ERK signal channel inhibitor, breast cancer medicine, method and application

By knocking down the CKAP4 protein with lentiviral vector or double-stranded RNA, the ERK signaling pathway was inhibited, and the problems of breast cancer cell proliferation and invasion were solved, and effective control and apoptosis of breast cancer cells were achieved.

CN120242075APending Publication Date: 2025-07-04FIRST AFFILIATED HOSPITAL OF KUNMING MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510420297.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

Abnormal activation of the ERK signaling pathway plays an important role in the occurrence, development and metastasis of breast cancer. The prior art is difficult to effectively inhibit this pathway, leading to the proliferation, migration and invasion of breast cancer cells.

Method used

Lentiviral vectors carrying gRNAs that guide the targeting cleavage of Cas9 to CKAP4 and Cas9-encoding sequences or double-stranded RNAs interfering with CKAP4 are used to further inhibit the ERK signaling pathway by knocking down the expression of CKAP4 protein, including double-stranded RNAs that interfere with KRAS to further inhibit the ERK signaling pathway.

Benefits of technology

Effectively inhibit the proliferation, migration and invasion of breast cancer cells, promote cell apoptosis, and block cells in the G1 phase, showing the prospect of application as a breast cancer drug.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120242075A_ABST
    Figure CN120242075A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of ERK signal pathways, in particular to an ERK signal pathway inhibitor, a breast cancer drug, a method and application. The ERK signal channel inhibitor provided by the embodiment of the invention not only can knock down CKAP4 protein expression, but also can knock down various protein expressions in an ERK signal channel, so that the ERK signal channel is inhibited. By inhibiting the ERK signal pathway, the inhibitors can inhibit proliferation, migration and invasion, can block breast cancer cells in the G1 phase and promote apoptosis of the breast cancer cells, and have application prospects as breast cancer drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the technical field of ERK signaling pathway, and specifically relates to ERK signaling pathway inhibitors, breast cancer drugs, methods and applications. Background Art

[0002] The ERK signaling pathway, namely the extracellular signal-regulated kinase signaling pathway, is one of the important signal transduction pathways in cells and plays a key role in various physiological processes such as cell growth, differentiation, proliferation, apoptosis, and cell migration. The ERK signaling pathway mainly consists of RAS protein, RAF protein, MEK protein and ERK protein.

[0003] Among them, the RAS protein is a small G protein with GTPase activity. In the inactive state, it binds to GDP. When the cell is stimulated by external signals, the RAS protein binds to the guanine nucleotide exchange factor (GEF), and the exchange of GDP for GTP occurs and it is activated. The activated RAS-GTP can bind to and activate downstream proteins. The RAS protein is a protein family encoded by the RAS gene family, and this family includes genes such as KRAS, NRAS and HRAS. The KRAS protein is a member of the RAS protein family and is encoded by the KRAS gene. The KRAS protein is a key protein in the ERK signaling pathway, and its main function is to transmit extracellular signals into the cell, thereby regulating processes such as cell growth, proliferation and differentiation. When the cell receives signals such as growth factors, the KRAS protein will bind to GTP and be activated, and then initiate downstream signal transduction.

[0004] The RAF protein belongs to the serine / threonine protein kinase family and is a direct downstream target of RAS. The RAF protein contains multiple domains, among which the N-terminal contains a regulatory domain and the C-terminal contains a kinase domain. The activated RAS protein can recruit the RAF protein to the cell membrane and activate it. The MEK protein, namely mitogen-activated protein kinase kinase, is a dual-specificity kinase that can phosphorylate and activate the ERK protein. The MEK protein has two key phosphorylation sites, and its activation requires both of these sites to be phosphorylated simultaneously. The ERK protein is a serine / threonine protein kinase and usually exists in an inactive form in the cytoplasm. The ERK protein has multiple subtypes, such as ERK1 and ERK2, etc., which have similar structures and functions and contain functional domains such as kinase domains and nuclear localization signals. When specific threonine and tyrosine residues of the ERK protein are phosphorylated by MEK, the ERK is activated and can translocate into the nucleus to regulate the expression of downstream genes.

[0005] When various extracellular signals, such as growth factors, cytokines, hormones, neurotransmitters, etc., bind to corresponding receptors on the cell surface, these receptors mainly include receptor tyrosine kinases (RTKs), G protein-coupled receptors (GPCRs), etc. After the receptors are activated, through a series of signal transduction events, they recruit and activate guanine nucleotide exchange factors (GEFs). GEFs promote the exchange of GDP bound to RAS protein with GTP in the cell, thus making the RAS protein in an activated state (RAS-GTP). The activated RAS-GTP binds to the N-terminal regulatory domain of RAF protein, resulting in conformational changes and activation of RAF protein. The activated RAF protein can phosphorylate and activate MEK protein, and MEK protein further phosphorylates the threonine and tyrosine residues of ERK protein, making ERK protein fully activated. The activated ERK protein can transmit signals by phosphorylating various downstream substrates, including transcription factors, cytoskeletal proteins, other protein kinases, etc., thereby regulating various biological functions of cells. Moreover, during this cascade reaction process, the signal is amplified step by step, and a small amount of extracellular signal can trigger a strong biological effect inside the cell.

[0006] The abnormal activation of the ERK signaling pathway plays an important role in the occurrence, development, and metastasis of tumors. Mutations or overexpressions of proteins such as RAS, RAF, MEK, or ERK exist in many tumor cells, leading to the continuous activation of the ERK signaling pathway and promoting the proliferation, survival, and invasion of tumor cells. Summary of the Invention

[0007] Therefore, this application discovers that CKAP4 in breast cancer cells is closely related to its proliferation, migration, invasion, and cell cycle, and also discovers that CKAP4 and the ERK signaling pathway jointly regulate the proliferation, migration, invasion, and cell cycle of breast cancer cells. For this reason, the embodiments provide inhibitors of the ERK signaling pathway, which can not only knockdown the expression of CKAP4 protein, but also knockdown the expression of multiple proteins in the ERK signaling pathway, thereby inhibiting the ERK signaling pathway. By inhibiting the ERK signaling pathway, these inhibitors can inhibit proliferation, migration, and invasion, and can arrest breast cancer cells in the G1 phase, promoting apoptosis of breast cancer cells, and have the application prospect as breast cancer drugs.

[0008] In a first aspect, an embodiment discloses an ERK signaling pathway inhibitor, including a lentiviral vector carrying a gRNA that guides Cas9 to target and cleave CKAP4 and a Cas9 coding sequence; a recombinant lentivirus carrying a gRNA that guides Cas9 to target and cleave CKAP4 and a Cas9 coding sequence; double-stranded RNA interfering with CKAP4; a lentiviral vector carrying a cloned nucleotide sequence of the double-stranded RNA interfering with CKAP4; a lentivirus carrying a cloned nucleotide sequence of the double-stranded RNA interfering with CKAP4; double-stranded RNA interfering with KRAS; a lentiviral vector carrying a cloned nucleotide sequence of the double-stranded RNA interfering with KRAS; and at least one of a lentivirus carrying a cloned nucleotide sequence of the double-stranded RNA interfering with KRAS.

[0009] In the embodiment of the first aspect, the gRNA that guides Cas9 to target and cleave CKAP4 is as shown in any one of SEQ ID NO: 1 to 4.

[0010] In the embodiment of the first aspect, the lentiviral vector is the lenti-CRISPRv2 plasmid carrying a nucleotide sequence as shown in any one of SEQ ID NO: 1 to 4 and a Cas9 coding sequence.

[0011] In the embodiment of the first aspect, the double-stranded RNA interfering with CKAP4 is as shown in SEQ ID NO: 13 and SEQ ID NO: 14.

[0012] In the embodiment of the first aspect, the lentiviral vector is the GV493 plasmid carrying a DNA nucleotide sequence as shown in SEQ ID NO: 13 or SEQ ID NO: 14.

[0013] In the embodiment of the first aspect, the double-stranded RNA interfering with CKAP4 is as shown in SEQ ID NO: 15 and SEQ ID NO: 16.

[0014] In the embodiment of the first aspect, the lentiviral vector is the GV493 plasmid carrying a nucleotide sequence as shown in SEQ ID NO: 15 or SEQ ID NO: 16.

[0015] In the embodiment of the first aspect, the double-stranded RNA interfering with KRAS is as shown in SEQ ID NO: 17 and SEQ ID NO: 18.

[0016] In the embodiment of the first aspect, the lentiviral vector is the GV493 plasmid carrying a nucleotide sequence as shown in SEQ ID NO: 17 or SEQ ID NO: 18.

[0017] In the embodiment of the first aspect, the double-stranded RNA interfering with KRAS is as shown in SEQ ID NO: 19 and SEQ ID NO: 20.

[0018] In an embodiment of the first aspect, the lentiviral vector is the GV493 plasmid carrying the nucleotide sequence shown in SEQ ID NO: 19 or SEQ ID NO: 20.

[0019] In a second aspect, an embodiment discloses a breast cancer drug using the ERK signaling pathway inhibitor described in the first aspect as an active ingredient.

[0020] In a third aspect, an embodiment discloses a method for inhibiting the ERK signaling pathway in breast cancer cells or tissues. The method includes: obtaining the ERK signaling pathway inhibitor described in the first aspect; mixing and transfecting a solution containing the ERK signaling pathway inhibitor with the culture medium of breast cancer cells, culturing the transfected solution, and screening to obtain breast cancer cells with inhibited ERK signaling pathway.

[0021] In a fourth aspect, an embodiment discloses a reagent for detecting the expression level of CKAP4 protein, including an ERK antibody.

[0022] In a fifth aspect, an embodiment discloses a WB kit for detecting the expression of CKAP4 protein, including an ERK antibody.

[0023] In a sixth aspect, an embodiment discloses a method for in vitro detecting the content of CKAP4 protein in breast cancer cells or tissues. The method includes: extracting a total protein sample from the breast cancer cells or tissues to be tested; performing SDS-PAGE electrophoresis on the total protein sample, transferring the obtained gel to a PVDF membrane, and after blocking; adding a primary antibody solution containing an ERK antibody; after incubation, adding a secondary antibody solution containing horseradish peroxidase-labeled goat anti-rabbit IgG; after incubation, developing color, and determining the protein content according to the developed color map.

[0024] In a seventh aspect, an embodiment discloses a reagent for detecting the expression level of ERK protein, including a CKAP4 antibody.

[0025] In an eighth aspect, an embodiment discloses a WB kit for detecting the expression level of ERK protein, including a CKAP4 antibody.

[0026] In a ninth aspect, an embodiment discloses a method for in vitro detecting the content of ERK protein in breast cancer cells or tissues. The method includes: extracting a total protein sample from the breast cancer cells or tissues to be tested; performing SDS-PAGE electrophoresis on the total protein sample, transferring the obtained gel to a PVDF membrane, and after blocking; adding a primary antibody solution containing a CKAP4 antibody; after incubation, adding a secondary antibody solution containing horseradish peroxidase-labeled goat anti-rabbit IgG; after incubation, developing color, and determining the protein content according to the developed color map.

[0027] In a tenth aspect, the embodiments disclose the use of the ERK signaling pathway inhibitor of the first aspect in the preparation of drugs for treating breast cancer. Description of the Drawings

[0028] Figure 1 Expression results in breast cancer tissues and adjacent tissues provided in the embodiments. Figure 1 A is an immunohistochemical staining map of CKAP4 protein. Figure 1 B is a statistical chart of CKAP4 protein expression levels. Figure 1 C is the CKAP4 protein expression score.

[0029] Figure 2 Expression results in breast cancer (T) and adjacent tissues (N) provided in the embodiments. Figure 2 A is a statistical chart of the relative expression levels of CKAP4 mRNA (n = 12). Figure 2 B is a WB detection map (n = 12). ***P < 0.001.

[0030] Figure 3 WB detection maps of CKAP4 protein expression in various breast cancer cells provided in the test examples.

[0031] Figure 4 Results of knocking down CKAP4 in breast cancer cells based on Cas9 ribozyme provided for the RT-PCR test example (A) and the WB test example (B) respectively.

[0032] Figure 5 Relative expression levels of CKAP4 mRNA provided for the RT-PCR test example (A) and CKAP4 protein expression maps provided for the WB test example (B). Among them, HCC1806 cells (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells (shCKAP4-1 / shCKAP4-2) with CKAP4 expression knocked down by double-stranded RNA were used, and "shNC" is the cell group not treated with double-stranded RNA.

[0033] Figure 6 Expression maps of CKAP4 protein, ERK protein, and p-ERK protein in HCC1806 cells (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells (shCKAP4-1 / shCKAP4-2) with CKAP4 expression knocked down by double-stranded RNA provided for the WB test example. Among them, "shNC" is the cell group not treated with double-stranded RNA.

[0034] Figure 7Relative expression levels of CKAP4 mRNA provided for RT-PCR test cases (A) and expression diagrams of CKAP4 protein, MEK protein, ERK protein, p-ERK protein, and KRAS protein provided for WB test cases (B). Among them, HCC1806 cells with knocked-down KRAS protein expression by double-stranded RNA (shKRAS) and MDA-MB-231 cells with knocked-down KRAS protein (shKRAS) were used, and "shNC" was the cell group not treated with double-stranded RNA.

[0035] Figure 8 Expression diagrams of CKAP4 protein, ERK protein, and p-ERK protein provided for WB test cases. Figure 8 A shows the results of HCC1806 cells (shCKAP4) and MDA-MB-231 cells (shCKAP4) with knocked-down CKAP4 protein by double-stranded RNA, and "shNC" is the cell group not treated with double-stranded RNA. Figure 8 B shows the results of HCC1806 cells (ERKi) and MDA-MB-231 cells (ERKi) with knocked-down ERK protein by ERK inhibitor, and "shNC" is the cell group not treated with ERK inhibitor.

[0036] Figure 9 Results of HCC1806 cells and MDA-MB-231 cells provided for immunoprecipitation test cases.

[0037] Figure 10 In vitro proliferation detection results (A) of HCC1806 cells (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells (shCKAP4-1 / shCKAP4-2) with knocked-down CKAP4 by double-stranded RNA provided for SRB test cases and in vitro proliferation detection results (B) of HCC1806 cells (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells (shCKAP4-1 / shCKAP4-2) with knocked-down CKAP4 by double-stranded RNA provided for EdU test cases. "shNC" is the cell group not treated with double-stranded RNA, **P < 0.01, ***P < 0.001.

[0038] Figure 11 Cell cycle detection results of HCC1806 cells (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells (shCKAP4-1 / shCKAP4-2) with knocked-down CKAP4 by double-stranded RNA provided for flow cytometry test cases. "shNC" is the cell group not treated with double-stranded RNA, **P < 0.01, ***P < 0.001.

[0039] Figure 12 Apoptosis results of HCC1806 cells (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells (shCKAP4-1 / shCKAP4-2) with CKAP4 knocked down by double-stranded RNA for flow cytometry test cases. "shNC" is the cell group not treated with double-stranded RNA, **P < 0.01, ***P < 0.001.

[0040] Figure 13 Cell migration results of HCC1806 cells (shCKAP4) and MDA-MB-231 cells (shCKAP4) with CKAP4 knocked down by double-stranded RNA for cell scratch test cases. "shNC" is the cell group not treated with double-stranded RNA, *P < 0.05, **P < 0.01, ***P < 0.001.

[0041] Figure 14 Cell invasion results of HCC1806 cells (shCKAP4) and MDA-MB-231 cells (shCKAP4-1) with CKAP4 knocked down by double-stranded RNA for Transwell test cases. **P < 0.01, ***P < 0.001.. *P < 0.05, **P < 0.01, ***P < 0.001.

[0042] Figure 15 Results of inhibiting the in vivo growth of breast cancer tissues by knocking down CKAP4 for in vivo transplantation test cases. Figure 15 Schematic diagram of establishing a xenograft tumor model in nude mice with A cells. Figure 15 B is the curve of the change in xenograft tumor volume. Figure 15 C is the entity diagram of the xenograft tumor. Figure 15 D is the statistical chart of the weight of the xenograft tumor. Figure 15 E is the result of immunohistochemical detection of the expression of the proliferation protein ki-67. "shNC" is the cell group not treated with double-stranded RNA, **P < 0.01, ***P < 0.001. Detailed implementation manners

[0043] In order to make the objectives, technical solutions and advantages of this application clearer, the following further elaborates on this application in combination with embodiments. It should be understood that the specific embodiments described herein are only used to explain this application and are not used to limit this application. The reagents not described in detail and separately in this application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail and specifically are all conventional experimental methods and can be learned from the prior art.

[0044] The expression of CKAP4 mRNA and protein in human breast cancer tissues is higher than that in adjacent tissues

[0045] 1. Clinical samples

[0046] A total of 101 postoperative specimens of breast cancer patients who underwent surgical treatment in the hospital from January 2015 to January 2017 were collected. The tissues were routinely fixed with 4% neutral formalin, and tissue sections were prepared for hematoxylin-eosin staining. The pathological results were confirmed by two experienced pathologists above the attending physician level. Histopathological typing of the tissues was performed according to the WHO Breast Tumor Pathology Diagnosis (2019 Edition), and the pathological diagnosis was non-special type invasive breast cancer. Histological grading was performed according to the Nottingham grading system score. Patient follow-up data were collected by telephone. This study was approved by the Ethics Committee.

[0047] 2. Methods

[0048] (1) Hematoxylin-eosin (HE) staining

[0049] The paraffin blocks of breast cancer tissues or tissue microarray paraffin blocks were sectioned, fixed on glass slides, stained, and sealed.

[0050] (2) Immunohistochemical staining (IHC)

[0051] The paraffin blocks of breast cancer tissues or tissue microarray paraffin blocks were sectioned, dewaxed, hydrated, antigen repaired, endogenous peroxidase blocked, and primary antibody (CKAP4 antibody, Enzo Life Science) was added and incubated at 37°C for 1 hour. After washing, secondary antibody (enzymatic labeled goat anti-mouse / rabbit IgG polymer) was added and incubated at 37°C for 20 min. After washing, color development, counterstaining, dehydration, clearing, and sealing were performed. The total score was calculated by multiplying the proportion of positive tumor cells by the staining intensity score. The proportions of positive tumor cells were 0 (5%), 1 (6 - 25%), 2 (26 - 50%), 3 (51% - 75%), 4 (76 - 100%) respectively. The staining intensity score was 0 (none), 1 (weak), 2 (medium), 3 (strong) points. According to the final score, <5% of the cells were stained, regardless of the staining intensity, it was determined to be negative (-); 1 - 4 points were recorded as weak (+); 5 - 8 points were moderate (++); 9 - 12 points were strong (+++). In the following statistical analysis, negative and weak expression were determined as the low expression group, and medium and strong expression were determined as the high expression group.

[0052] (3) RT-PCR

[0053] Total RNA was extracted from fresh breast cancer tissues and adjacent breast tissues using Trizol reagent. The concentration of total RNA was measured using NANODROP2000, and the quality of RNA was analyzed by agarose gel electrophoresis. The total RNA with determined concentration and quality was reverse transcribed into cDNA. The reverse transcription system, calculated as 10 μL, included 2 μL RT Master Mix (5×), 100 ng - 1 μg total RNA, and the remaining volume of Nuclease-free water.

[0054] The cDNA samples obtained by reverse transcription were subjected to qPCR. The qPCR reaction system, calculated as 20 μL, included 1 μL cDNA, 0.8 μL 10 μM upstream primer, 0.8 μL 10 μM downstream primer, 10 μL 1×TSING Master SYBR Green I qPCR Mix - UDG (Without ROX), and the remaining volume of double-distilled water. The qPCR reaction steps included: 50 °C for 2 min; 95 °C for 2 min; 95 °C for 15 s; 40 cycles; 60 °C for 1 min. The expression of RNA was normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Data analysis was performed using Bio-Rad CFX96 Manager software.

[0055] Among them, the upstream primer for detecting CKAP4 mRNA was: F5: shown as SEQ ID NO:21, AAGCTGTGAAGCAAGGGGAG. R5: shown as SEQ ID NO:22, GGATTTGGTGAGCTCCGTCA.

[0056] The upstream primer for detecting GAPDH mRNA was: F6: shown as SEQ ID NO:23, GAAAGCCTGCCGGTGACTAA. R6: shown as SEQ ID NO:24, GCCCAATACGACCAAATCAGAGA.

[0057] (4) Protein immunoblotting (western blotting, WB)

[0058] Fresh breast cancer tissues and adjacent breast tissues were lysed with RIPA buffer to extract total proteins, and the protein concentration was detected by the BCA method. SDS-PAGE electrophoresis was performed, and then the gel was transferred to a PVDF membrane using a membrane transfer instrument and blocked at room temperature for 1 - 2 h. The primary antibody (CKAP4 antibody, Enzo Life Science) was added and incubated at 4 °C for 12 hours. After washing, the secondary antibody (horseradish peroxidase-labeled goat anti-rabbit IgG) was added and incubated at room temperature for 2 h, and then developed. The protein expression level was analyzed using ImageJ software.

[0059] 3. Results

[0060] As shown in Table 1 and Figure 1 as follows, 101 clinical samples of breast cancer were collected, and immunohistochemical staining was performed on breast cancer tissues and adjacent breast tissues to detect the expression level of CKAP4 protein, and semi-quantitative analysis was carried out. According to the scoring principle, the CKAP4 expression level was divided into a low-expression group and a high-expression group. The results showed that among 101 breast cancer tissues, 32 cases had low expression (accounting for 68.3%), and 69 cases had high expression (accounting for 31.7%); among the paired adjacent breast tissues of the same patient, 81 cases had low expression (accounting for 80.2%), and 20 cases had high expression (accounting for 19.8%). The expression of CKAP4 in breast cancer tissues was significantly higher than that in adjacent breast tissues.

[0061] Twelve pairs of breast cancer tissues and corresponding breast tissues were randomly selected from the above samples, and the mRNA and protein expression levels of CKAP4 were detected by qPCR and WB. As Figure 2 shown, the mRNA and protein expression levels of CKAP4 in breast cancer tissues were both higher than those in adjacent tissues.

[0062] As Figure 3 shown in the WB analysis of the CKAP4 protein expression in breast cancer cell lines, compared with breast epithelial cell lines (MCF-10A, 184B5), HER-2 overexpressing breast cancer cell lines (SKBR-3), Luminal type breast cancer cell lines (T47D, MCF-7), the expression of CKAP4 was significantly up-regulated in TNBC cell lines (MDA-MB-231, HCC1806, HS578T, 149PT); among them, the expression of CKAP4 in MDA-MB-231 and HCC1806 cells was relatively high. These results suggest that the transcriptional and translational expression levels of CKAP4 are both increased in breast cancer, especially in TNBC (triple-negative breast cancer), and it may play a regulatory role in the occurrence and development of cancer.

[0063] Table 1 Statistical analysis of CKAP4 protein expression in breast cancer and adjacent tissues

[0064]

[0065] Knockdown of CKAP4 based on Cas9 ribozyme

[0066] In addition, high expression of CKAP4 is a poor prognostic factor for patients with pancreatic cancer and lung cancer, and it promotes the proliferation and migration of tumor cells. Therefore, the embodiments of the present application provide RNAs, vectors, viruses and methods for knocking down CKAP4.

[0067] The embodiment discloses an RNA, whose nucleotide sequence is shown in SEQ ID NO: 1-4. This RNA can guide the Cas9 ribozyme to cleave and remove the gene sequence of CKAP4, achieving knockdown of the CKAP4 gene in breast cancer cells in vitro and in vivo, and further interfering with or inhibiting the proliferation, migration, and invasion of breast cancer cells, thereby playing a role in preventing or treating breast cancer, and having the application prospect of developing into a drug for preventing or treating breast cancer.

[0068] The embodiment also discloses a primer set, whose nucleotide sequence is as shown in SEQ ID NO: 5 and 6, or as shown in SEQ ID NO: 7 and 8, or as shown in SEQ ID NO: 9 and 10, or as shown in SEQ ID NO: 11 and 12. Among them, the primer set of SEQ ID NO: 5 and 6 can obtain the RNA containing the sequence shown in SEQ ID NO: 1 after annealing treatment. The primer set of SEQ ID NO: 7 and 8 can obtain the RNA containing the sequence shown in SEQ ID NO: 2 after annealing treatment. The primer set of SEQ ID NO: 9 and 10 can obtain the RNA containing the sequence shown in SEQ ID NO: 3 after annealing treatment. The primer set of SEQ ID NO: 11 and 12 can obtain the RNA containing the sequence shown in SEQ ID NO: 4 after annealing treatment. Specifically, it is shown in Table 2 below.

[0069] In Table 2, the sequence "CACCG" is usually part of the precursor sequence of the guide RNA (gRNA) in the CRISPR-Cas9 system. In the lentiCRISPRv2 vector, the CACCG sequence is a specific sequence for cloning the gRNA. It is located in front of the gRNA sequence to help ensure the correct expression and function of the gRNA. The sequence "CAAA" is usually used to ensure the correct orientation of the cloned gRNA sequence in the vector. In the lentiCRISPRv2 vector, the CAAA sequence is usually located behind the gRNA sequence to help ensure the correct orientation of the cloned gRNA sequence in the vector. These sequences are very important in the design and synthesis of oligos because they ensure the correct cloning and expression of the gRNA, enabling the CRISPR-Cas9 system to effectively target and edit specific DNA sequences.

[0070] Table 2 gRNA and its primers

[0071]

[0072] The examples also disclose a method for synthesizing the above RNA. The method includes preparing an annealing reaction solution, treating the annealing reaction solution at 37 °C for 30 min, treating it at 95 °C for 5 min, and allowing it to cool naturally, thereby obtaining the RNAs shown in SEQ ID NO: 1-4 respectively. Among them, the annealing reaction solution, calculated as 20 μL, contains 2 μL of 10× annealing buffer (Invitrogen), 5 μL of any one of 100 μM F1-F4, 5 μL of any one of 100 μM R1-F4, and the balance of ddH2O.

[0073] To facilitate the introduction of the RNA and Cas9 ribozyme into breast cancer cells, the examples also provide a recombinant lentiviral vector. The recombinant lentiviral vector is the lenti-CRISPRv2 plasmid (Addgene, #52961) carrying any one of the nucleotide sequences shown in SEQ ID NO: 1-4.

[0074] The examples also disclose a method for preparing the recombinant lentiviral vector. The method includes: obtaining a linearized lenti-CRISPRv2 fragment; ligating the annealing product obtained by the above method with the linearized lenti-CRISPRv2 fragment to obtain a recombinant fragment; transferring the recombinant fragment into Escherichia coli; screening positive clones from the culture of the transformants; and extracting the recombinant lentiviral vector from the culture of the positive clones.

[0075] In some examples, the step of obtaining the linearized lenti-CRISPRv2 fragment includes: preparing a plasmid digestion reaction solution, digesting the plasmid digestion reaction solution at 37 °C for 30 min, and subjecting the digested solution to agarose gel recovery to obtain a target fragment of 12.8 kb. Among them, the plasmid digestion reaction solution, calculated as 60 μL, contains 5 μg of lenti-CRISPRv2, 3 μL of FastDigest BsmBI, 2 μL of 10× FastDigest Buffer, 0.6 μL of 100 mM TT (freshly prepared), and the balance of water.

[0076] In some examples, the step of ligating the annealing product obtained by the above method with the linearized lenti-CRISPRv2 fragment to obtain a recombinant fragment includes: preparing a ligation reaction solution, and reacting the ligation reaction solution at 16 °C for 1 h. Among them, the ligation reaction solution, calculated as 10 μL, contains 2 μL (100-200 ng) of the primer annealing product, 1 μL (50-100 ng) of the linearized lenti-CRISPRv2 fragment, 1 μL of 10× T4 DNA Ligation Buffer, 2 μL of T4 DNA ligase, and the balance of water.

[0077] The recombinant lentiviral vector obtained based on the above method is transfected into cells, and a recombinant lentivirus carrying a nucleotide sequence as shown in any one of SEQ ID NOs: 1 to 4 and a Cas9 coding sequence can be synthesized in vivo.

[0078] Based on this, the embodiment also discloses a method for preparing a recombinant lentivirus carrying a nucleotide sequence as shown in any one of SEQ ID NOs: 1 to 4 and a Cas9 coding sequence. The method comprises: co-transfecting HEK293T cells with a recombinant lentiviral vector, a PSPAX2 plasmid and a PMD2.G plasmid, and harvesting the recombinant lentivirus from the culture of the transformant.

[0079] In some embodiments, the method for preparing a recombinant lentivirus carrying a nucleotide sequence as shown in any one of SEQ ID NOs: 1 to 4 and a Cas9 coding sequence specifically comprises:

[0080] 1) Plant 4×10 in a 10 cm dish 6 HEK293T cells were grown to 70%-90% confluency;

[0081] 2) Mix 12 μg recombinant Lenti-CRISPR-V2, 8 μg PSPAX2 and 4 μg PMD2.G and add to 1.5 mL Opti-MEM to obtain a plasmid dilution solution;

[0082] 3) Add 60 μL of Lipo-2000 to 1.5 mL of Opti-MEM and incubate at room temperature for 5 min to obtain a Lipo-2000 dilution solution;

[0083] 4) Mix the plasmid dilution and Lipo-2000 dilution, and incubate at room temperature for 20 minutes to allow the plasmid and Lipo-2000 to fully bind to form a complex.

[0084] 5) Remove the culture medium in the 10 cm dish, add the plasmid-liposome complex dropwise into the dish, gently shake the dish to evenly distribute the complex on the cell surface, add an appropriate amount of complete culture medium to 10 mL, and return the dish to the incubator for continued culture.

[0085] 6) At 48 - 72 hours after transfection, collect the supernatant containing virus particles. Transfer the supernatant to a sterile centrifuge tube, centrifuge at 3000 rpm for 10 - 15 min to remove cell debris. If a higher titer of virus is needed, virus concentration can be carried out. Commonly used methods include ultracentrifugation, PEG precipitation method, etc. For example, when using the PEG 8000 precipitation method, add PEG 8000 with a final concentration of 8% - 10% and 0.5 M NaCl to the supernatant, incubate overnight at 4°C or for at least 2 - 4 h. Then centrifuge at 4000 rpm for 30 - 60 min, discard the supernatant, and resuspend the precipitate with an appropriate amount of PBS to obtain the concentrated virus solution.

[0086] 7) The collected virus solution needs to be assayed for its titer. Commonly used methods include fluorescence quantitative method (for lentiviruses with fluorescent labels), TCID 50 method, etc., to determine the infectivity of the virus and the amount of virus required for subsequent experiments.

[0087] Through the above - mentioned examples, recombinant lentiviruses carrying the nucleotide sequences shown in any one of SEQ ID NO:1 - 4 and the Cas9 coding sequence were obtained. Transferring the recombinant lentiviruses into breast cancer cells can obtain breast cancer cells with CKAP4 knockdown.

[0088] Therefore, the examples disclose a method for preparing breast cancer cells with CKAP4 knockdown. The method includes: obtaining breast cancer cells and recombinant lentiviruses carrying the nucleotide sequences shown in any one of SEQ ID NO:1 - 4 and the Cas9 coding sequence; mixing and transfecting the recombinant lentivirus solution with the culture medium of breast cancer cells, culturing the transfected solution, and screening breast cancer cells with CKAP4 knockdown.

[0089] In some examples, the method for preparing breast cancer cells with CKAP4 knockdown specifically includes:

[0090] 1) One day before transfection, digest breast cancer cells in the logarithmic growth phase with trypsin and inoculate them into a cell culture plate at an appropriate density. For example, for a 24 - well plate, inoculate about 2 - 5×10 4 cells per well, add an appropriate amount of complete medium to make the cells reach a confluence of 30% - 50% at the time of transfection, and then place the culture plate back into the incubator for continued culture.

[0091] 2) With an MOI of 10, and 5×10 4 cells per well, and a lentivirus titer of 1×10 8 TU / mL, then 5 μL of the lentivirus stock solution needs to be added to each well, and then dilute it to 200 μL with serum - free medium.

[0092] 3) Add 1 - 2 μL of 8 mg / mL polybrene solution to 200 μL of the viral diluent, gently mix well, and incubate at room temperature for 15 - 30 min to improve the infection efficiency of the lentivirus.

[0093] 4) Aspirate the original culture medium in the cell culture plate, gently wash the cells once with PBS, and then add the viral diluent containing polybrene to the cell culture wells. Gently shake the culture plate to evenly distribute the virus solution. Return the culture plate to the incubator for continued culture.

[0094] 5) After 12 - 24 hours of transfection, aspirate the culture medium containing the virus, add an appropriate amount of fresh complete culture medium, and continue to culture the cells to reduce the toxicity of the virus and polybrene to the cells.

[0095] 6) Add puromycin for screening 48 h after infection to kill the cells that have not been successfully infected. The successfully infected cells will survive, and puromycin needs to be added to the subsequent culture medium all the time.

[0096] 7) Verification of CKAP4 knockdown or knockout can be performed by WB or Real - time PCR 2 days after puromycin screening. Among them, the detection methods of WB or Real - time PCR are the same as those in the above - mentioned examples.

[0097] In some examples, the recombinant lentivirus containing the nucleotide sequence shown in any one of SEQ ID NO:1 - 4 and the Cas9 coding sequence was transfected into MDA - MB - 231 cells to obtain CKAP4 - knocked - down MDA - MB - 231 cells. RT - PCR and Western blot were used to detect the CKAP4 mRNA expression level and CKAP4 protein expression level in the CKAP4 - knocked - down MDA - MB - 231 cells. The detection steps were the same as those in the above - mentioned test examples. As Figure 4 shown, the recombinant lentivirus containing the nucleotide sequence shown in any one of SEQ ID NO:1 - 4 and the Cas9 coding sequence significantly reduced the CKAP4 mRNA expression level and CKAP4 protein expression level in MDA - MB - 231 cells compared with the control group.

[0098] Knockdown of CKAP4 and KRAS based on interfering RNA

[0099] In addition, the examples also provided a method based on interfering RNA to achieve knockdown of the ERK signaling pathway in breast cancer cells. For this purpose, the examples also provided an ERK signaling pathway inhibitor, and the inhibitor included at least one of double - stranded RNA interfering with CKAP4 and double - stranded RNA interfering with KRAS. In these examples, these double - stranded RNAs can be synthesized by chemical or biological methods.

[0100] Among them, the sense strand of double-stranded RNA1 interfering with CKAP4 is: 5’-CAGCUGAAGAGGAGUGUGGGUUCAAGAGA-3’, SEQ ID NO:13, and the antisense strand is: 5’-CCCACACUCUCCUUCAGCUG-3’, SEQ ID NO:14.

[0101] The sense strand of double-stranded RNA2 interfering with CKAP4 is: 5’-GCAUCGUCAAGAGGAGUACAUUUCAAGAGA-3’, SEQ ID NO:15, and the antisense strand is: 5’-AUGUACUCCUCUUGACGAUGC-3’, SEQ ID NO:16.

[0102] The sense strand of double-stranded RNA1 interfering with KRAS is: 5’-GCUGGAGCAGAUGACGCAGAUUCAAGAGA-3’, SEQID NO:17, and the antisense strand is: 5’-UCUGCGUCAUCUGCUCCAGC-3’, SEQ ID NO:18.

[0103] The sense strand of double-stranded RNA2 interfering with KRAS is: 5’-GCUGGUGCAGACGAAUAUCUUUCAAGAGA-3’, SEQID NO:19, and the antisense strand is: 5’-AGAUAUUCGUCUGCACCAGC-3’, SEQ ID NO:20.

[0104] Based on this, the embodiment also provides a method for inhibiting the ERK signaling pathway in breast cancer cells. The method includes: mixing at least one of the double-stranded RNA interfering with CKAP4 and the double-stranded RNA interfering with KRAS with a transfection reagent to form a complex of the double-stranded RNA and the transfection reagent; co-culturing the complex with breast cancer cells; harvesting and screening positive cells from the co-culture, and the positive cells are the breast cancer cells with the ERK signaling pathway inhibited.

[0105] In some embodiments, the method for inhibiting the ERK signaling pathway in breast cancer cells specifically includes:

[0106] 1) Chemically synthesize the above double-stranded RNA interfering with CKAP4 or double-stranded RNA interfering with KRAS, and dissolve it in RNase-free water to 20 μM.

[0107] 2) Seed HCC1806 cells or MDA-MB-231 cells in the logarithmic growth phase at an appropriate density (such as 2×10 5 cells / well) in a 6-well plate, add 2 ml of complete medium to each well, and culture in an incubator for 24 h to allow the cells to adhere and reach a confluence of 30% - 50%.

[0108] 3) Preparation of transfection complexes: Operate according to the instruction manual of Lipofectamine RNAiMAX transfection reagent. In a sterile centrifuge tube, dilute 50 pmol of double-stranded RNA and 5 μL of transfection reagent to 100 μL with Opti-MEM medium respectively, mix gently and incubate at room temperature for 5 min. Then mix the diluted double-stranded RNA and transfection reagent, mix gently and incubate at room temperature for 20 min to form a complex of double-stranded RNA and transfection reagent.

[0109] 4) Cell transfection: Aspirate the original medium in the 6-well plate and add 800 μL of Opti-MEM medium to each well. Then add the complex of double-stranded RNA and transfection reagent dropwise into the cell culture wells, gently shake the culture plate to make the complex evenly distributed. After continuing to culture in the incubator for 4 - 6 h, replace it with complete medium and continue to culture. Screen positive cells from the culture, and the positive cells are breast cancer cells with inhibited ERK signaling pathway.

[0110] The embodiment also provides a lentiviral vector carrying the above interfering RNA, and uses this vector to mediate the interference of CKAP4 and KRAS. Based on this, the embodiment also provides a recombinant lentiviral vector. This recombinant lentiviral vector is the GV493 plasmid (GeneChem) carrying the RNA shown in any one of SEQ ID NO:13 - 20.

[0111] The embodiment also discloses a method for preparing this recombinant lentiviral vector. The method includes: obtaining a linearized GV493 fragment; ligating a DNA molecule shown in any one of SEQ ID NO:13 - 20 with the linearized GV493 fragment to obtain a recombinant fragment; transferring the recombinant fragment into Escherichia coli; screening positive clones from the culture of the transformants; and extracting the recombinant lentiviral vector from the culture of the positive clones.

[0112] In some embodiments, the step of obtaining a linearized GV493 fragment includes: preparing a plasmid digestion reaction solution, digesting the plasmid digestion reaction solution at 37 °C for 3 h, and performing agarose gel recovery on the digested solution to obtain a target fragment of 10.9 kb. Among them, the plasmid digestion reaction solution contains 2 μg of lenti-CRISPRv2, 1 μL of 10 U / μL AgeI, 1 μL of 10 U / μL EcoRI, 5 μL of 10×CutSmart Buffer and the remaining amount of water in a volume of 50 μL.

[0113] In some embodiments, the step of ligating a DNA molecule such as any one of SEQ ID NO: 13 to 20 with a linearized GV493 fragment to obtain a recombinant fragment includes: preparing a ligation reaction solution and reacting the ligation reaction solution at 16 °C for 1 h. Among them, the ligation reaction solution, calculated as 20 μL, contains 100 ng of the linearized GV493 fragment, 100 ng of a DNA molecule such as any one of SEQ ID NO: 13 to 20, 2 μL of 10×T4 DNA Ligation Buffer, 1 μL of T4 DNA ligase, and the balance of water.

[0114] Based on the recombinant lentiviral vector obtained by the above method, when it is transfected into cells, it can synthesize recombinant lentivirus carrying any nucleotide sequence of SEQ ID NO: 13 to 20 in vivo.

[0115] In some embodiments, the method for preparing a recombinant lentivirus carrying any nucleotide sequence of SEQ ID NO: 13 to 20 specifically includes:

[0116] 1) Seed 4×10 6 HEK293T cells in a 10 cm dish until they reach 70%-90% confluence;

[0117] 2) Mix 20 μg of the recombinant lentiviral vector carrying any nucleotide sequence of SEQ ID NO: 13 to 20, 15 μg of pHelper1.0, and 10 μg of pHelper2.0 and add them to 1.5 mL of Opti-MEM to obtain a plasmid dilution;

[0118] 3) Add 60 μL of Lipo-2000 to 1.5 mL of Opti-MEM and incubate at room temperature for 5 min to obtain a Lipo-2000 dilution;

[0119] 4) Mix the plasmid dilution and the Lipo-2000 dilution and incubate at room temperature for 20 min to obtain a complex formed by sufficient binding of the plasmid and Lipo-2000.

[0120] 5) Remove the medium from the 10 cm dish, add the plasmid-liposome complex dropwise to the culture dish, gently shake the culture dish to evenly distribute the complex on the cell surface, add an appropriate amount of complete medium to 10 mL, and return it to the incubator for continued culture.

[0121] 6) At 48 - 72 hours after transfection, collect the supernatant containing virus particles. Transfer the supernatant to a sterile centrifuge tube and centrifuge at 3000 rpm for 10 - 15 min to remove cell debris. If a higher titer of virus is required, virus concentration can be performed. Commonly used methods include ultracentrifugation, PEG precipitation, etc. For example, when using the PEG 8000 precipitation method, add PEG 8000 with a final concentration of 8% - 10% and 0.5 M NaCl to the supernatant, and incubate overnight at 4°C or for at least 2 - 4 hours. Then centrifuge at 4000 rpm for 30 - 60 min, discard the supernatant, and resuspend the precipitate with an appropriate amount of PBS to obtain the concentrated virus solution.

[0122] 7) The collected virus solution needs to be assayed for its titer. Commonly used methods include fluorescence quantitative method (for lentiviruses with fluorescent labels), TCID 50 method, etc., to determine the infectivity of the virus and the amount of virus required for subsequent experiments.

[0123] Through the above examples, recombinant lentiviruses carrying any one of the nucleotide sequences of SEQ ID NO: 13 - 20 were obtained. Transferring the recombinant lentiviruses into breast cancer cells can obtain breast cancer cells with CKAP4 knockdown and breast cancer cells with KRAS knockdown.

[0124] Therefore, the examples disclose a method for preparing breast cancer cells with CKAP4 knockdown or breast cancer cells with KRAS knockdown. The method includes: obtaining breast cancer cells and recombinant lentiviruses carrying any one of the nucleotide sequences of SEQ ID NO: 13 - 20; mixing and transfecting the recombinant lentivirus solution with the culture medium of breast cancer cells, culturing the transfected solution, and screening breast cancer cells with CKAP4 knockdown or breast cancer cells with KRAS knockdown.

[0125] In some examples, the method for preparing breast cancer cells with CKAP4 knockdown or breast cancer cells with KRAS knockdown specifically includes:

[0126] 1) One day before transfection, digest breast cancer cells in the logarithmic growth phase with trypsin and inoculate them into a cell culture plate at an appropriate density. For example, for a 24 - well plate, inoculate about 2 - 5×10 4 cells per well, add an appropriate amount of complete medium to make the cells reach 30% - 50% confluence at the time of transfection, and then place the culture plate back into the incubator for continued culture.

[0127] 2) With an MOI of 10, and 5×10 4 cells per well, and a lentivirus titer of 1×10 8 TU / mL, then 5 μL of the lentivirus stock solution needs to be added to each well, and then dilute it to 200 μL with serum - free medium.

[0128] 3) Add 1 - 2 μL of 8 mg / mL polybrene solution to 200 μL of the virus dilution, gently mix well, and incubate at room temperature for 15 - 30 min to improve the infection efficiency of the lentivirus.

[0129] 4) Aspirate the original culture medium in the cell culture plate, gently wash the cells once with PBS, then add the virus dilution containing polybrene to the cell culture wells, and gently shake the culture plate to evenly distribute the virus solution. Return the culture plate to the incubator for continued culture.

[0130] 5) After 12 - 24 hours of transfection, aspirate the medium containing the virus, add an appropriate amount of fresh complete medium, and continue to culture the cells to reduce the toxicity of the virus and polybrene to the cells.

[0131] 6) After 48 hours of infection, add puromycin for screening to kill the cells that have not been successfully infected. The successfully infected cells will survive, and puromycin needs to be added to the medium continuously in the future.

[0132] 7) After 2 days of puromycin screening, WB or Real - time PCR can be used to verify the knockdown or reduction of CKAP4. Among them, the detection methods of WB or Real - time PCR are the same as those in the above - mentioned examples.

[0133] Interfering with CKAP4 inhibits the ERK signaling pathway

[0134] In some test examples, RT - PCR and Western blot were used to detect the expression levels of CKAP4 in breast cancer cells with CKAP4 knockdown or KRAS knockdown, and the expression levels of KRAS, ERK, and pERK in the ERK signaling pathway. The detection steps were the same as those in the above - mentioned examples.

[0135] Among them, the primers used in the detection of KRAS by RT - PCR were: KRAS - F: GAGTGCCTTGACGATACAG, SEQ ID NO:25. KRAS - R: GAGAATATCCAAGAGACAGGTT, SEQ ID NO:26.

[0136] Among them, the primary antibody of CKAP4 used in the Western blot detection was purchased from Life Science, with the catalog number ALX-804-604-C100 Enzo and the dilution ratio of 1:1000; the primary antibody of KRAS used in the Western blot detection was purchased from Cell Signaling Technology, with the catalog number 67648 and the dilution ratio of 1:1000; the primary antibody of ERK used in the Western blot detection was purchased from Cell Signaling Technology, with the catalog number 4695 and the dilution ratio of 1:1000; the primary antibody of pERK used in the Western blot detection was purchased from Cell Signaling Technology, with the catalog number 4370 and the dilution ratio of 1:1000. The primary antibody of β-actin protein used in the Western blot detection was purchased from Cell Signaling Technology, with the catalog number #4967.

[0137] As Figure 5 shown, the expression level of CKAP4 decreased in breast cancer cells with CKAP4 knockdown or KRAS knockdown.

[0138] As Figure 6 shown, the expression levels of KRAS, ERK, and pERK in the ERK signaling pathway of breast cancer cells with CKAP4 knockdown or KRAS knockdown also decreased significantly, indicating that the interfering RNA, recombinant lentiviral vector carrying the interfering RNA, and lentivirus carrying the interfering RNA provided in the examples can all inhibit the ERK signaling pathway of breast cancer cells and have the application potential as ERK signaling pathway inhibitors.

[0139] Interfering with KRAS inhibits the ERK signaling pathway

[0140] In some test examples, RT-PCR and Western blot were used to detect the expression level of CKAP4 and the expression levels of KRAS, ERK, and pERK in the ERK signaling pathway of breast cancer cells with KRAS expression interfered. The detection steps were the same as those in the above examples.

[0141] As Figure 7 shown in A, the expression of CKAP4 decreased in HCC1806 cells and MDA-MB-231 cells with KRAS expression interfered, indicating that interfering with KRAS expression can inhibit the expression of the CKAP4 gene.

[0142] As Figure 7 shown in B, the expression levels of KRAS, ERK, and pERK in the ERK signaling pathway of HCC1806 cells and MDA-MB-231 cells with KRAS expression interfered also decreased significantly, indicating that interfering with KRAS expression provided in the examples can inhibit the expression of pERK, and the interfering RNA of KRAS, recombinant lentiviral vector carrying the interfering RNA, and lentivirus carrying the interfering RNA all have the application potential as inhibitors of the ERK signaling pathway.

[0143] CKAP4 and ERK mutually regulate in breast cancer cells

[0144] In some test cases, Western blot (WB) was used to detect the expression levels of CKAP4, ERK, and pERK proteins in MDA-MB-231 cells with CKAP4 knockdown obtained using interfering RNA and in HCC1806 cells with CKAP4 knockdown obtained using interfering RNA. As Figure 8 shown in A, the expression of CKAP4 and pERK was synchronously downregulated in HCC1806 cells and MDA-MB-231 cells with CKAP4 expression interfered.

[0145] In some test cases, MDA-MB-231 cells and HCC1806 cells were treated with an ERK inhibitor (FR 180204, Beyotime, Shanghai), and WB was used to detect the expression of CKAP4, ERK, and pERK proteins in the resulting cells. As Figure 8 shown in B, the expression of CKAP4 and ERK was synchronously downregulated in the cells obtained after treating MDA-MB-231 cells and HCC1806 cells with the ERK inhibitor.

[0146] This indicates that in breast cancer cells MDA-MB-231 and HCC1806, CKAP4 regulates the expression of phosphorylated ERK, ERK regulates the expression of CKAP4, and CKAP4 and the ERK pathway mutually regulate each other's expression.

[0147] Reagents and methods for detecting CKAP4, and reagents and methods for detecting ERK

[0148] Test cases:

[0149] 1) Breast cancer cells MDA-MB-231 and HCC1806 in the logarithmic growth phase were taken. After trypsinizing the cells, the cell pellet was collected. Cell lysate containing a protease inhibitor was added and the cells were lysed on ice for 30 min. Centrifugation was performed for 10 min (4 °C, 10000 g), and the supernatant protein was collected for subsequent experiments or stored at -80 °C for preservation.

[0150] 2) The protein concentration was adjusted to 1 μg / μL using the BCA method and aliquoted into 1.5 mL centrifuge tubes (1.5 ml), 500 μl / tube.

[0151] 3) 1 μL of ERK antibody (05-157, Sigma-Aldrich, Anti-MAPK1 / ERK2 Antibody, Upstate, mouse monoclonal, 1B3B9) or 1 μL of CKAP4 antibody (Proteintech, catalog number #14475-1-AP, dilution factor 1:1000) was added and incubated overnight at 4 °C with rotation.

[0152] 4) Take Protein A / G beads, gently mix the beads, aspirate 30 μL into a 1.5 mL centrifuge tube, and wash the beads three times with the lysis buffer.

[0153] 5) Add the supernatant of the lysis buffer and the antibody mixture incubated overnight to the beads, and incubate with rotation at 4 °C for 4 - 6 h.

[0154] 6) Centrifuge at 2000 g for 3 min, and wash the pellet three times with the lysis buffer (each time add 1 mL of lysis buffer, invert the tube several times up and down, and centrifuge to discard the lysis buffer).

[0155] 7) Resuspend the pellet with 100 μL of lysis buffer and an appropriate amount of loading buffer, boil at 98 °C for 10 min, then centrifuge to collect the supernatant for immunoblotting detection.

[0156] As Figure 9 shown, the ERK antibody can detect the CKAP4 protein, and the CKAP4 antibody can also detect the ERK protein.

[0157] Based on this, the embodiment provides a reagent for detecting the expression level of CKAP4 protein, including the ERK antibody. Using this ERK antibody can perform immunoblotting detection to achieve quantitative detection of the CKAP4 protein content in breast cancer cells. Based on this, the embodiment also provides a WB kit for detecting the expression level of CKAP4 protein, including the ERK antibody.

[0158] Based on this, the embodiment also provides a method for in vitro detecting the CKAP4 protein content in breast cancer cells or tissues. The method includes: extracting the total protein sample from the breast cancer cells or tissues to be tested; performing SDS-PAGE electrophoresis on the total protein sample, transferring the obtained gel to a PVDF membrane, and after blocking; adding the primary antibody solution containing the ERK antibody; after incubation, adding the secondary antibody solution containing horseradish peroxidase-labeled goat anti-rabbit IgG; after incubation, developing color, and determining the protein content according to the developed color map.

[0159] Based on this, the embodiment provides a reagent for detecting the expression level of ERK protein, including the CKAP4 antibody. Using this CKAP4 antibody can perform immunoblotting detection to achieve quantitative detection of the ERK protein content in breast cancer cells. Based on this, the embodiment also provides a WB kit for detecting the expression level of ERK protein, including the CKAP4 antibody.

[0160] Based on this, the embodiment also provides a method for in vitro detecting the content of ERK protein in breast cancer cells or tissues. The method includes: extracting a total protein sample from the breast cancer cells or tissues to be tested; performing SDS-PAGE electrophoresis on the total protein sample, transferring the obtained gel to a PVDF membrane, and after blocking; adding a primary antibody solution containing CKAP4 antibody; after incubation, adding a secondary antibody solution containing horseradish peroxidase-labeled goat anti-rabbit IgG; after incubation, developing color, and determining the protein content according to the developed color map.

[0161] Knockdown of CKAP4 inhibits the proliferation of breast cancer cells

[0162] In some test cases, the SRB staining method and the EdU staining method were used to test the proliferation of CKAP4-knockdown HCC1806 cells and CKAP4-knockdown MDA-MB-231 cells.

[0163] As Figure 10 shown, the proliferation ability of CKAP4-knockdown HCC1806 cells was significantly decreased compared with that of non-CKAP4-knockdown HCC1806 cells, and the proliferation ability of CKAP4-knockdown MDA-MB-231 cells was significantly decreased compared with that of non-CKAP4-knockdown MDA-MB-231 cells. This shows that knocking down the CKAP4 gene in breast cancer cells can inhibit their proliferation.

[0164] Knockdown of CKAP4 arrests breast cancer cells in the G1 phase

[0165] In some test cases, flow cytometry and WB were used to detect the cell cycle of CKAP4-knockdown HCC1806 cells and CKAP4-knockdown MDA-MB-231 cells.

[0166] As Figure 11 shown, the number of cells in the G1 phase and G2 / M phase of CKAP4-knockdown HCC1806 cells was increased compared with that of non-CKAP4-knockdown HCC1806 cells, and the total number of cells in the S phase was decreased. The number of cells in the G1 phase and G2 / M phase of CKAP4-knockdown MDA-MB-231 cells was increased compared with that of non-CKAP4-knockdown MDA-MB-231 cells, and the total number of cells in the S phase was decreased.

[0167] This shows that knocking down CKAP4 arrests breast cancer cells in the G1 phase.

[0168] Knockdown of CKAP4 promotes apoptosis of breast cancer cells

[0169] In some test cases, flow cytometry was used to detect the apoptosis of CKAP4-knockdown HCC1806 cells and CKAP4-knockdown MDA-MB-231 cells.

[0170] As Figure 12As shown, the proportion of cell death and apoptosis in CKAP4-knockdown HCC1806 cells is increased compared to that in non-CKAP4-knockdown HCC1806 cells. The proportion of cell death and apoptosis in CKAP4-knockdown MDA-MB-231 cells is increased compared to that in non-CKAP4-knockdown MDA-MB-231 cells.

[0171] This indicates that knocking down CKAP4 promotes apoptosis of breast cancer cells.

[0172] Knockdown of CKAP4 inhibits the migration of breast cancer cells

[0173] In some test cases, the migration of CKAP4-knockdown HCC1806 cells and CKAP4-knockdown MDA-MB-231 cells was detected by the cell scratch assay.

[0174] As Figure 13 shown, the cell migration rates of CKAP4-knockdown HCC1806 cells at 24 h, 48 h, and 72 h are decreased compared to those of non-CKAP4-knockdown HCC1806 cells. The cell migration rates of CKAP4-knockdown MDA-MB-231 cells at 24 h, 48 h, and 72 h are decreased compared to those of non-CKAP4-knockdown MDA-MB-231 cells. This indicates that knocking down CKAP4 can inhibit the migration of breast cancer cells.

[0175] Knockdown of CKAP4 inhibits the invasion of breast cancer cells

[0176] In some test cases, the invasion of CKAP4-knockdown HCC1806 cells and CKAP4-knockdown MDA-MB-231 cells was detected by the Transwell assay.

[0177] As Figure 14 shown, the number of invasive cells of CKAP4-knockdown HCC1806 cells is decreased compared to that of non-CKAP4-knockdown HCC1806 cells. The number of invasive cells of CKAP4-knockdown MDA-MB-231 cells is decreased compared to that of non-CKAP4-knockdown MDA-MB-231 cells. This indicates that knocking down CKAP4 can inhibit the invasion of breast cancer cells.

[0178] Knockdown of CKAP4 inhibits the proliferation of xenografts in vivo

[0179] In some test cases, CKAP4-knockdown HCC1806 cells and CKAP4-knockdown MDA-MB-231 cells were injected into the xenograft tumors of breast cancer model mice to test the proliferation of the xenograft tumors. Specifically as follows:

[0180] Six-week-old female BALB / c nude mice (Beijing) were raised under specific pathogen-free (SPF) conditions. All animal experiments were approved by the Animal Ethics Committee. AsFigure 15 As shown in A, 1×10 6 CKAP4 knockdown HCC1806 breast cancer cells or CKAP4 knockdown MDA-MB-231 cells were subcutaneously injected into the mammary fat pads of nude mice, and the size of subcutaneous tumors was observed every 4 days. The growth of tumors was dynamically observed with vernier calipers, and the calculation formula was volume = 1 / 2 (width² × length), obtaining breast cancer model mice (shCKAP4-1 group and shCKAP4-2 group). And 1×10 6 HCC1806 breast cancer cells or MDA-MB-231 cells were used as the control group (Ctrl). After observing for 22 days, at the end point of observation, euthanasia was performed by rapid cervical dislocation. The tumors were excised and weighed. Tumor tissues were sampled, dehydrated, embedded, sectioned, and subjected to HE staining to observe histological morphology and immunohistochemical analysis. The specific method was the same as described above.

[0181] As Figure 15 shown in Figure 15 B, Figure 15 C and Figure 15 D, compared with the control group, the tumor growth rates of the shCKAP4-1 group and the shCKAP4-2 group were significantly slowed down, and the volumes and weights of the transplanted tumors were significantly decreased. As

[0182] shown in E, the number of Ki-67 positive cells, a cell proliferation protein, in the xenograft tumors of the shCKAP4-1 group and the shCKAP4-2 group was less than that of the control group. This indicates that CKAP4 knockdown effectively inhibits the growth of breast cancer tumors in vivo.

[0183] According to the above test examples, the expression of CKAP4 in breast cancer cells HCC1806 and MDA-MB-231 can be knocked down by a recombinant lentiviral vector carrying any one of the nucleotide sequences shown in SEQ ID NO: 1-4 and the Cas9 coding sequence, a recombinant lentivirus, and double-stranded RNA, thereby inhibiting the proliferation, migration, and invasion of breast cancer cells in vitro and in vivo, and can block breast cancer cells at the G1 phase and promote apoptosis of breast cancer cells. Therefore, the recombinant lentiviral vector, recombinant lentivirus, and double-stranded RNA carrying any one of the nucleotide sequences shown in SEQ ID NO: 1-4 and the Cas9 coding sequence provided in the examples all have the application prospect of developing into breast cancer drugs.

[0184] In addition, the test examples also found that CKAP4 and ERK regulate each other in breast cancer cells. Downregulating CKAP4 can downregulate ERK, and downregulating ERK can downregulate CKAP4. Downregulating CKAP4 can inhibit the proliferation, migration and invasion of breast cancer cells in vitro and in vivo, arrest breast cancer cells in the G1 phase, and promote apoptosis of breast cancer cells.

[0185] Therefore, the embodiment also provides a breast cancer drug, which uses at least one of a recombinant lentiviral vector carrying a nucleotide sequence shown in any one of SEQ ID NO: 1 to 4 and a Cas9 coding sequence, a recombinant lentivirus, and a double-stranded RNA shown in any one of SEQ ID NO: 13 to 20 as an active ingredient.

[0186] As mentioned above, the above are only the preferred specific embodiments of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present application should be covered by the protection scope of the present application.

Claims

1. An ERK signaling pathway inhibitor, comprising: A lentiviral vector carrying a gRNA that guides Cas9 to target and cleave CKAP4 and a Cas9 coding sequence; A recombinant lentivirus carrying a gRNA that guides Cas9 to target and cleave CKAP4 and a Cas9 coding sequence; Double-stranded RNA interfering with CKAP4; A lentiviral vector carrying a cloned nucleotide sequence of double-stranded RNA interfering with CKAP4; A lentivirus carrying a cloned nucleotide sequence of double-stranded RNA interfering with CKAP4; Double-stranded RNA interfering with KRAS; A lentiviral vector carrying a cloned nucleotide sequence of double-stranded RNA interfering with KRAS; and At least one of a lentivirus carrying a cloned nucleotide sequence of double-stranded RNA interfering with KRAS.

2. The ERK signaling pathway inhibitor according to claim 1, optionally, the gRNA that guides Cas9 to target and cleave CKAP4 is as shown in any one of SEQ ID NO: 1 to 4; Optionally, the lentiviral vector is the lenti-CRISPRv2 plasmid carrying a nucleotide sequence as shown in any one of SEQ ID NO: 1 to 4 and a Cas9 coding sequence; Optionally, the double-stranded RNA interfering with CKAP4 is as shown in SEQ ID NO: 13 and SEQ ID NO: 14; Optionally, the lentiviral vector is the GV493 plasmid carrying a DNA nucleotide sequence as shown in SEQ ID NO: 13 or SEQ ID NO: 14; Optionally, the double-stranded RNA interfering with CKAP4 is as shown in SEQ ID NO: 15 and SEQ ID NO: 16; Optionally, the lentiviral vector is the GV493 plasmid carrying a nucleotide sequence as shown in SEQ ID NO: 15 or SEQ ID NO: 16; Optionally, the double-stranded RNA interfering with KRAS is as shown in SEQ ID NO: 17 and SEQ ID NO: 18; Optionally, the lentiviral vector is the GV493 plasmid carrying a nucleotide sequence as shown in SEQ ID NO: 17 or SEQ ID NO: 18; Optionally, the double-stranded RNA interfering with KRAS is as shown in SEQ ID NO: 19 and SEQ ID NO: 20; Optionally, the lentiviral vector is the GV493 plasmid carrying a nucleotide sequence as shown in SEQ ID NO: 19 or SEQ ID NO:

20.

3. A breast cancer drug using the ERK signaling pathway inhibitor according to claim 1 as an active ingredient.

4. A reagent for detecting the expression level of CKAP4 protein, comprising an ERK antibody.

5. A WB kit for detecting the expression level of CKAP4 protein, comprising an ERK antibody.

6. A method for in vitro detecting the content of CKAP4 protein in breast cancer cells or tissues, comprising: Extracting a total protein sample from the breast cancer cells or tissues to be tested; Performing SDS-PAGE electrophoresis on the total protein sample, transferring the obtained gel to a PVDF membrane, and after blocking; Adding a primary antibody solution containing an ERK antibody; After incubation, add a secondary antibody solution containing horseradish peroxidase-labeled goat anti-rabbit IgG; and After incubation and color development, determine the protein content according to the color development map.

7. A reagent for detecting the expression level of ERK protein, comprising a CKAP4 antibody.

8. A WB kit for detecting the expression level of ERK protein, comprising a CKAP4 antibody.

9. A method for in vitro detecting the content of ERK protein in breast cancer cells or tissues, comprising: extracting a total protein sample from the breast cancer cells or tissues to be tested; performing SDS-PAGE electrophoresis on the total protein sample, transferring the obtained gel to a PVDF membrane, and after blocking; adding a primary antibody solution containing a CKAP4 antibody; after incubation, adding a secondary antibody solution containing horseradish peroxidase-labeled goat anti-rabbit IgG; and after incubation and color development, determining the protein content according to the color development map.

10. Use of the ERK signaling pathway inhibitor according to claim 1 or 2 in the preparation of a drug for treating breast cancer.