Akabane disease virus recombinant virus-like particle and preparation method thereof

Abstract

The invention discloses akabane disease virus recombinant virus-like particles and a preparation method thereof, and belongs to the technical field of biology. The akabane disease virus recombinant virus-like particles are obtained by recombinant expression of structural protein Gn and structural protein Gc of akabane disease virus in an insect cell-baculovirus expression system and self-assembly; the amino acid sequence of the structural protein Gn is as shown in SEQ ID NO. 1; the amino acid sequence of the structural protein Gc is as shown in SEQ ID NO. 2. According to the invention, genes of coding structural proteins Gn and Gc are optimized according to codon preference of insect cells, and AKAV virus-like particles with higher safety are successfully prepared through a baculovirus-insect cell expression system. The AKAV virus-like particle provided by the invention has application potential in various fields of AKAV vaccines, immunotherapy and the like, and provides technical reserve for biological safety monitoring.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to an Akabane virus recombinant virus-like particle and a preparation method thereof. Background Art

[0002] Akabane virus (AKAV) is a highly contagious animal pathogen that can replicate in arthropods and infect host animals through bites. Such viruses can not only cause reproductive dysfunction in economic animals such as cattle and sheep, but also seriously threaten the development of the aquaculture industry in China and human public health safety. AKAV is a negative-strand RNA virus of the Simbu Serogroup in the genus Orthobunyavirus of the family Bunyaviridae. In order to avoid the adverse effects of Bunyavirus-related research on biosafety, existing research mostly prepares virus-like particles (VLPs) to obtain viruses with immunogenicity but no infectivity. Currently, VLPs of Bunyaviruses such as Rift Valley fever virus and severe fever with thrombocytopenia syndrome virus have been prepared, but there is no relevant report on the preparation method of AKAV VLPs.

[0003] Proper glycosylation is crucial for the antigenicity and immunogenicity of proteins. Therefore, it is particularly important to select a suitable expression system. Currently, the baculovirus expression vector system (BEVS) is a relatively mature eukaryotic expression system for VLPs. Its suspension culture mode is easy to scale up, and multiple foreign genes can be inserted simultaneously and the recombinant genes can be highly expressed. BEVS uses insect cells as the expression host, which can post-translationally modify the expressed foreign proteins and promote their correct folding.

[0004] In summary, exploring the preparation method of AKAV virus-like particles is of great significance for the vaccine development of Bunyavirus-related viruses and the prevention and control of biological risk factors. Summary of the Invention

[0005] The purpose of the present invention is to provide an Akabane virus recombinant virus-like particle and a preparation method thereof to solve the problems existing in the above-mentioned prior art. The present invention optimized the genes encoding the structural proteins Gn and Gc according to the codon preference of insect cells, and successfully prepared AKAV virus-like particles with higher safety through the baculovirus-insect cell expression system. AKAV virus-like particles have application potential in various fields such as AKAV vaccines and immunotherapy, providing a technical reserve for biosafety monitoring.

[0006] To achieve the above purpose, the present invention provides the following solutions:

[0007] The present invention provides a recombinant virus-like particle of Akabane disease virus, which is recombinantly expressed by the structural protein Gn and the structural protein Gc of Akabane disease virus in an insect cell-baculovirus expression system and self-assembled;

[0008] The amino acid sequence of the structural protein Gn is as shown in SEQ ID NO.1; the amino acid sequence of the structural protein Gc is as shown in SEQ ID NO.2.

[0009] Optionally, the nucleotide sequence of the gene encoding the structural protein Gn is as shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding the structural protein Gc is as shown in SEQ ID NO.4.

[0010] The present invention also provides a method for preparing the recombinant virus-like particle of Akabane disease virus, comprising the following steps:

[0011] Connect the genes encoding the structural protein Gn and the structural protein Gc to an insect cell expression vector to obtain a recombinant plasmid;

[0012] Transform the obtained recombinant plasmid into Escherichia coli competent cells to obtain a recombinant bacmid;

[0013] Transfect the obtained recombinant bacmid into insect cells to obtain a recombinant baculovirus;

[0014] Infect the obtained recombinant baculovirus into insect cells to express the structural protein Gn and the structural protein Gc, and obtain a recombinant virus-like particle of Akabane disease virus;

[0015] The nucleotide sequence of the gene encoding the structural protein Gn is as shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding the structural protein Gc is as shown in SEQ ID NO.4.

[0016] The present invention also provides the application of the recombinant virus-like particle of Akabane disease virus in the preparation of a drug for preventing Akabane disease.

[0017] Optionally, the drug includes a vaccine.

[0018] The present invention also provides a drug for preventing Akabane disease, which includes the recombinant virus-like particle of Akabane disease virus.

[0019] Optionally, the drug further includes a pharmaceutically acceptable immunoadjuvant.

[0020] Optionally, the drug includes a vaccine.

[0021] The present invention discloses the following technical effects:

[0022] To avoid the adverse effects of research on Bunyaviruses such as Akabane disease virus on biosafety, the present invention selects the structural proteins Gn and Gc encoded by the M gene of Akabane disease virus as basic assembly components, optimizes the genes encoding the structural proteins Gn and Gc according to the codon preference of insect cells, constructs a recombinant plasmid with pathogenic structure and immunogenicity but without replication ability, and successfully prepares a safer Akabane disease virus-like particle through the baculovirus-insect cell expression system.

[0023] The Akabane disease virus-like particle provided by the present invention has application potential in various fields such as Akabane disease virus vaccines and immunotherapy, and provides a technical reserve for biosafety monitoring. Brief Description of the Drawings

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0025] Figure 1 Design of recombinant plasmid of Akabane disease virus M gene and results of recombinant bacmid PCR amplification; A: Map of recombinant plasmid pFastBac Dual-AKAV-G; B: Results of recombinant plasmid pFastBac Dual-AKAV-G PCR amplification;

[0026] Figure 2 Results of recombinant baculovirus transfection of Sf9 cells for cytopathic effect; A: Normal Sf9 cells; B: Transfection reagent control; C: Cytopathic effect of Sf9 cells infected with recombinant baculovirus (5 μg); D: Cytopathic effect of Sf9 cells infected with recombinant baculovirus (10 μg);

[0027] Figure 3 Expression level of Akabane disease virus Gn / Gc protein in Sf9 cells infected with recombinant baculovirus; M: Protein relative molecular weight standard;

[0028] Figure 4 Results of indirect immunofluorescence detection of recombinant baculovirus; A and C: Normal Sf9 cells in the blank control group; B: Sf9 cells infected with rBac-AKAV-G (using AKAV-Gc as the primary antibody); D: Sf9 cells infected with rBac-AKAV-G (using AKAV-Gn as the primary antibody);

[0029] Figure 5Results of AKAV VLP purification and Western blot verification; A: Results of purification by sucrose density gradient centrifugation; B: Expression of Gc / Gn proteins in the suspension bands collected at each sucrose density.

[0030] Figure 6 Results of electron microscopy observation of VLPs; A: Measurement of VLP particle size, where (1) the particle size length is 0.07 μm, (2) the particle size length is 0.06 μm, (3) the particle size length is 0.08 μm, and (4) the particle size length is 0.07 μm; B: Double-layer membrane structure of VLP; C: Spike structure of VLP glycoprotein. Detailed implementation manners

[0031] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0032] It should be understood that the terms used in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0033] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0034] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are only exemplary.

[0035] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0036] Example 1 Preparation and identification of recombinant virus-like particles of Akabane disease virus

[0037] 1 Materials and Methods

[0038] 1.1 Cell lines and antibodies

[0039] DH10Bac competent cells were purchased from Beijing Tsingke Biotechnology Co., Ltd. Insect ovarian cells (Sf9 cells) and AKAV-Gc / Gn monoclonal antibody were preserved by the Animal Inspection Institute of the China National Institute of Quality Inspection and Testing Science.

[0040] 1.2 Main reagents

[0041] Plasmid miniprep kit was purchased from TransGen Biotech Co., Ltd.; SIM SF medium was purchased from SinoBiological Inc.; Penicillin-streptomycin, antibody diluent, SDS-PAGE preparation reagents, HRP-labeled goat anti-mouse IgG and mouse-derived β-Actin monoclonal antibody were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; KOD PCR reagent was purchased from TOYOBO Biotechnology Co., Ltd.; ExpiFectamine Sf TM Transfection reagent, fetal bovine serum, and DMEM medium were all purchased from Thermo Fisher Scientific.

[0042] 1.3 Design of recombinant plasmid pFastBac Dual-AKAV-G

[0043] The CDS gene information of the M segment of the AKAV TJ2016 strain (GenBank sequence accession number: MT761688.1) was obtained from the NCBI website. Based on the baculovirus insect cell expression system, the codons of the original ORF were optimized. BbsI / KpnI restriction enzyme sites were added to the upstream and downstream of the optimized M gene sequence, and the optimized sequences Gn (amino acid AA: 18 - 309) and Gc (amino acid AA: 533 - 1340) were inserted downstream of the PpH and Pp10 promoters of the p-FastBac Dual plasmid, respectively. The insertion site downstream of the PpH promoter was 5’BamHI and 3’HindIII, and the insertion site downstream of the Pp10 promoter was 5’BbsI and 3’KpnI. On this basis, the recombinant shuttle vector pFastBac Dual-AKAV-G was constructed. The recombinant plasmid was synthesized by Beijing Tsingke Biotechnology Co., Ltd.

[0044] SEQ ID NO.1 (Gn amino acid sequence):

[0045] mpprntnggrcfyggdmfrqinstspmseicvrddislvksigyhklaanreviessmsyyrlyyvknwfecnpvqdilgtfmvfdvnhegilapktyacratcsislerdtgnvvlespalnhytihgttikngwfktkvsidldntcedlhitcghktlnvhacfrqhksciryfkgsilpevmiesictnaelillccfsaiscfvaiiltktylvyllipifypfvklyglllqrfckqckncllpihpfspcpttcicgmvynstealkvhrkclnctgyktltktr;

[0046] SEQ ID NO.2 (Gc amino acid sequence):

[0047] kdlhsatihefiaanlypnsfkkhlasagpdsikwktyiqnnnlhlcndhvvkmicrcvikqeecsstkvddgeqiaqyykknkefykadleilytvisraipglvgnllrqvlksqkyeeslhvlnkikkdvsknnqlnsivefliyinskniteevrelrirpdlsirgskftdknpgtpnikecqtplfitctgkrfrslmkqyiacsnggvklyqrpnkplalvdnklcigdkycmiafdpmvideniqkldcyslaatdqsdgmlkpersirllktgeckiagalsriavsinqknykystivhrksdlvdeyclspncdldcypyypanlvdcswsesthstlsqkvishtdiesfissvklslhndliqhhfrplsnmphvkpnfksinvqgtisggkiqdsyitfsiplmtglsqgftlqdhkgntlfdiiayvksarviatynheyktgptvsinvqhneqctgscpssipkkdnwltfsrehtstwgceewgclaigtgcvygscqdvireeatvisrvnneqlevefcvseptstmcntinvlepvlgehmqfevhsvqtnllpevaliknrrvykgsinkkgvfnpqcgsvqsfdgklygvgnpkfdyichalsrkdivvrkcyenhyyscatlkeaveiksnitnsktmlyndnallgsasvkimlgdliyqqasvqekdirghatcggctdcfndvackismtsngvyqcpivsscdsyinnvyinegtndinlkfrclkaeikisicgrempvkseiikdtkkldlasadqtsyikefdkkcatwlcrayneg;

[0048] SEQ ID NO.3 (Optimized Gn nucleotide sequence):

[0049] ATGCCACCACGTAATACCAATGGTGGAAGATGCTTCTATGGTGGTGACATGTTCCGT CAGATCAACTCCACTTCTCCAATGTCGGAAATCTGCGTCCGTGACGACATCTCGTTGGTCAAGTCCATCGGCTACCACAAATTGGCCGCTAACAGGGAGGTGATCGAATCGTCAATGTCATATTACAGGCTGTATTACGTTAAGAACTGGTTCGAGTGTAATCCAGTACAAGACATCTTGGGTACTTTCATGGTGTTCGACGTGAATCACGAGGGTATCTTGGCTCCAAAGACGTATGCTTGCCGCGCTACTTGTTCTATCTCTCTGGAGCGTGACACCGGAAACGTAGTACTTGAAAGTCCAGCACTGAACCACTACACTATTCACGGCACCACCATCAAGAACGGTTGGTTCAAGACTAAGGTGAGCATCGACCTTGACAACACGTGTGAGGACTTGCACATCACATGCGGTCATAAGACACTGAATGTCCACGCTTGCTTCCGTCAGCACAAGAGCTGTATCCGCTACTTCAAGGGTTCCATTCTGCCTGAAGTCATGATCGAGTCGATCTGTACCAACGCTGAACTCATCTTGCTGTGTTGCTTCTCCGCCATTAGCTGCTTCGTGGCGATCATCTTGACAAAGACTTATTTGGTGTACCTGCTGATCCCAATCTTCTACCCATTCGTGAAACTGTACGGATTGCTTCTTCAACGCTTCTGCAAGCAATGCAAGAACTGCCTCTTGCCAATCCATCCGTTCTCTCCATGCCCGACGACTTGCATCTGCGGTATGGTGTACAACTCCACTGAGGCACTCAAAGTGCACCGTAAGTGCTTGAACTGTACAGGTTACAAGACACTGACTAAGACCAGA;

[0050] SEQ ID NO.4 (Optimized Gc nucleotide sequence):

[0051]

[0052] 1.4 Construction and Identification of Recombinant Bacmid rBacmid-AKAV-G

[0053] 1.4.1 Extraction of Recombinant Bacmid

[0054] The recombinant plasmid pFastBac Dual-AKAV-G was transferred into E.coli DH10 Bac competent cells. The DH10Bac competent cells were dissolved in an ice bath. The recombinant plasmid was dissolved to a concentration of 100 ng / μL, and 1 μL was taken and added to 50 μL of DH10Bac competent cells. After gently mixing, it was placed in an ice bath for 30 min, heat-shocked in a 42 °C water bath for 90 s, and then placed on ice and allowed to stand for 2 min. After adding 700 μL of SOC medium, it was placed in a 37 °C constant temperature shaker and cultured at 180 rpm for 4 h. 40 μL of X-gal (20 mg / mL) and 20 μL of IPTG (40 mg / mL) were evenly spread on a solid LB medium containing triple antibiotics (50 μg / mL kanamycin, 10 μg / mL tetracycline, 7 μg / mL gentamicin), and placed in a 37 °C incubator for 1 h. 25 μL of the bacterial solution was evenly spread on the above medium, and after inverted culture at 37 °C for 48 h, blue-white screening was carried out. The single white colony was continuously inoculated onto the solid medium containing triple antibiotics according to the method of streaking on a plate until no blue colonies appeared. A single white colony with regular shape was picked and inoculated into a liquid LB medium containing triple antibiotics, cultured at 37 °C and 200 rpm for 14 h, and the plasmid was extracted according to the instructions of the EasyPure Plasmaid MiniPrep Kit (Trans, EM101). After neutralization with Neutralization Buffer and centrifugation, the supernatant was taken and transferred to a new EP tube. An equal volume of isopropanol was added, and it was inverted and mixed evenly, and allowed to stand for 15 min to precipitate DNA. After centrifugation at 12,000×g for 2 min, the supernatant was discarded. After resuspension with 75% ethanol, it was centrifuged again. After washing twice with ethanol according to the above method, the ethanol was discarded, and it was allowed to stand at room temperature for 5 min to fully volatilize the ethanol. ddH2O preheated at 72 °C was added to the tube to dissolve it, and the recombinant bacmid rBacmid-AKAV-G was obtained, labeled and stored at -20 °C.

[0055] 1.4.2 Identification of Recombinant Bacmid

[0056] The gene sequence of the recombinant bacmid rBacmid-AKAV-G was identified using the universal primers M13-R and M13-F. The reaction system was as follows: 0.5 μL of KOD FX Neo, 12.5 μL of 2× Buffer for KOD FX Neo, 5 μL of dNTP, 0.5 μL each of the upstream and downstream primers, 5 μL of ddH2O, and 1 μL of the recombinant bacmid, with a total volume of 25 μL. The PCR reaction conditions were: 2 min at 94 °C; 1 s at 98 °C, 3 s at 55 °C, 3 min at 68 °C, for 35 cycles; and 7 min at 68 °C.

[0057] 5 μL of the PCR product was taken for sequencing identification, and the sequencing was completed by Beijing Tsingke Biotechnology Co., Ltd.

[0058] 5 μL of the PCR product was mixed with 1 μL of 6× Gel Loading Dye, electrophoresed at 150 V for 25 min, and then observed using a developing instrument. The rBacmid-AKAV-G that met the expectations and had correct sequencing results could be used for the next experiment.

[0059] 1.5 Preparation and identification of recombinant baculovirus rBac-AKAV-G

[0060] 1.5.1 Preparation of recombinant baculovirus

[0061] Sf9 cells were subcultured until the cell viability reached 100%. Sf9 cells were seeded in a six-well plate at a density of 1×10 6 cells / well and placed in a carbon dioxide-free incubator at 27 °C for 30 - 60 min to adhere. The ExpiFectamine TM Sf transfection reagent was inverted 5 - 10 times and gently mixed. 10 μL of the ExpiFectamine TM Sf transfection reagent was added to 250 μL of Opti-MEM Medium for dilution, gently inverted 5 - 10 times for mixing, and incubated at room temperature for 5 min. rBacmid-AKAV-G was directly added to the diluted ExpiFectamine TM Sf transfection reagent at two concentrations of 5 μg / 10 μg, gently inverted 5 - 10 times, and incubated at room temperature for 5 min. The DNA-lipid mixture was added dropwise to the six-well plate containing the incubated Sf9 cells and cultured in a carbon dioxide-free incubator at 27 °C for 72 h until cytopathic effects appeared. The cells with cytopathic effects were repeatedly frozen and thawed twice to break the cells to release the virus, and the cell supernatant was centrifuged and collected for recombinant virus passage. The P2 generation virus was continuously expanded and cultured at 27 °C for 72 h. Blind passage was carried out to the P3 generation, and the cell supernatant was collected for further verification.

[0062] 1.5.2 Western blot verification of recombinant baculovirus

[0063] The recombinant baculovirus rBac-AKAV-G in the cell supernatant was verified by Western blot. The collected cell supernatant was mixed with 5×loading buffer and incubated in a 95°C water bath for 10 min to prepare WB samples.

[0064] Preparation of SDS-PAGE gel: 12% lower separating gel and 5% upper stacking gel. After loading, the voltage of the electrophoresis apparatus was adjusted to 80 V for 35 - 40 min, and then changed to 120 V to continue electrophoresis for 45 - 55 min. Proteins on the polyacrylamide gel were transferred to the PVDF membrane by wet transfer method, and electrophoresed at a constant voltage of 80 V in an ice bath for 2 h. After transfer to the PVDF membrane, it was blocked with 5% skim milk at room temperature for 2 h. After washing three times with PBST, it was incubated overnight at 4°C with AKAV Gc / Gn monoclonal antibody as the primary antibody (1:5000). After washing three times with PBST, it was incubated with HRP-labeled goat anti-mouse monoclonal antibody as the secondary antibody (1:5000) at room temperature for 1 h. After incubation with chemiluminescent solution for 30 s, it was observed in an imager.

[0065] 1.5.3 IFA verification of recombinant baculovirus

[0066] Sf9 cells in good growth state were cultured adherently in a 96-well plate, and Sf9 cells were infected with the recombinant baculovirus. Cells were collected after 72 h. The supernatant was discarded, fixed with ice-cold ethanol for 30 min, washed three times with PBS, and then incubated with AKAV Gc / Gn monoclonal antibody (1:1000) in a 37°C incubator for 1 h. After washing three times with PBS, it was incubated with FITC-labeled goat anti-mouse IgG secondary antibody (1:500) in the dark for 40 min. After washing with PBS, it was observed under a fluorescence microscope.

[0067] 1.6 Purification and identification of AKAV VLPs

[0068] 1.6.1 Purification of AKAV VLPs

[0069] The identified rBac-AKAV-G was inoculated again into suspension-cultured Sf9 cells, cultured in a 28°C carbon dioxide-free incubator at 120 rmp for 96 h, and then the cells were collected and stored in an -80°C refrigerator. After repeated freezing and thawing 2 times, all cell suspensions were collected and centrifuged at 10000 rmp at 4°C for 30 min to remove cell pellets, and the supernatant was retained. The cell supernatant was centrifuged at 25000 rpm at 4°C for 2 h, and then the supernatant was discarded. The precipitate was resuspended by thoroughly pipetting with PBS and added to the top layer of a density gradient sucrose (20% - 40% - 60% (w / v)) centrifugation cushion, and centrifuged at 35000 rpm at 4°C for 3 h. The white suspension band between each sucrose gradient was aspirated with a syringe, mixed with 20 volumes of pre-cooled PBS to remove sugar, and centrifuged at 25000 rpm for 2 h, and then resuspended with 1 mL of pre-cooled PBS respectively.

[0070] 1.6.2 Western blot Identification

[0071] Take 40 μL of the samples obtained between the upper layer of 20% sucrose, between 20% - 40% sucrose, and between 40% - 60% sucrose respectively, mix them with 10 μL of loading buffer, and incubate in a 95°C water bath for 10 min. Take 10 μL of each sample and add it into the loading wells of a 5% SDS-PAGE stacking gel. Set the voltage to 80 V. After electrophoresis for 40 min, change the voltage to 120 V and continue electrophoresis for 50 min until the samples enter the lower 12% separating gel. Transfer the proteins to a PVDF membrane by wet transfer method. Set the voltage to 80 V and transfer for 2 h, then take out the membrane and block it in 5% skim milk for 2 h. Incubate overnight at 4°C with AKAV Gc / Gn monoclonal antibody as the primary antibody (1:5000). After washing with PBST, incubate at room temperature for 1 h with HRP-labeled goat anti-mouse monoclonal antibody as the secondary antibody (1:5000). Incubate with chemiluminescent solution for 30 s and then observe in an imager.

[0072] 1.6.3 Electron Microscopy Identification

[0073] Take 20 μL of the AKAV VLPs sample, cover a 200-mesh copper grid on the sample drop, and adsorb at room temperature for 1 min. Cover the copper grid on the 2% phosphotungstic acid staining solution, perform negative staining for 30 s, and then dry at room temperature for 5 - 10 min. Set the accelerating voltage to 80 kV, collect VLPs images under a transmission electron microscope, and perform labeling and analysis.

[0074] 2 Experimental Results

[0075] 2.1 Construction of Recombinant Plasmid and Identification of Recombinant Bacmid

[0076] Insert the Gn and Gc sequences of AKAV into the two promoters of the pFastBac Dual vector ( Figure 1 in A) respectively. Then perform PCR identification on the obtained positive clone vectors. Use the universal primers M13R and M13F to perform PCR amplification on pFastBac Dual-AKAV-G as the template. The amplification results are as Figure 1 shown in B. The size of the specific amplification fragment is about 6000 bp, which is consistent with the expected fragment size (5933 bp). In addition, the nucleic acid sequence determination results of the target gene show that its homology with the expected protein gene is as high as 100%, and no adverse mutations or nucleotide deletions are found. Therefore, the above results indicate that the recombinant plasmid pFastBacDual-AKAV-G is correctly constructed.

[0077] 2.2 Rescue of Recombinant Baculovirus

[0078] Sf9 cells were transfected with rBacmid-AKAV-G at two concentrations of 5 μg / 10 μg and passaged continuously. After passage to the P3 generation and culturing at 27 °C for 72 h, obvious cytopathic effects occurred in the cells, mainly manifested as cell enlargement, rounding, detachment of a large number of adherent cells, and an increase in the number of floating cells, as Figure 2 shown, indicating the successful rescue of the recombinant baculovirus rBac-AKAV-G.

[0079] 2.3 Identification of recombinant baculovirus

[0080] 2.3.1 Western blot verification

[0081] Samples were prepared from the supernatants of Sf9 cells infected with rBac-AKAV-G, using AKAV-Gc and AKAV-Gn monoclonal antibodies as primary antibodies respectively. The Western blotting results showed as Figure 3 shown. There were no specific bands in the control group, while the specific band appeared between 100 - 130 kDa after incubation with the Gc monoclonal antibody, and the specific band incubated with the Gn monoclonal antibody was between 25 - 35 kDa, which was consistent with the expected protein size. It indicated that the Sf9 cells infected with rBac-AKAV-G could accurately express AKAV Gc / Gn proteins.

[0082] 2.3.2 Indirect immunofluorescence identification

[0083] The obtained recombinant baculovirus rBac-AKAV-G was used to infect Sf9 cells for 72 h. After ethanol fixation, AKAV-Gc and AKAV-Gn monoclonal antibodies were used as primary antibodies. The immunofluorescence results were as Figure 4 shown. There was no fluorescence signal in the control group, while large areas of green fluorescence appeared in the cells infected with the recombinant virus, and the number of adherent cells was less than that in the control group. This result further confirmed that the obtained recombinant virus rBac-AKAV-G could express the target protein.

[0084] 2.4 Purification and identification of AKAV VLPs

[0085] 2.4.1 Western blot verification

[0086] To observe the AKAV virus-like particles packaged by the recombinant virus, the virus-like particles were purified by sucrose density gradient centrifugation. The white suspension bands between the upper layer of 20% sucrose, between 20% - 40% sucrose density, and between 40% - 60% sucrose density were collected respectively, and samples were prepared after removing sugar ( Figure 5In A), the Western blot assay used AKAV-Gc and AKAV-Gn monoclonal antibodies as the primary antibodies. The results showed that no obvious bands appeared in the suspension bands with a sucrose density of more than 40%, while clear bands were observed between 40% and 60% sucrose density, which were 105 kDa (Gc) and 28 kDa (Gn) respectively ( Figure 5 In B), indicating that AKAV VLPs meeting the expectations can be obtained between 40% and 60% sucrose gradients.

[0087] 2.4.2 Electron microscopy verification

[0088] To further identify whether the expressed AKAV Gn / Gc proteins were packaged into complete VLPs, the purified VLPs were observed by transmission electron microscopy. The results showed that the prepared virus-like particles were spherical with an envelope and had a diameter of about 60 - 100 nm ( Figure 6 In A). In addition, a clear bilayer membrane structure of AKAV VLPs was visible under the electron microscope ( Figure 6 In B), as well as the spiky structures on the surface of the particles composed of the viral glycoproteins Gn and Gc ( Figure 6 In C). The results indicated that the VLPs were mainly assembled from the glycoproteins of AKAV, further confirming that the VLPs expressed in this study were AKAV VLPs and could be applied to subsequent related research.

[0089] The embodiments described above are only for describing the preferred mode of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A recombinant virus-like particle of Akabane disease virus, characterized in that, The Akabane disease virus recombinant virus-like particles are recombinantly expressed by the structural protein Gn and the structural protein Gc of the Akabane disease virus in an insect cell-baculovirus expression system and self-assembled to obtain; The amino acid sequence of the structural protein Gn is as shown in SEQ ID NO.1; the amino acid sequence of the structural protein Gc is as shown in SEQ ID NO.

2.

2. The recombinant virus-like particle of Akabane disease virus according to claim 1, characterized in that, The nucleotide sequence of the gene encoding the structural protein Gn is as shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding the structural protein Gc is as shown in SEQ ID NO.

4.

3. The preparation method of the Akabane disease virus recombinant virus-like particles according to claim 1, characterized in that, Comprising the following steps: Connect the genes encoding the structural protein Gn and the structural protein Gc to an insect cell expression vector to obtain a recombinant plasmid; Transform the obtained recombinant plasmid into Escherichia coli competent cells to obtain recombinant bacmids; Transfect the obtained recombinant bacmids into insect cells to obtain recombinant baculoviruses; Infect the obtained recombinant baculoviruses into insect cells to express the structural protein Gn and the structural protein Gc, and obtain Akabane disease virus recombinant virus-like particles; The nucleotide sequence of the gene encoding the structural protein Gn is as shown in SEQ ID NO.3; the nucleotide sequence of the gene encoding the structural protein Gc is as shown in SEQ ID NO.

4.

4. Use of the Akabane disease virus recombinant virus-like particles according to claim 1 in the preparation of a medicament for preventing Akabane disease.

5. The application according to claim 4, characterized in that, The medicament includes a vaccine.

6. A drug for preventing Akabane disease, characterized in that, The medicament includes the Akabane disease virus recombinant virus-like particles according to claim 1.

7. The drug according to claim 6, characterized in that, The medicament further includes a pharmaceutically acceptable immunoadjuvant.

8. The drug according to claim 6, characterized in that, The medicament includes a vaccine.

Images