - mice (CD45.1 background);

[0093] B: Results of analysis of the proportion of donor cells and effector functions in peripheral blood and tumor-infiltrating CD8 + T cells in MC38 tumor mice treated with adoptive transfer;

[0094] C: Analysis of effector molecules IFNγ and TNFα in CD8 - / - T cells of Ch25h + in peripheral blood and tumor tissues. Figure 9 : 25HC enhances the immunosuppressive function of TAM by activating the AMPKa-STAT6-ARG1 signaling pathway;

[0095] A: Results of the phosphorylation level of threonine at position 172 of adenosine monophosphate-activated protein kinase (AMPKa) in PEM treated with 25-HC;

[0096] B: Results of the phosphorylation level of threonine at position 172 of AMPKa in the macrophage cell line (iBMDM) treated with 25-HC;

[0097] C: Results of the phosphorylation level of tyrosine at position 641 of STAT6 in IL4 / IL13-treated AMPKa-knockout macrophage cell line (iBMDM-sgAmpka) and control (iBMDM-Control);

[0098] D: Results of the transcriptional level and phosphorylation level of STAT6 under the action of IL4 / IL13 in 293T cells overexpressing HA-AMPKa, FLAG-STAT6, and the luciferase reporter gene plasmid of STAT6;

[0099] E: Results of the interaction between AMPKa and STAT6 in IL4 / IL13-treated PEMs;

[0100] F: Results of the interaction between AMPKa and STAT6 in iBMDM-sgAmpka and iBMDM-Control treated with IL4 / IL13.

[0101] Figure 10 : Knockdown of Ch25h expression in macrophages using siRNA or shRNA reduces Arg1 expression in M2 macrophages;

[0102] A: Results of Ch25h expression in primary peritoneal macrophages transfected with Ch25h siRNA and control Scr siRNA;

[0103] B: Results of Arg1 expression in M2 macrophages induced by cytokines IL4 / IL13 in primary peritoneal macrophages transfected with Ch25h siRNA and control Scr siRNA;

[0104] C: Results of the content of metabolite 25-HC in M2 macrophages induced by cytokines IL4 / IL13 in primary peritoneal macrophages transfected with Ch25h siRNA and control Scr siRNA detected by LC-MS / MS;

[0105] D: Results of Ch25h expression in the macrophage cell line iBMDM transfected with Ch25h shRNA and control shRNA-Scr;

[0106] E: Results of Arg1 expression in M2 macrophages induced by cytokines IL4 / IL13 in iBMDM transfected with Ch25h shRNA and control shRNA-Scr;

[0107] F: Results of the content of metabolite 25-HC in M2 macrophages induced by cytokines IL4 / IL13 in iBMDM transfected with Ch25h shRNA and control shRNA-Scr detected by LC-MS / MS. Detailed implementation manners

[0108] The present invention first discloses a novel signaling pathway closely related to the immunotherapy (tumor inhibition) of tumors. The present invention discloses a new mechanism for regulating tumor immunotherapy involving this signaling pathway. The present invention also discloses preferred regimens and drugs for alleviating / treating tumors.

[0109] In the present invention, the role of cholesterol-25-hydroxylase (CH25H) as a tumor immunotherapy target site and in regulating the tumor immune microenvironment was studied. The base sequence of the CH25H is as shown in SEQ ID NO:1; wherein, CH25H catalyzes cholesterol to produce 25-hydroxycholesterol (25-HC), revealing the regulatory effects of the CH25H gene and its metabolite 25-HC on the functions of tumor-associated macrophages (TAM) and CD8+ T lymphocytes, thereby providing new strategies and targets for tumor immunotherapy or enhancing the effector functions of immune cells. Specifically, it was found that TAM in tumor tissues and CH25H was highly expressed and 25-HC was significantly accumulated in the tumor microenvironment; in addition, 25-HC was also accumulated in the tumor tissues of liver cancer patients, and CH25H was highly expressed in TAM of tumor patients including liver cancer, colon cancer, ovarian cancer, endometrial cancer and other tissues. 25-HC activates the AMPKa-STAT6-ARG1 signaling pathway. On the one hand, it enhances the immunosuppressive function of TAM, and on the other hand, it inhibits the killing function of CD8+ T lymphocytes and promotes their exhaustion, ultimately promoting the growth of MC38 colon cancer and B16 melanoma cells. The knockout of the CH25H gene significantly inhibited the growth of tumor cells and improved the anti-tumor effect of the immune checkpoint inhibitor anti-PD1. Therefore, by targeting and inhibiting the expression of CH25H-related genes or encoded proteins, the tumor immune microenvironment can be regulated, the anti-tumor immunity of the body can be effectively stimulated, making CH25H a target site that can enhance the response rate of tumor immunotherapy, having broad application prospects in anti-tumor immunotherapy, improving the effect of tumor immunotherapy and prolonging the survival period of patients.

[0110] Term

[0111] In this application, the term "and / or" describes the association relationship of associated objects, indicating that three relationships can exist. For example, A and / or B can represent: A exists alone, A and B exist simultaneously, and B exists alone. Wherein A and B can be singular or plural.

[0112] In the present invention, "at least one" means one or more, and "a plurality" means two or more. "At least one (item) less than the following" or its similar expression refers to any combination of these items, including any combination of single item (item) or plural items (items). For example, "at least one (item) of a, b, or c", or, "at least one (item) of a, b, and c" can both represent: a, b, c, a - b (i.e., a and b), a - c, b - c, or a - b - c, where a, b, and c can be single or plural respectively.

[0113] Inhibiting the growth of tumor cells includes promoting the apoptosis of tumor cells, inhibiting the tumorigenesis of tumor cells, and the clearance of tumor cells by the immune system.

[0114] It should be understood that in various embodiments of the present invention, the magnitude of the serial numbers of the above processes does not mean the sequence of execution. Some or all of the steps can be executed in parallel or sequentially. The execution sequence of each process should be determined by its function and internal logic, and should not constitute any limitation to the implementation process of the embodiments of the present invention.

[0115] The terms used in the embodiments of the present invention are only for the purpose of describing specific embodiments, and are not intended to limit the present invention. The singular forms "a" and "the" used in the embodiments of the present invention and the appended claims are also intended to include the plural forms, unless the context clearly indicates otherwise.

[0116] Signal Pathways and Their Regulation

[0117] As used in the present invention, the terms "(signal) pathway" and "(signal) route" can be used interchangeably.

[0118] As used in the present invention, the "(signal) pathway" refers to a signal system formed by the mutual restriction or interaction between a series of genes or proteins or their metabolites (synthetic products or processed products), and also includes the interaction between pathway proteins and other elements or organelles in the cell. Sometimes it also includes the co-participation of its upstream and downstream genes or proteins, which generally leads to the occurrence of some cell events. The CH25H (-25-HC)-AMPKa-STAT6-ARG1 signal pathway mainly includes the following elements: CH25H gene / protein, AMPKa gene / protein, STAT6 gene / protein, ARG1 gene / protein; preferably, it also includes their upstream and downstream regulatory genes / proteins or chemical molecules. Among them, the nucleotide sequence of the CH25H gene is, for example, as shown in SEQ ID NO:1.

[0119] In the present invention, unless otherwise stated, the protein / gene information in some upstream and downstream signal pathways related to the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signal pathway is known in the art.

[0120] As used in the present invention, unless otherwise stated, the target genes / proteins under discussion and the signal pathways they participate in are in tumor-associated macrophages or M2 macrophages, or in CD8 + T cells, or in tumor tissues (including the tumor microenvironment).

[0121] When used as a target for artificial regulation or when an artificial screening system is established, the proteins or coding genes in the signal pathway can be naturally occurring, for example, they can be purified and isolated from mammals; they can also be recombinantly prepared, for example, recombinant proteins can be produced according to conventional gene recombination techniques. In addition, any variant forms that do not affect the biological activity of these proteins are available, such as derivatives or variants whose functions have not changed.

[0122] The above-mentioned proteins (polypeptides) also include their variant forms, including (but not limited to): deletion, insertion and / or substitution of several (usually 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10, still more preferably 1-8, 1-5) amino acids, and addition or deletion of one or several (usually within 20, preferably within 10, more preferably within 5) amino acids at the C-terminus and / or N-terminus. Any protein with high homology to the above-mentioned protein (for example, the homology with the polypeptide sequence is 70% or higher; preferably the homology is 80% or higher; more preferably the homology is 90% or higher, such as 95%, 98% or 99% homology) and having the same function as the protein is also included in the present invention. The present invention also includes a mutant form of the protein or a protein truncation, as long as the mutant protein or truncation substantially retains the function of the full-length protein.

[0123] The sequences of the above-mentioned genes also include sequences degenerate thereto. The polynucleotides (genes) encoding the proteins can be natural genes or their degenerate sequences.

[0124] As used in the present invention, the terms "downregulation (agent)" and "inhibition (agent)" can be used interchangeably, and they also include: blockers, antagonists, etc.

[0125] The inventors of the present invention found that in the signal pathway, CH25H causes the accumulation of 25-HC, and 25-HC activates the AMPKa-STAT6-ARG1 signal pathway, enhancing the immunosuppressive function of TAM. Downregulating CH25H, reducing the accumulation of 25-HC, and reducing the activation effect on the AMPKa-STAT6-ARG1 signal pathway, thereby reducing the immunosuppressive function of tumor-associated macrophages (TAM) (and activating the cytotoxicity of CD8 + T lymphocytes). Therefore, through this mode of action, drugs suitable for targeted regulation can be screened or designed.

[0126] It should be understood that after learning the function of the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway (preferably, also including its upstream and downstream proteins or genes), various methods well-known to those skilled in the art can be used to regulate the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway. For example, various methods well-known to those skilled in the art can be used to regulate the expression of pathway proteins or cause their loss of expression.

[0127] The present invention provides a method for downregulating the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway, including targeted mutation, gene editing or gene recombination of the CH25H gene or its downstream genes in the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway, so as to achieve downregulation.

[0128] RNA interference technology is a technology for silencing gene expression. As a preferred embodiment of the present invention, a method for downregulating the expression of the CH25H gene or its downstream genes is provided, including: transferring interfering molecules (such as siRNA, shRNA, miRNA, etc.) that interfere with the expression of the CH25H gene or its downstream genes into cells, or treating cells through a suitable pathway to introduce them into cells, for example, designing a transmembrane functional domain to enable it to have the ability to cross the membrane.

[0129] As a preferred embodiment, the interference effect is carried out using siRNA technology. Small interfering RNAs consisting of sense and antisense strands of 21-23 nt are prepared. The small interfering RNAs then form a silencing complex (RNA-induced silencing complex, RISC) and unwind into single strands. The antisense strand guides the silencing complex to specifically bind to the target mRNA through base pairing, causing the mRNA to decompose. In the specific embodiments of the present invention, preferred siRNA reagents are provided.

[0130] As a preferred embodiment, the interference effect is carried out using shRNA technology. shRNA is an RNA sequence that can cause a tight hairpin to rotate and can be used to silence gene expression through RNA interference. shRNA uses a vector introduced into cells and utilizes a promoter to ensure that shRNA is always expressed. This vector is usually passed on to daughter cells, enabling gene silencing to be inherited. The shRNA hairpin structure is cleaved into siRNA by the cellular mechanism and then binds to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs that match the siRNA to which it binds. shRNA is transcribed by RNA polymerase III. In the specific embodiments of the present invention, preferred shRNA reagents are provided.

[0131] As another embodiment of the present invention, the CRISPR / Cas (Cas9) system is used for gene editing to knockdown, knockout or down-regulate target genes. Appropriate sgRNA target sites can bring higher gene editing efficiency. Therefore, before starting gene editing, it is necessary to design and find appropriate target sites. After designing specific target sites, in vitro cell activity screening is also required to obtain effective target sites for subsequent experiments. Using this method, CH25H or its downstream genes can be transformed into truncated or mutant forms with loss of function. In the specific embodiments of the present invention, preferred gene editing means are provided to achieve the knockout of CH25H (CH25H - / - ).

[0132] As an alternative way of the present invention, the method of homologous recombination can be used to specifically target CH25H or its downstream genes, causing defective expression or lack of expression. For example, the Cre and loxp methods can be applied to selectively knockout, reduce expression or inactivate related genes in the genomes of animals or cells.

[0133] In the present invention, various nucleic acid inhibitors (such as antisense nucleotides) also include modified forms, and the modifications basically do not change the activity of the nucleic acid inhibitors. More preferably, the modifications can improve the activity, stability or therapeutic effect of the nucleic acid inhibitors. The modifications of nucleic acid inhibitors include but are not limited to: methoxylation modification, thiolation modification, cholesterol modification, alkyl modification, locked nucleic acid modification, peptide nucleic acid modification, and / or nucleic acid inhibitors in which the phosphate backbone is replaced by a phospholipid linkage.

[0134] As an alternative way of the present invention, inhibitors specifically targeting CH25H or its downstream genes are provided, which are small molecule compounds targeting CH25H or its downstream genes. According to the disclosure of the present invention, those skilled in the art can adopt appropriate screening methods to screen such small molecule compounds. The screening can rely on various compound libraries existing in the art or to be developed, or some new compound libraries can be established by oneself.

[0135] Regulatory reagents and pharmaceutical compositions

[0136] As a preferred embodiment of the present invention, there is provided a down-regulator that down-regulates the expression or activity of CH25H or its downstream genes, down-regulates the interaction of CH25H or its downstream genes, or down-regulates the interaction of CH25H or its downstream genes. The down-regulator refers to any substance that can reduce the activity, reduce the stability, down-regulate the expression, reduce the activation level (such as reducing the phosphorylation level), reduce the effective action time, inhibit their transcription and translation of CH25H or its downstream genes. These substances can all be used in the present invention as substances potentially useful for tumor immunotherapy. They can be compounds, small chemical molecules, or biomolecules. The biomolecules can be at the nucleic acid level (including DNA, RNA) or at the protein level.

[0137] In the present invention, the down-regulator can be: nucleic acid inhibitors, protein inhibitors, antibodies, ligands, compounds, nucleases, nucleic acid-binding molecules, etc., provided that it can down-regulate the expression of CH25H or its downstream genes, inhibit its activity or function or interaction. The nucleic acid inhibitors include: small interfering RNAs, shRNAs, sgRNAs, antisense nucleic acids, microRNAs that target the coding gene or its transcript of CH25H or its downstream genes, or constructs that can express or form the small interfering RNAs, shRNAs, sgRNAs, antisense nucleic acids, microRNAs.

[0138] For example, the down-regulator is: an interfering RNA molecule or antisense nucleotide that specifically interferes with the expression of CH25H or its downstream genes; or a homologous recombination, targeted mutation, or gene editing reagent that specifically targets CH25H or its downstream genes, and so on.

[0139] The present invention also provides a pharmaceutical composition for tumor immunotherapy, comprising an effective amount of the down-regulator of the present invention.

[0140] In a more preferred embodiment, the pharmaceutical composition further comprises an immune checkpoint inhibitor. The inventors unexpectedly found that the combined use of the CH25H down-regulator and the immune checkpoint inhibitor can extremely significantly improve the effect of tumor suppression. The combined use of the two shows a significant synergistic effect.

[0141] As used herein, the term "effective amount" or "effective dose" refers to an amount that can produce a function or activity in humans and / or animals and is acceptable to humans and / or animals as used herein.

[0142] As used herein, "pharmaceutically acceptable" ingredients are those that are suitable for humans and / or mammals without excessive adverse side effects (such as toxicity, irritation, and allergic reactions), that is, substances with a reasonable benefit / risk ratio. The term "pharmaceutically acceptable carrier" refers to a carrier used for administering a therapeutic agent, including various excipients and diluents.

[0143] The present invention also provides a medicine box for tumor immunotherapy, which comprises: a down-regulator according to the present invention in an effective amount, and an immune checkpoint inhibitor in an effective amount. More preferably, the medicine box further comprises: an instruction manual to guide clinicians to use the medicine in a correct and reasonable manner.

[0144] For the convenience of drug administration, the down-regulator and / or the immune checkpoint inhibitor are made into a unit dosage form and placed in a kit. "Unit dosage form" refers to a dosage form prepared for the convenience of drug use, which is the dosage form required for single-dose medication, including but not limited to various liquid preparations (such as injections), solid preparations (such as tablets), capsules, sustained-release preparations. In addition, the down-regulator and / or the immune checkpoint inhibitor can also be independently placed in different containers and mixed and applied when needed.

[0145] In some embodiments, the drug comprises a promoter for tumor immunotherapy. In the specific use process, a drug for preventing or treating tumors prepared with CH25H as a tumor immunotherapy target can be used as a promoter in combination with other tumor immunotherapy drugs to improve the effect of tumor immunotherapy.

[0146] In some embodiments, the application includes: using CH25H as a tumor immunotherapy target to activate cytotoxic immune cells in immunotherapy.

[0147] In some embodiments, the mechanism of using CH25H as a tumor immunotherapy target for immunotherapy is: by inhibiting CH25H gene expression, down-regulating the content of 25-HC, and activating cytotoxic immune cells to act.

[0148] In some embodiments, the cytotoxic immune cells include CD8 + T cells, at least one of NK cells.

[0149] In some embodiments, the dosage form of the drug is selected from at least one of tablets, capsules, granules, pills, injections, suspensions, dispersions, syrups. However, the dosage form of the drug of the present invention is not limited thereto, and other achievable dosage forms are within the protection scope of the present invention.

[0150] In some embodiments, the tumor includes a primary tumor and a metastatic tumor.

[0151] In some embodiments, the tumor includes solid tumors such as melanoma, colon cancer, lung cancer, liver cancer, etc.

[0152] In some embodiments, the drug comprises at least one of a drug for inhibiting the growth of tumor cells, a drug for enhancing the killing power against tumor cells, a drug for prolonging the survival time of the tumor-bearing organism, and a drug for increasing the presentation of tumor cell surface antigens.

[0153] In some embodiments, the expression of the CH25H gene is inhibited by gene editing to cause base insertion mutation, base deletion mutation, non-synonymous base mutation or whole gene loss of the CH25H gene.

[0154] In some embodiments, the reagent for inhibiting the expression of the CH25H gene includes an RNA molecule that interferes with the CH25H gene.

[0155] In some embodiments, the reagent for inhibiting the expression of the CH25H protein or losing the activity of the CH25H protein includes a CH25H protein antibody or a small molecule inhibitor of the CH25H protein.

[0156] In some embodiments, the drug further includes a pharmaceutically acceptable excipient. Adding a pharmaceutically acceptable drug excipient in the drug ensures the preparation and clinical application of the prepared drug. In some specific embodiments, the drug excipient is selected from at least one of a diluent, a wetting agent, a binder, a lubricant, a coloring agent, and a coating agent.

[0157] Although in the specific embodiments of the present invention, a dosing regimen for animals such as mice is given. It should be understood that converting the dosing dose from animals such as mice to a dosing dose applicable to humans is easily made by those skilled in the art. For example, it can be calculated according to the Meeh-Rubner formula: Meeh-Rubner formula: A = k × (W 2 / 3 ) / 10,000. In the formula, A is the body surface area, calculated in m 2 ; W is the body weight, calculated in g; K is a constant, which varies with the animal species. For example, but not limited to: 9.1 for mice and rats, 9.8 for guinea pigs, 10.1 for rabbits, 9.9 for cats, 11.2 for dogs, 11.8 for monkeys, and 10.6 for humans. It should be understood that according to the different drugs and clinical situations, according to the evaluation of an experienced pharmacist, the conversion of the dosing dose can be changed.

[0158] The technical solution of the present invention starts from the regulation of immune cells and improves the effect of tumor immunotherapy, thereby having a broad-spectrum anti-tumor effect.

[0159] Drug screening

[0160] Based on the new discovery of the present inventors, the research on the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway has various uses, and the uses include: screening substances that regulate this signaling pathway, with the expectation of being used as tumor immunotherapy drugs. Among them, the regulation includes: silencing, knocking down or knocking out the CH25H gene agent, inhibiting the activity of the CH25H protein, etc.

[0161] The present invention provides a method for screening down-regulators that modulate the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway. The screening is carried out by adding a candidate substance to be screened into a system containing the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway and observing the changes or interactions of various proteins or genes in the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway. If the candidate substance down-regulates CH25H, thereby reducing the accumulation of 25-HC, reducing the activation effect on the AMPKa-STAT6-ARG1 signaling pathway, and reducing the immunosuppressive function of TAM, then the substance is a tumor immunotherapy drug (including potential drugs).

[0162] As used herein, "inhibition", "down-regulation", etc. all refer to "inhibition" and "down-regulation" with statistical significance. That is: significantly "inhibit" and "down-regulate". For example, compared with the protein activity, protein expression, protein binding or methylation level of the control group, it is significantly "inhibited" or "down-regulated" by more than 10%, 20%, 30%, 40%, 50%; more preferably, more than 60%, 70%, 80%.

[0163] The system containing the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway is selected from: cell system (or cell culture system), subcellular system (or subcellular culture system), solution system, animal system or tissue system (or tissue culture system). Preferably, the system containing the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway is a tumor-associated macrophage or M2-type macrophage (or cell culture) system.

[0164] As a preferred embodiment of the present invention, the method further includes: performing further cell experiments and / or animal tests on the obtained potential substances to further select and determine substances useful for tumor immunotherapy (inhibiting tumors) from the candidate substances.

[0165] When screening, various techniques well known in the art can be used to determine the changes and interactions of proteins or their coding genes.

[0166] A variety of conventional techniques can be used to identify the transcription or expression of genes in the system. These techniques include but are not limited to: oligonucleotide hybridization techniques (such as probes), polymerase chain reaction (PCR), polyacrylamide gel electrophoresis, etc. To detect the interaction between proteins and the strength of the interaction, a variety of techniques well known to those skilled in the art can be used, such as co-immunoprecipitation techniques, GST precipitation techniques, phage display techniques or yeast two-hybrid systems. The nuclear localization of proteins is also a technique well known in the art.

[0167] The substances preliminarily screened by the above method can form a screening library, so that people can finally screen out the substances useful for tumor immunotherapy from it.

[0168] The present invention also provides potential substances for tumor immunotherapy obtained by using the screening method.

[0169] The substances useful for tumor immunotherapy obtained can be used to prepare a pharmaceutical composition, as described in the following text of the present invention.

[0170] The methods of screening substances acting on a target by using a protein or a gene or a specific region thereof as the target are well known to those skilled in the art, and these methods can all be used in the present invention. The candidate substances may be selected from: peptides, polymeric peptides, peptidomimetics, non-peptide compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, organic small molecules, inorganic small molecules, nucleic acid sequences, etc. Those skilled in the art know clearly how to select a suitable screening method according to the type of the substance to be screened.

[0171] Applications in diagnosis or prognostic assessment

[0172] It is found in the present invention that tumor-associated macrophages and M2 macrophages highly express CH25H and accumulate 25-HC, and 25-HC enhances the immunosuppressive function of TAM and M2 macrophages. The immunosuppressive function of M2 macrophages and TAM with Ch25h - / - gene deletion is reduced, and 25-HC enhances the immunosuppressive function of TAM by activating the AMPKa-STAT6-ARG1 signaling pathway. Therefore, CH25H participates in a new signaling pathway: the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway. CH25H and the signaling pathway it participates in can be used as molecular markers for guiding the diagnosis or prognosis (including medication guidance) of tumor immunotherapy: (i) for disease typing and differential diagnosis; (ii) for evaluating the therapeutic drugs, drug efficacy, prognosis of relevant populations, and selecting appropriate treatment methods. For example, the population with abnormal (increased) CH25H gene expression can be isolated, so that more targeted treatment can be carried out.

[0173] The prognosis of a disease of a subject providing the sample to be evaluated can be predicted by determining the expression or activity of CH25H or the pathway genes / proteins of the signaling pathway in which it participates, and an appropriate drug can be selected for treatment. Generally, a threshold for CH25H expression can be defined. When the expression of CH25H is higher than the defined threshold, a regimen for inhibiting CH25H can be considered for treatment. The said threshold is easy to determine for those skilled in the art. For example, by comparing and analyzing the general CH25H expression in tumor immunotherapy patients or the expression in normal healthy people, a threshold for abnormal CH25H expression can be obtained.

[0174] Therefore, the present invention provides the use of CH25H or the pathway genes / proteins of the signaling pathway in which it participates for preparing a reagent or kit for evaluating the prognosis of tumor immunotherapy. Various techniques known in the art can be used to detect the presence and expression of the corresponding genes or proteins, and these techniques are all included in the present invention. For example, existing techniques such as Southern blotting, Western blotting, DNA sequence analysis, PCR, etc. can be used, and these methods can be used in combination. The present invention also provides a reagent for detecting the presence and expression of a gene or protein in an analyte. Preferably, when detecting at the gene level, specific amplification primers or probes for specific recognition can be used to determine the presence of the target gene; when detecting at the protein level, an antibody or ligand that specifically binds to the protein can be used to determine the expression of the target protein.

[0175] The said kit may further include various reagents required for DNA extraction, PCR, hybridization, color development, etc., including but not limited to: extraction solution, amplification solution, hybridization solution, enzyme, control solution, color development solution, washing solution, etc. In addition, the said kit may further include an instruction manual and / or nucleic acid sequence analysis software, etc.

[0176] The present invention will be further illustrated below with specific examples. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following examples are generally carried out under conventional conditions such as those described in Molecular Cloning: A Laboratory Manual, 3rd edition, edited by J. Sambrook et al., Science Press, or under the conditions recommended by the manufacturer.

[0177] Materials and Methods

[0178] 1. Cells and Animals

[0179] The 293T cells were obtained from the Cell Bank of the Chinese Academy of Sciences, with the catalog number GNHu17; the iBMDM were a kind gift from the group of Academician Feng Shao at the Beijing Institute of Life Sciences; the MC38 cell line was from the group of Chenqi Xu at the Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences; the B16-F10 cell line was obtained from the Cell Bank of the Chinese Academy of Sciences, with the catalog number TCM36; the LLC cell line was from the Cell Bank of the Chinese Academy of Sciences, with the catalog number TCM7; the Hepa1-6 cell line was from the Cell Bank of the Chinese Academy of Sciences, with the catalog number TCM39. All of the above cell lines were cultured in complete DMEM medium (containing 10% FBS, 2 mM L-Glutamine, 100 U / ml penicillin-streptomycin).

[0180] C57BL / 6 mice were purchased from Shanghai SLAC Laboratory Animal Co., Ltd., CD45.1 mice were obtained from the group of Xiaolong Liu at the Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences, and Ch25h gene knockout mice were purchased from Jackson Laboratory (catalog number: 016263). All mice were housed in the SPF animal facility of the Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences (number: No.SIBCB-S333-2112-044).

[0181] 2. Main Reagents

[0182]

[0183]

[0184] 3. RNA Extraction, Reverse Transcription and Real-Time Quantitative PCR

[0185] After cell treatment, the cells were collected, washed once with PBS, added with 1 ml of Trizol for lysis, incubated at room temperature for 5 min, added with 200 μl of chloroform, vortexed vigorously, incubated at room temperature for 3 minutes, centrifuged at 12000 rpm at 4°C for 15 min. Take the upper aqueous phase (the upper liquid, about 500 μl) and add an equal volume of isopropanol, incubated at room temperature for 10 min, centrifuged at 12000 rpm at 4°C for 10 min, added with 1 mL of 75% ethanol for washing once, centrifuged at 12000 rpm at 4°C for 5 min. Discard the supernatant, suck the liquid dry with a small tip, air-dry the precipitate for 5 - 10 min, add 20 μl of ddH2O (DEPC-treated) to dissolve and mix well, and then measure the RNA concentration with Nanodrop. The RNA was stored at -80°C.

[0186] Reverse transcription: First, mix 1 μg of RNA and 100 ng of Oligo(dN6), and adjust the volume to 14 μl with DEPC water. Incubate at 70 °C for 10 min, quickly ice-bath for 2 min, then add 4 μl of reverse transcriptase buffer (5X), 1 μl of M-MLV reverse transcriptase, and 1 μl of 10 mM dNTP, and adjust the volume to 20 μl with DEPC water. Incubate at 37 °C for 1 h, and inactivate the reverse transcriptase activity at 72 °C for 10 min. Add 180 μl of deionized water to the reverse transcription product, which can be used as the cDNA template for the qPCR reaction.

[0187] The qPCR reaction system is 20 μl: 3.2 μl of deionized water, 10 μl of SYBR-Green Master Mix, 6 μl of diluted cDNA template, and 0.8 μl of forward and reverse primers (10 μM each). The reaction program is as follows: 95 °C for 3 min; 95 °C for 10 sec, 60 °C for 30 sec, 72 °C for 30 sec, read the fluorescence value, for a total of 40 cycles; 95 °C for 1 min; 55 °C for 1 min; melting at 55 °C - 98 °C, with the temperature increasing by 5 °C every 5 sec, and read the fluorescence value simultaneously.

[0188] The RT-qPCR primer sequences are as follows:

[0189]

[0190]

[0191] 4. LC-MS / MS detection of cholesterol metabolites

[0192] Quantitative analysis of sterols was performed using LC-MS / MS. The steps included: Mixing 50 μL of plasma with 1 mL of pre-cooled methanol-water (10:1, -20 °C) and 10 μL of internal standard methanol solution (cholesterol-d7, 24-hydroxycholesterol-d7, campesterol-d3, estrone-d2, estradiol-d2, dehydroepiandrosterone-d2, β-sitosterol-d7) (Steraloids, USA). After centrifuging for 10 min (12,000 rpm, 4 °C), the supernatant was obtained, dried with nitrogen, and the extraction residue was obtained. For cells and tissues, approximately 10 mg of the sample was processed in the same manner. In both cases, the sample was further processed with a tissue lyser (20 Hz, 90°), with repeated freeze-thaw cycles and centrifugation before 15 min of sonication. 100 μL of the derivatization reagent pyridine solution was added to the extraction residue of each sample. The derivatization reagent included 2-pyridinecarboxylic acid (8 mg), 2-methyl-6-nitrophthalic anhydride (22 mg), and dimethylaminopyridine (4 mg) (Aladdin, Shanghai, China). After standing at 80 °C for 60 min, 200 μL of water was added, and extraction was performed with 1.5 mL of MTBE. The upper layer was dried with nitrogen and then redissolved in 100 μL of acetonitrile for LC-MS / MS analysis. LC-MS / MS analysis was performed using a 30AD UHPLC (Shimadzu, Japan) and a QTRAP 6500plus mass spectrometer (SCIEX, USA). Data acquisition was performed using Analyst (V1.7, Sciex) software, and data processing was performed using OS (V2.0, Sciex) software. Chromatographic separation was performed using a Zorbax Eclipse plus C18 column (100x2.1 mm, 1.8 mm, Agilent, USA), with an injection volume of 5 μL; gradient elution was performed using water containing 0.1% formic acid (A) and acetonitrile (B). Optimized electrospray ionization source mass spectrometer parameters included an ion spray voltage (5500 V), curtain gas (40 psi), and temperature (550 °C). After method validation, all detectable sterols were quantified using these internal standards.

[0193] 5. Detection of the percentage and activity of immune cells by flow cytometry

[0194] Surface molecule staining: After the treated cells were resuspended evenly, they were transferred to a 1.5 mL centrifuge tube, centrifuged at 1000 rpm for 5 min to obtain cell pellets. The antibody was diluted with FACS buffer (1:200 (v / v)), and 50 μL of the FACS buffer containing the antibody was used to resuspend the cells in each tube. Incubation was carried out at 4 °C in the dark for 25 min, terminated with 200 μL of FACS buffer, centrifuged at 1000 rpm for 5 min. The obtained cell pellets were resuspended with a certain volume of FACS buffer, filtered, and then detected by flow cytometry.

[0195] Intracellular cytokine staining: For intracellular cytokine staining of TNFα or IFNγ, etc.: Primary CD8 + After 24 h of activation of primary CD8

[0196] + T cells, after treatment with Monensin for 4 - 6 h, the collected cells are surface stained. The cell pellet obtained by centrifugation is fixed with 200 μl of 4% PFA at room temperature for 30 min, terminated with 300 μl of 0.1% Triton, centrifuged at 1600 rpm for 5 min. The antibody is diluted with 0.1% Triton (1:200 (v / v)), and each tube of cell pellet is resuspended with 50 μl of FACS buffer containing the antibody, incubated in the dark at 4°C for 40 min, terminated with 0.1% Triton, centrifuged at 1600 rpm for 5 min. The obtained cell pellet is resuspended with a certain volume of FACS buffer, filtered, and then analyzed on the flow cytometer.

[0197]

[0197] ① One day in advance: Dilute anti-CD3 / CD28 antibody with coating buffer to a final concentration of 2 μg / ml + 2 μg / ml, add 200 μl or 100 μl to 48-well plates or 96-well plates, and incubate overnight at 4°C;

[0198] ② After decapitating 6 - 10-week-old mice, soak them in 75% alcohol for 3 - 5 minutes; Dissect the mice in a laminar flow hood, remove the axillary and inguinal lymph nodes and spleen, soak them in a 6 cm Petri dish with Killing buffer (RMPI 1640 + 3% FBS + double antibodies), grind them through a 70 μM filter to make a single cell suspension; Centrifuge at 1200 rpm for 5 min, lyse red blood cells with 5 ml of lysis buffer, filter, centrifuge at 1200 rpm for 5 min, resuspend 1 ml of the cell pellet in CD8 + T cell negative selection buffer in a 2 ml centrifuge tube, centrifuge at 1200 rpm for 5 min; Resuspend with 400 μl of negative selection buffer and add 80 μl of CD8 + T cell negative selection antibody cocktail (Invitrogen), incubate at room temperature for 15 min, gently flick the tube wall to mix once in the middle, terminate with 500 μl of negative selection buffer, centrifuge at 1200 rpm for 5 min;

[0199] ③ The obtained cell pellet was resuspended in 400 μl of negative selection buffer and negative selection beads B were added, followed by incubation at room temperature for 15 min. During this period, the tube wall was gently flicked once to mix evenly. Then, 500 μl of negative selection buffer was freshly added and blown to be homogeneous. It was adsorbed on a negative selection magnetic stand (Invitrogen) for 5 min. The supernatant was carefully aspirated and transferred to a new 2-ml centrifuge tube. The adsorption step was repeated for 5 min, and the supernatant was aspirated. Then, it was centrifuged at 1200 rpm for 5 min, washed once with RPMI 1640, and centrifuged at 1200 rpm for 5 min. After the obtained cell pellet was resuspended in complete RPMI 1640 medium, cell counting was performed.

[0200] ④ The 48-well or 96-well plate incubated with Anti-CD3 / CD28 antibody overnight was washed once with PBS. The counted primary CD8 + T cells were added with IL-2 and seeded into the wells at a density of 1 - 3 million / ml. After 48 h, part of the cells were collected as effector T cells to detect cell activation, production of effector molecules, and proliferation. The remaining cells were resuspended in fresh medium containing IL-2 and seeded into a new plate coated with antibody to induce exhausted T cells. Stimulation was performed once every two days for five consecutive rounds. At the end of each round of stimulation, part of the cells were collected for functional detection.

[0201] 7. Induction, isolation, and culture of primary murine macrophages

[0202] Mice over 12 weeks old were intraperitoneally injected with 3% thioglycolate aqueous solution, 3 mL for each mouse. Four days later, the mice were sacrificed by decapitation or carbon dioxide asphyxiation, and then immersed in sterilized alcohol for 2 min. The mice were placed ventral side up and flat, and a small incision was carefully made on the outer abdomen while keeping the peritoneum intact. 5 mL of DMEM culture medium was injected into the peritoneal cavity of the mouse using a 5-mL syringe, and then the syringe was withdrawn. The mouse abdomen was massaged several times. The syringe needle was inserted into the peritoneal cavity of the mouse again, and as much liquid as possible was aspirated and transferred into a centrifuge tube. It was centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. It was resuspended with an appropriate amount of complete medium, counted, and seeded according to experimental requirements. After overnight cell culture, the adherent cells were peritoneal macrophages for downstream experiments.

[0203] 8. Tumor model construction and anti-PD1 treatment

[0204] The B16-F10 melanoma cell line (0.2 x 10 6 cells) or MC38 colorectal cancer cell line (0.5 x 10 6 cells) was subcutaneously injected into the abdomen of WT or Ch25h - / - mice. The tumor volume was measured every 2 to 3 days, and the calculation formula was: V = (minor tumor axis) 2 x (major tumor axis) / 2. When the tumor volume reached 80 - 100 mm3 At that time, anti-PD1 antibody (BioXcell, clone number 29F.1A12) (200 μg / mouse) was intraperitoneally injected every 3 days.

[0205] 9. CD8 + Adoptive transfer experiment of CD8 T cells

[0206] 4x10 MC38 tumor cells were inoculated at the right inguinal position of C57BL / 6 recipient mice. After 8 days, mice with similar tumor sizes were randomly divided into two groups, and 5x10 5 activated CD8 5 donor cells (WT and Ch25h with CD45.1 background + were used as donor mice, and their CD8 - / - T cells were activated with anti-CD3 / CD28 for 48 h). The tumor size was observed, and the length and width of the tumor were measured with a vernier caliper every other day and recorded. Mice were sacrificed when the tumor volume exceeded the ethical standard; about 20 days after inoculating tumor cells, when the average tumor volume reached 1500 mm + , the mice were sacrificed, and the proportion and function of tumor-infiltrating cells were analyzed. 3 10. Nucleotide sequence of CH25H (SEQ ID NO:1; human source):

[0207] 10. Nucleotide sequence of CH25H (SEQ ID NO:1; human source):

[0208] atgagctgccacaactgctccgacccccaggtcctttgcagctccgggcagctgttcctgcagcccctctgggaccacctgaggagctgggaggccctcctacagtcgcccttcttcccggtcatcttctccatcaccacatacgtgggcttttgcctgcccttcgtggtcctggatatcctgtgctcctgggtgcccgccctgcggcgctacaagatccaccctgacttctcgccatccgcgcagcagctgctaccttgcctggggcagaccctctaccagcatgtgatgtttgtgttccccgtgacgctgctgcattgggcccgcagcccggccctcctgccccacgaagctcccgagctgctcctgctgctgcaccacatcctgttctgcctgctactcttcgacatggagttcttcgtgtggcacctgctgcaccacaaggtgccctggctgtaccgcaccttccacaaggtgcaccaccagaactcgtcctcgttcgcgctggcaacgcagtatatgagcgtctgggaactgttttctttgggcttcttcgacatgatgaacgtcacactgctcgggtgccacccgctcaccaccctgaccttccacgtggtcaacatctggctttccgtggaggaccactccggctacaacttcccttggtccactcacagactggtgcccttcgggtggtacgggggtgtggtgcaccacgacctgcatcactctcactttaactgcaacttcgctccgtactttacacactgggacaaaatactgggaacgctgcggactgcatctgtcccagcgcggtg

[0209] 11. Statistical analysis

[0210] The inventor of the present invention performed statistical analysis on all data using GraphPad Prism 9 software. Unpaired t-tests, one-way ANOVA, or two-way ANOVA were used for between-group comparisons. ns, not significant (p>0.05); *P<0.05; **P<0.01; ***P<0.001; ****P<0.0001.

[0211] Example 1: Tumor-associated macrophages and M2 macrophages highly express CH25H and accumulate 25-HC

[0212] To detect the expression of CH25H in M2 macrophages, M2 macrophages were induced with cytokines IL4 and IL13, and the protein expression level, gene expression level of CH25H, and the content of metabolite 25-HC in M2 macrophages were detected by WB, RT-qPCR, and LC-MS / MS methods, respectively.

[0213] To detect the expression of Ch25h in tumor-associated macrophages (TAM), a subcutaneous xenograft tumor model of Hepa1-6 liver cancer mice was constructed, and TAM in tumor tissues was sorted. The Ch25h gene expression in resting PEM and TAM was detected by RT-qPCR, and the content of 25-HC in PEM and TAM was detected by LC-MS / MS method.

[0214] To detect and analyze the expression of CH25H and the content of 25-HC in tumor tissues of cancer patients, tumor tissues and adjacent tissues of liver cancer patients were collected. Macrophages or monocytes in the tissues were sorted by flow cytometry. The expression of CH25H was detected by RT-qPCR, and the content of 25-HC in the tissues was detected by LC-MS / MS method. Furthermore, the expression of CH25H in different subsets of macrophages was analyzed through the single-cell sequencing database of cancer patients.

[0215] The experimental results showed that: IL4 and IL13 induced the protein expression of CH25H in a time-gradient-dependent manner ( Figure 1 A), and M2 macrophages increased the Ch25h gene expression and accumulated 25-HC ( Figure 1 B).

[0216] In addition, the Ch25h gene expression was increased and 25-HC was accumulated in TAM of Hepa1-6 liver cancer tissues ( Figure 1 C).

[0217] Compared with adjacent tissues, the expression of CH25H was upregulated in macrophages or monocytes in tumor tissues of liver cancer patients ( Figure 1 D), and 25-HC was accumulated ( Figure 1 E).

[0218] Single-cell sequencing database analysis showed that MARCO was highly expressed in macrophages in ovarian cancer (OV) tissues + CH25H was highly expressed in C1QC TAMs in colon cancer (CRC) tissues + CH25H was highly expressed in LYVE TAMs in kidney cancer (KIDNEY) and endometrial cancer (UCEC) tissues + CH25H was highly expressed in LYVE TAMs

[0219] Example 2: Accumulation of 25-HC in tumor tissues and microenvironment

[0220] To detect the levels of various oxysterols in the tumor microenvironment, subcutaneous tumor models were established in C57BL / 6 mice using colon cancer cells MC38 and melanoma cells B16F10. After 25 days of tumor growth, peripheral blood, tumor interstitial fluid, and tumor tissues of tumor-bearing mice were collected, and the contents of various oxysterols were detected by LC-MS / MS

[0221] The experimental results showed that: in MC38 tumor tissues, the content of 25-HC was the highest compared with other various oxysterols ( Figure 2 A). Compared with peripheral serum, the enrichment degree of 25-HC in tumor interstitial fluid was significantly increased ( Figure 2 B). Similar phenomena were observed in the B16F10 melanoma model: the content of 25-HC in melanoma tumor tissues was significantly higher than that of other oxysterols ( Figure 2 C); the content of 25-HC in tumor interstitial fluid was significantly higher than that in peripheral serum ( Figure 2 D).

[0222] Example 3: High expression of CH25H in tumor tissues is negatively correlated with the survival rate of tumor patients

[0223] To analyze the correlation between the expression of CH25H in tumor tissues and the survival rate of tumor patients, the correlation between the expression of CH25H in tumor tissues and the survival rate of tumor patients was analyzed through tumor tissue samples recorded in The Cancer Genome Atlas (TCGA). The tumors included colon cancer (COADREAD), lymphoma (AML), lung cancer (LUSC), and pancreatic cancer (PAAD). The number of cases analyzed was recorded in Figure 3 in

[0224] The experimental results showed that: high expression of CH25H in tumor tissues was negatively correlated with the survival rate of tumor patients ( Figure 3 ).

[0225] Example 4: 25-HC enhanced the immunosuppressive function of TAMs and M2 macrophages

[0226] In order to detect the effect of CH25H / 25-HC on the immunosuppressive function of TAM and M2 macrophages, firstly, LC-MS / MS was used to detect the expression of Ch25h - / - The content of 25-HC in M2 macrophages (knocked out by CRISPR / Cas9 technology, obtained from Jackson Laboratory) and wild-type (WT) M2 macrophages was detected by RT-qPCR. - / - The expression of genes Ch25h, Arg1 and Mrc1 in WT-M2 macrophages was also detected by WB. - / - The protein expressions of transcription factor STAT6 and phosphorylated STAT6 (Tyr641) were detected in the conditioned medium of MC38 and LLC during the induction of Ch25h. - / - The expression of Arg1 gene in M2 macrophages induced by 25-HC combined with IL4 and IL13 was also detected by RT-qPCR. - / - and WT-M2 macrophages and TAMs inhibit CD8 + T cell proliferation; Finally, RT-qPCR was used to detect the induction of Ch25h by 25-HC combined with IL4 and IL13 - / - and Arg1 gene expression in WT-M2 macrophages.

[0227] The experimental results show that: Ch25h - / - Gene-deficient M2 macrophages completely abolished the production of 25-HC ( Figure 4 A), and significantly inhibited the expression of M2 macrophage-related genes Arg1 and Mcr1 ( Figure 4 B), and also significantly inhibited the activity of STAT6 ( Figure 4 C).

[0228] In addition, Ch25h - / - Arg1 expression was also significantly downregulated in TAMs with gene deletion ( Figure 4 D), and 25-HC treatment can further enhance Arg1 expression ( Figure 4 E).

[0229] In addition, Ch25h - / - The immunosuppressive function of gene-deficient M2 macrophages and TAMs is reduced ( Figure 4 F and G), and the addition of 25-HC can restore Ch25h - / - Arg1 expression in gene-deficient M2 macrophages enhances TAM immunosuppressive function (Figure 4 H).

[0230] Example 5. CH25H / 25-HC Participates in the AMPKa-STAT6-ARG1 Signaling Pathway and Enhances the Immunosuppressive Function of TAMs

[0231] To explore the molecular mechanism by which the accumulation of 25-HC caused by CH25H enhances the immunosuppressive function of TAMs, the inventors treated primary macrophages (PEM) and macrophage cell lines (iBMDM) with 25-HC in vitro and detected the phosphorylation level of threonine at position 172 (active site) of adenosine monophosphate-activated protein kinase (AMPKa).

[0232] Furthermore, the inventors constructed an AMPKa-knockout macrophage cell line (iBMDM-sgAmpka) and a control cell line (iBMDM-Control) using CRISPR / Cas9 technology, and detected the phosphorylation level of tyrosine at position 641 (active site) of STAT6 under the action of IL4 / IL13. Among them, the sgAmpka sequences are as follows:

[0233] mAmpkα1gRNA1: 5′-CACCGAGGGTGCCTGAACAGCTTC-3’ (SEQ ID NO:14);

[0234] mAmpkα1gRNA2: 5′-AAACGAAGCTGTTCAGGCACCCTCC-3’ (SEQ ID NO:15);

[0235] mAmpkα2gRNA1: 5′-CACCGACCTCAGGTGCTGCATAATT-3’ (SEQ ID NO:16);

[0236] mAmpkα2gRNA2: 5′-AAACAATTATGCAGCACCTGAGGTC-3’ (SEQ ID NO:17).

[0237] In addition, the inventors overexpressed HA-AMPKa, FLAG-STAT6, and the luciferase reporter gene plasmid of STAT6 in 293T cells, and detected the transcriptional level and phosphorylation level of STAT6 by luciferase reporter gene and WB experiments under the action of IL4 / IL13.

[0238] Finally, the inventors detected the interaction between AMPKa and STAT6 in PEM and iBMDM treated with IL4 / IL13 by co-immunoprecipitation experiments.

[0239] Experimental results showed that the accumulation of 25-HC caused by CH25H further enhanced the activity of AMPKa in PEM and iBMDM ( Figure 9 A and B); macrophages lacking Ampka downregulated the activity of STAT6 ( Figure 9 C), on the contrary, overexpression of AMPKa enhanced the transcriptional level and activity of STAT6 ( Figure 9 D); co-immunoprecipitation experiments confirmed the interaction between AMPKa and STAT6 ( Figure 9 E and 9F). It is known that STAT6 directly regulates ARG1 expression.

[0240] Therefore, the accumulation of 25-HC caused by CH25H enhances the immunosuppressive function of TAM by activating the AMPKa-STAT6-ARG1 signaling pathway, and inhibiting 25-HC is beneficial to reducing the immunosuppressive function of TAM.

[0241] Example 6: Knockdown of Ch25h expression in macrophages using siRNA or shRNA to reduce Arg1 expression in M2 macrophages

[0242] Primary peritoneal macrophages and the macrophage cell line iBMDM were transfected with Ch25h siRNA and shRNA respectively to detect the effect of the reagents on the gene Ch25h in the activation of M2 macrophages. After confirming the knockdown efficiency of Ch25h, M2 macrophages induced by cytokines IL4 / IL13 were used, and Arg1 expression was detected. Further, the content of the metabolite 25-HC was detected by LC-MS / MS.

[0243] Ch25h siRNA sequence:

[0244] sense: 5’-GCAUCACUCUCAGUUUAACUU-3’ (SEQ ID NO:2);

[0245] antisense: 5’-GUUAAACUGAGAGUGAUGCUU-3’ (SEQ ID NO:3).

[0246] Ch25h shRNA sequence:

[0247] Forward oligo: 5’-CCGGGCATCACTCTCAGTTTAACCTCGAGGTTAAACTGAGAGTGATGCTTTTTG-3’ (SEQ ID NO:4);

[0248] Reverse oligo: 5’-AATTCAAAAAGCATCACTCTCAGTTTAACCTCGAGGTTAAACTGAGAGTGATGC-3’ (SEQ ID NO:5).

[0249] The experimental results showed that: inhibiting the expression of the Ch25h gene significantly reduced the expression of the Ch25h gene ( Figure 10 A and D) and the level of the metabolite 25-HC ( Figure 10 C and F), and reduced the expression of Arg1 in M2 macrophages ( Figure 10 B and E).

[0250] Example 7, 25-HC inhibited the effector function of CD8 + T lymphocytes and promoted their exhaustion

[0251] To detect the effect of 25-HC on the effector function of CD8 + T cells, after CD8 + T cells were activated by anti-CD3 / CD28 for 12 hours, then treated with 25-HC at different concentration gradients (100 nM, 1 μM) for 12 hours. After treating the cells with Monensin for 5 hours, the cells were collected and the expression of the effector molecules TNFα and IFNγ in CD8 + T cells was detected by flow antibody staining and flow cytometry; to detect the expression of CH25H at different stages of CD8 + T cell activation, resting CD8 + T cells were induced to effector T cells (Day2) and exhausted T cells (Day8) at different times by anti-CD3 / CD28 antibody activation. The expression of CH25H in CD8 + T cells in three states was detected by RT-qPCR and Western blot; to detect the function of CH25H in CD8 + T cells, WT and Ch25h - / - CD8 + T cells (knocked out by CRISPR / Cas9 technology, obtained from the JACKSON laboratory) were induced to the exhausted stage by antibody activation, and the cells were collected to detect the proportions of their effector T cells and exhausted T cells by flow cytometry.

[0252] The experimental results showed that: compared with the control group (DMSO), 100 nM and 1 μM of 25-HC could significantly inhibit the levels of the effector molecules TNFα and IFNγ expressed by CD8 + T cells ( Figure 5 A, 5B).

[0253] Compared with resting CD8 + T cells or effector T cells, CD8 + T cells expressed significantly more CH25H in vitro after antibody activation and exhaustion, including mRNA and protein levels ( Figure 5 C, 5D).

[0254] Furthermore, knockout of CH25H increased the expression of effector CD8 + T ratio, while reducing terminally exhausted CD8 + T cell ratio ( Figure 5 E).

[0255] Example 8: More immune cells infiltrate tumor tissues in CH25H gene-deficient mice

[0256] In order to verify the inhibitory effect of CH25H gene deletion on tumor cell growth, - / - Subcutaneous xenografts of MC38 tumor cells were constructed in gene-deficient mice (knockout by CRISPR / Cas9 technology, obtained from Jackson Laboratory) and WT mice. The tumor size was measured every 2-3 days and the growth curve of tumor cells was plotted. Ch25h was further detected by LC-MS / MS. - / - The content of 25-HC in MC38 tumor tissues of WT and WT mice was detected by flow cytometry. - / - Phenotype of TAMs and CD4 + and CD8 + The proportion of T lymphocytes; In addition, Ch25h - / - CD3 in MC38 tumor tissues of WT and WT mice + The proportion of T lymphocytes was detected by flow cytometry. - / - CD4 + and CD8 + The proliferation of T lymphocytes was also detected by flow cytometry. - / - IFNg expression in MC38 tumor tissues of WT and WT mice + CD8 + T and TNFa + CD8 + Finally, flow cytometry was used to detect the proportion of Ch25h - / - CD45 in B16F0 tumor tissues of WT and mice + The ratio of immune cells and CD8 T lymphocytes and CD3 + The number of T lymphocytes.

[0257] The experimental results showed that: compared with WT mice, in Ch25h - / - gene-deficient mice, the tumor growth rate of MC38 was slower ( Figure 6 A), less 25-HC accumulated in the tumor tissue ( Figure 6 B), and the proportion of CD206 + M2 macrophages decreased ( Figure 6 C left), on the contrary, the proportion of iNOS + M1 macrophages increased ( Figure 6 C right).

[0258] In addition, the proportions of CD4 + , CD8 + and CD3 + T lymphocytes were more, and their proliferation ability was stronger ( Figure 6 D, E and F), and the proportions of IFNg + CD8 + T and TNFa + CD8 + T lymphocytes increased ( Figure 6 G).

[0259] Similarly, compared with WT mice, in Ch25h - / - gene-deficient mice, the proportions of CD45 + immune cells and CD8 + T lymphocytes in the B16F10 tumor tissue, as well as the number of CD3 + T lymphocytes per gram of tumor tissue, all increased ( Figure 6 H).

[0260] Example 9, Downregulation of CH25H Gene Enhances the Antitumor Effect of Immune Checkpoint Antibody anti-PD1

[0261] To verify the antitumor effect of the combination of CH25H gene deletion and the immune checkpoint inhibitor anti-PD1, subcutaneous transplanted tumors of MC38 and B16F10 tumor cells were established on Ch25h - / - and WT mice. When the tumor volume reached 80 - 100 mm 3 , the anti-PD1 antibody was intraperitoneally injected every two days (200 μg / time), and the growth curves of the tumor cells were measured and plotted.

[0262] The experimental results showed that: compared with WT mice, Ch25h - / -In gene - deficient mice, the growth rate of MC38 and B16F10 tumor cells slows down, and the addition of anti - PD1 antibody significantly reduces the tumor volume; the down - regulation of CH25H gene and the addition of anti - PD1 antibody achieve a synergistic effect( Figure 7 A - B).

[0263] Example 10. CD8 + T cells with Ch25h knockout have stronger anti - tumor activity

[0264] To detect the direct regulatory effect of Ch25h on the process of CD8 + T cells clearing tumors, WT and Ch25h - / - CD8 + T cells from donor mice (CD45.1 background) were purified and activated by anti - CD3 / CD28 for 2 days, and then transferred into recipient mice with tumors of wild - type background CD45.1 via the tail vein to observe their ability to control tumor growth.

[0265] The experimental results showed that CD8 + T cells lacking Ch25h had a better inhibitory effect on the late - stage growth of tumors( Figure 8 A). By analyzing the proportion of tumor - infiltrating lymphocytes, compared with WT cells, CD8 - / - T cells lacking Ch25h had a higher proportion in both peripheral blood and tumor tissues( + B), and expressed higher levels of effector molecules IFNγ and TNFα( Figure 8 C). Figure 8 C).

[0266] From the above experimental results, it can be seen that the deletion of gene Ch25h and its metabolite 25 - HC can, on the one hand, effectively reduce the immunosuppressive function of TAM and M2 - type macrophages and promote more immune cells to infiltrate into tumor tissues; on the other hand, it can enhance the effector function of CD8 + T cells and inhibit their exhaustion, ultimately restricting tumor occurrence and development, and enhancing the anti - tumor effect of immune checkpoint inhibitor anti - PD1.

[0267] Example 11. Drug screening

[0268] Cells: M2 - type macrophages.

[0269] Test group: Cultivate the M2 - type macrophages and administer candidate substances;

[0270] Control group: Cultivate the M2 - type macrophages without administering candidate substances.

[0271] Detect the expression or activity of CH25H in the test group and the control group respectively, analyze the amount of 25-HC produced by it, and make a comparison. If the expression or activity of CH25H in the test group is statistically lower (such as 30% or lower) than that in the control group, and the amount of 25-HC produced is significantly reduced, it indicates that the candidate substance is a substance that reduces the immunosuppressive function of tumor-associated macrophages and is applicable to tumor immunotherapy (inhibiting tumors).

[0272] Furthermore, it also includes observing the activation of AMPKa or Arg1 (or the AMPKa-STAT6-ARG1 pathway in which it participates). If the candidate substance inhibits CH25H, reduces the accumulation of 25-HC, and reduces the activation effect on the AMPKa-STAT6-ARG1 signaling pathway, it indicates that the candidate substance is a substance that reduces the immunosuppressive function of tumor-associated macrophages and can be used as a tumor immunotherapy drug.

[0273] The above-described embodiments merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the present invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims. At the same time, all the documents mentioned in the present invention are cited as references in this application, just as if each document is cited separately as a reference.

Claims

1. Use of a downregulator of CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing the same in the preparation of a tumor immunotherapy drug.

2. The use according to claim 1, characterized in that, The tumor immunotherapy includes: (1) Reducing the immunosuppressive function of tumor-associated macrophages; preferably, the downregulator inhibits CH25H, reduces the accumulation of 25-HC, and reduces the activation effect on the AMPKa-STAT6-ARG1 signaling pathway, thereby reducing the immunosuppressive function of tumor-associated macrophages; or (2) Increase the level of effector molecule expression in CD8 + T cells; preferably, the downregulator inhibits CH25H, reduces the accumulation of 25-HC, thereby increasing the level of effector molecule expression in CD8 + T cells; preferably, the effector molecule includes TNFα or IFNγ; or (3) Enhance effector CD8 + T cell ratio and reduce the ratio of terminally exhausted CD8 + T cells; preferably, the downregulator inhibits CH25H and reduces the accumulation of 25-HC, thereby enhancing the effector CD8 + T cell ratio and reducing the ratio of terminally exhausted CD8 + T cells; or (4) Increasing the amount of infiltrating immune cells in tumor tissues; or (5) Enhancing the anti-tumor effect of the immune checkpoint antibody anti-PD1; or (6)Enhance the anti-tumor activity of CD8 + T cells.

3. The use according to claim 1, characterized in that, The downregulator includes those selected from: downregulators of CH25H, downregulators of the interaction between 25-HC and AMPKa; Preferably, the downregulator includes: reagents for silencing, knocking down or knocking out the CH25H gene, reagents for inhibiting the protein activity of CH25H; more preferably, it includes: interfering molecules specifically interfering with the expression of the CH25H gene, CRISPR gene editing reagents, homologous recombination reagents or site-directed mutagenesis reagents targeting the CH25H gene, and these reagents perform loss-of-function mutations on CH25H.

4. The use according to claim 1, characterized in that, The downregulator is an interfering reagent for silencing the CH25H gene; preferably, the interfering reagent is siRNA or shRNA; more preferably, the siRNA is the siRNA formed by the sequences shown in SEQ ID NO:2 and SEQ ID NO:3; more preferably, the shRNA is the shRNA formed by the sequences shown in SEQ ID NO:4 and SEQ ID NO:

5.

5. The use according to claim 1, characterized in that, The CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing the same is the CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 in tumor-associated macrophages or M2 macrophages.

6. Use of a downregulator and an immune checkpoint inhibitor in the preparation of a medicament or kit for inhibiting tumors, wherein the downregulator is CH25H or a downregulator of the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing the same; preferably, the immune checkpoint inhibitor includes: Anti-PD1 antibody, anti-PD-L1 antibody, anti-CTLA4 antibody, anti-TIGIT antibody.

7. The use according to any one of claims 1 to 6, characterized in that, The tumors include: colon cancer, melanoma, lymphoma, lung cancer, liver cancer, pancreatic cancer.

8. Use of CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing the same for screening tumor immunotherapy drugs; preferably, the CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway is the CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 in tumor-associated macrophages or M2 macrophages.

9. A method for screening tumor immunotherapy drugs, including: (1) Contacting a candidate substance with a system containing the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway; (2) Screen out substances that downregulate the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway, and the substances are tumor immunotherapy drugs; Among them, the downregulation includes: downregulating CH25H, thereby reducing the accumulation of 25-HC, reducing the activation effect on the AMPKa-STAT6-ARG1 signaling pathway, and reducing the immunosuppressive function of tumor-associated macrophages.

10. The method according to claim 9, characterized in that, Step (1) includes: adding a candidate substance to a system containing the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway; Step (2) includes: detecting the expression of CH25H, the accumulation of 25-HC, and the activation of AMPKa by 25-HC in the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway, and comparing with a control group, where the control group is a system containing the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway without adding the candidate substance; if the candidate substance downregulates CH25H, reduces the accumulation of 25-HC, and reduces the activation effect on the AMPKa-STAT6-ARG1 signaling pathway, then the candidate substance is a tumor immunotherapy drug.

11. The method according to claim 9, characterized in that, The method further includes: (a) Analyzing the effect of the candidate substance on the immune function of tumor-associated macrophages. If the candidate substance inhibits CH25H, reduces the accumulation of 25-HC, and reduces the activation effect on the AMPKa-STAT6-ARG1 signaling pathway, thereby reducing the immunosuppression of tumor-associated macrophages and enhancing the immune function of tumor-associated macrophages, then it is a tumor immunotherapy drug; or (b) Analyze the effect of the candidate substance on the level of effector molecule expression of CD8 + T cells. If the candidate substance inhibits CH25H, reduces the accumulation of 25-HC, and thus increases the level of effector molecule expression of CD8 + T cells, then it is a tumor immunotherapy drug; preferably, the effector molecule includes TNFα or IFNγ; or (c) Analyze the effect of the candidate substance on effector CD8 + T and terminally exhausted CD8 + T cells. If the candidate substance inhibits CH25H, reduces the accumulation of 25-HC, thereby increasing the proportion of effector CD8 + T and decreasing the proportion of terminally exhausted CD8 + T cells, then it is a tumor immunotherapy drug; or (d) Analyzing the effect of the candidate substance on the amount of infiltrating immune cells in tumor tissues. If the candidate substance increases the amount of infiltrating immune cells in tumor tissues, then it is a tumor immunotherapy drug; or (e) Analyze the effect of the candidate substance on the anti-tumor activity of CD8 + T cells. If the candidate substance enhances the anti-tumor activity of CD8 + T cells, then it is a tumor immunotherapy drug.

12. Use of CH25H or the CH25H(-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing the same in tumor-associated macrophages or M2 macrophages in the preparation of a diagnostic reagent for diagnosing or prognosticating tumors; preferably, the diagnosis or prognosis includes: Based on the expression or activity of CH25H or the CH25H (-25-HC)-AMPKa-STAT6-ARG1 signaling pathway containing it in tumor-associated macrophages or M2 macrophages, judge the occurrence or progression of the tumor, or judge whether it is suitable for a treatment plan using a "downregulator of the CH25H or CH25H-(25-HC)AMPKa-STAT6-ARG1 signaling pathway" for treatment; if the CH25H protein is highly expressed, then this treatment plan is applicable.

Images