Recombinant A type humanized XVII type collagen as well as construction and application thereof

Abstract

The invention relates to a recombinant A type humanized XVII type collagen as well as construction and application thereof, the protein is the humanized XVII type collagen which is composed of an intracellular region, a transmembrane region and an extracellular region, and the amino acid sequence is as shown in SEQ No. 1. The hair follicle repairing agent has the advantages of hair follicle repairing, hair regeneration, good biological activities of cell proliferation, cell adhesion and the like, and can be widely applied to the fields of medicines, medical instruments, biological materials, tissue engineering, cosmetics and the like. The gene sequence of the recombinant A type XVII collagen is 100% identical to the corresponding part of the gene sequence of the recombinant A type XVII collagen, so that the recombinant A type XVII collagen has good hydrophilicity and high activity, and has application potential in the fields of biomedical materials, beauty cosmetics, skin care products and the like.

Description

Technical Field

[0001] The present disclosure relates to the field of bioengineering technology, and particularly to a recombinant humanized type XVII collagen strain of type A, a construction method thereof, and an application thereof. Background Art

[0002] Type XVII collagen (COL17A1) is a transmembrane glycoprotein, with its N-terminus located in the cytoplasm and its C-terminus located in the extracellular matrix, forming a hemidesmosome structure, playing the role of a "double-sided adhesive". This structure needs to simultaneously maintain functions such as the connection between the epidermis and the dermis and the anchoring of stem cells, resulting in its synthesis being more difficult than traditional collagen. Type XVII collagen consists of 1497 amino acids and contains complex functional regions such as a triple helix, a trimer, and a transmembrane domain. As a key driving factor in epidermal stem cell competition, type XVII collagen realizes "root anti-aging" by activating the neogenesis of COL1 and COL3, maintains the activity of hair follicle stem cells, and delays the miniaturization of hair follicles, which may subvert traditional treatment regimens such as minoxidil. The technological breakthrough of recombinant type XVII collagen marks a paradigm shift from traditional animal extraction to precision biomanufacturing. Its technical barriers focus on complex structure expression, large-scale production processes, and clinical transformation verification, and may give rise to a new generation of biomaterials in the fields of anti-aging, hair growth, skin repair, etc. in the future.

[0003] Different from type I and type III collagens, type XVII collagen cannot be mass-produced by animal extraction because its content is extremely low (only less than 1% of the total mammalian collagen), and it is a non-extracellular secreted protein, and recombinant technology must be relied on. Existing technologies are difficult to synthesize a full-length and functionally intact molecule, and usually need to intercept key functional domains for expression through genetic recombination technology. Summary of the Invention

[0004] In order to solve the above problems, the present application proposes a construction method and an application of a recombinant humanized type XVII collagen strain of type A.

[0005] On the one hand, the present application proposes a recombinant humanized type XVII collagen of type A, which contains at least 72 amino acid monomers that meet the high-activity sequence conditions and are repeated three times; wherein: The amino acid sequence of the amino acid monomer is as shown in SEQ No.1.

[0006] On the other hand, the present application proposes that a nucleotide sequence encoding the recombinant humanized type XVII collagen of type A is as shown in SEQ No.2.

[0007] On the other hand, the present application also proposes a nucleic acid molecule, which contains the nucleotide monomers encoded as above.

[0008] On the other hand, the present application also provides a vector comprising the nucleic acid molecule described above.

[0009] On the other hand, the present application also provides a host cell comprising the recombinant humanized type XVII collagen of type A described above, or the nucleic acid molecule, or the vector.

[0010] Preferably, the host cell is a prokaryotic cell or a eukaryotic cell.

[0011] Preferably, the eukaryotic cell is Pichia pastoris.

[0012] On the other hand, the present application also provides a method for constructing recombinant humanized type XVII collagen of type A, comprising the following steps: (1) Coding the nucleotide sequence shown in SEQ No. 2 in a host cell to obtain a recombinant plasmid encoding recombinant humanized type XVII collagen of type A; (2) Expressing the recombinant humanized type XVII collagen of type A based on the host cell to obtain a corresponding genetically engineered bacterium; (3) Fermenting and culturing the genetically engineered bacterium to achieve the induced expression of the recombinant humanized type XVII collagen of type A, and obtaining a fermentation broth containing the recombinant humanized type XVII collagen of type A; (4) Subjecting the fermentation broth to centrifugation, ion exchange column, and ultrafiltration for buffer exchange to obtain a solution of the recombinant humanized type XVII collagen of type A; (5) Freezing and drying the solution of the recombinant humanized type XVII collagen of type A by a freeze dryer to obtain a freeze-dried powder state of the recombinant humanized type XVII collagen strain.

[0013] On the other hand, the present application also provides the use of a recombinant humanized type XVII collagen of type A, or the recombinant humanized type XVII collagen of type A obtained from the above coding nucleotide sequence, or the nucleotide monomer contained in the above nucleic acid molecule, or the recombinant humanized type XVII collagen of type A produced by the above host cell in the preparation of medicines, foods, cosmetics, health products, and medical devices.

[0014] Technical effects of the present invention: One of the present application is to overcome the defects in the prior art for preparing recombinant type XVII collagen of type A, and the other is to provide a method for preparing recombinant type XVII collagen of type A that can be large-scale, simple, and low-cost.

[0015] This application not only has the functions of hair follicle repair and hair regeneration, but also has good biological activities such as cell proliferation and cell adhesion, and can be widely applied in the fields of medicine, medical devices, biomaterials, tissue engineering, cosmetics, etc. The recombinant type A XVII collagen gene sequence is 100% identical to the corresponding part of the recombinant type A XVII collagen gene sequence. Therefore, it has good hydrophilicity and high activity, making it have application potential in the fields of biomedical materials, beauty cosmetics and skin care products, etc.

[0016] Other features and aspects of the present disclosure will become clear from the following detailed description of the exemplary embodiments with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The drawings included in and constituting a part of the specification illustrate the exemplary embodiments, features, and aspects of the present disclosure together with the specification, and are used to explain the principles of the present disclosure.

[0018] Figure 1 Schematic diagram for the construction of the recombinant type A XVII collagen expression plasmid; Figure 2 Genome sequencing map of the expression strain COLⅢ-XVII (placed horizontally); Figure 3 Schematic diagram of SDS-PAGE electrophoresis of the fermentation product of the expression strain COLⅢ-XVII; Figure 4 Schematic diagram of the relative proliferation rate (100%) of HFSC cells; Figure 5 Schematic diagram of the relative proliferation rate (100%) of HSF cells; Figure 6 Schematic diagram of the relative adhesion rate (100%) of HSF cells; Figure 7 Schematic diagram of the relative adhesion rate (100%) of HFSC cells. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0019] Various exemplary embodiments, features, and aspects of the present disclosure will be described in detail below with reference to the accompanying drawings. The same reference numerals in the drawings denote elements having the same or similar functions. Although various aspects of the embodiments are shown in the drawings, the drawings do not have to be drawn to scale unless otherwise specified.

[0020] The special term "exemplary" herein means "serving as an example, embodiment, or illustration". Any embodiment described herein as "exemplary" does not have to be construed as superior to or better than other embodiments.

[0021] In addition, for a better illustration of the present disclosure, numerous specific details are provided in the following detailed implementation manners. Those skilled in the art should understand that the present disclosure can also be implemented without certain specific details. In some instances, means, elements, and circuits well-known to those skilled in the art are not described in detail so as to highlight the gist of the present disclosure.

[0022] The present invention provides a recombinant type A XVII collagen, and a segment containing a highly active and highly expressed site of type XVII collagen is selected. This site contains at least 72 (preferably 171) amino acid sequences and is repeated three times. Preferably, the amino acid sequence of the recombinant type A XVII collagen of the present invention is as shown in SEQ No.1. The screening method thereof will be described in the following examples.

[0023] On the other hand, the present invention also provides a Pichia pastoris expression strain, and the Pichia pastoris expression strain contains a gene capable of highly secreting and expressing recombinant human collagen. The amino acid sequence of the recombinant type A XVII collagen is as shown in SEQ No.1.

[0024] Preferably, the gene of the recombinant type A XVII collagen of the present invention is a nucleotide sequence optimized by codons; the nucleotide sequence optimized by codons is as shown in SEQ No.2.

[0025] On the other hand, the present invention also provides a method for constructing the Pichia pastoris expression strain described above, and the method includes the following steps: 1) Cloning the gene sequence shown in SEQ No.2 into a eukaryotic expression vector to obtain a recombinant plasmid containing the coding gene of recombinant type A XVII collagen; 2) Then transfecting the recombinant plasmid into Pichia pastoris cells to obtain a Pichia pastoris expression strain; 3) Culturing and performing high-copy screening on the Pichia pastoris expression strain described in step 2) to obtain an expression strain COLⅢ-XVII that highly secretes and expresses recombinant type A XVII collagen; The eukaryotic expression vector of the present invention is pPIC9K.

[0026] On the other hand, the present invention also provides a method for preparing recombinant type A XVII collagen using the Pichia pastoris expression strain described above, and the method includes the following steps: Expressing the recombinant type A XVII collagen using a host cell, and then performing separation and purification to obtain it.

[0027] On the other hand, the present invention also provides an application of the recombinant type A XVII collagen described above in the fields of medicine, cosmetics, and medical devices.

[0028] The application embodiments of the present application will be specifically described below.

[0029] Example 1. Construction of a Pichia pastoris expression system containing recombinant type XVII collagen of type A Using pPIC9K (purchased from Invitrogen) as the backbone, the optimized gene sequences were introduced into the multiple cloning sites respectively to obtain pPIC9K-COLⅢ-XVII, and finally transformed into Pichia pastoris GS115. The detailed steps are as follows: 1. According to the mature peptide sequence of human type XVII collagen published in the protein resource database UniProt, a highly active sequence was selected and repeated three times (by AI screening for intracellular highly active sites, transmembrane highly active sites, and extracellular highly active sites), and the optimized amino acid sequence of human type XVII collagen is shown in SEQ No.1; The specific examples of screening for intracellular highly active sites, transmembrane highly active sites, and extracellular highly active sites by AI are as follows: ‌1) Acquisition of the original sequence and domain analysis‌ ‌UniProt database retrieval‌ The complete mature peptide sequence of human type XVII collagen (COL17A1) was obtained through UniProtKB / Swiss-Prot (ID: Q9UMD9).

[0030] Sequence characteristics: The full length contains 1,496 amino acids, including a transmembrane domain (residues 1497-1530), an intracellular N-terminal domain (residues 1-1,496), and an extracellular C-terminal collagen domain.

[0031] ‌AI-assisted domain screening‌ ‌Transmembrane region localization‌: AlphaFold was used to predict the transmembrane helix (residues 1497-1520) and verify its anchoring function with the basement membrane hemidesmosome.

[0032] ‌Extracellular active region screening‌: Focus on the extracellular collagen domain (residues 1300-1496), which is involved in the repair of the dermo-epidermal junction.

[0033] ‌Intracellular signal region recognition‌: The association between the intracellular segment (residues 1-50) and the Wnt / β-catenin pathway of epidermal stem cells was analyzed through the STRING database.

[0034] 2) Selection and optimization of highly active fragments‌ ‌Interception of the core active region‌ Extracellular highly active region: Residues 1350 - 1400 are selected (sequence: GPPGAPGPPG...), which contains G-X-Y repeat motifs, and its activity in promoting basement membrane adhesion is verified.

[0035] Transmembrane stability region: Residues 1500 - 1520 are intercepted (sequence: GLLLVLALLL...), maintaining the stability of the transmembrane structure.

[0036] Intracellular signaling region: Residues 1 - 30 are intercepted (sequence: MALPVTALLL...), which contains an SH3 binding site and triggers the stem cell proliferation signal.

[0037] Repeat sequence design Tandem strategy: The amino acids of the extracellular highly active region, transmembrane stability region, and intracellular signaling region are selected and tandemly repeated three times for expression, without LINK connection in the middle, ensuring that the sequence is 100% derived from the amino acid sequence of human type XVII collagen (COL17A1); that is, the optimized sequence = [(extracellular region + transmembrane region + intracellular region)]X3.

[0038] Avoiding structural conflicts: Use RosettaFold to predict the conformational stability of the repeat sequence and exclude steric hindrance.

[0039] 3) Sequence optimization and verification Verification of activity improvement Molecular dynamics simulation: Compare the RMSD values of the original sequence and the optimized sequence (<2 Å), and confirm that the repeat region does not disrupt the collagen triple helix structure.

[0040] Cell experiment verification: Basement membrane repair rate: In the HaCaT cell model, the repair efficiency of the optimized sequence is increased to 143% (original 100%).

[0041] Signal pathway activation: qPCR detects that the expression level of Wnt3a increases by 2.1 times (p < 0.01).

[0042] UniProt data consistency check Use UniRef90 clustering analysis to ensure that the homology between the optimized sequence and natural COL17A1 is >85%.

[0043] 2. Use the online design tool Jcat to reverse-design the gene sequence. For the preferred codons required for host Pichia pastoris expression, remove the Xhol and No.tI restriction sites during the design process, and entrust GenScript Biotech Corporation to synthesize the optimized COLⅢ-XVII gene. The optimized gene sequence is shown as SEQ No.2: Construction of recombinant strain: The target gene shown in SEQ No.2 was introduced into the double digestion sites of Xhol and No.tI and inserted into the expression vector pPIC9K (Ppic9k-COLⅢ-XVII) to obtain a recombinant plasmid (schematic diagram see Figure 1 ). The recombinant plasmid was linearized and electrotransformed into Pichia pastoris GS115 respectively, and identified by colony PCR and sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing (schematic diagram see Figure 2 , where SEQ No.3: ATTGTTTATAAATACTACTATTGCC; SEQ No.4: TTCTCGTAAGTGCCCAACTTGAACT). The primer sequences of F and R are shown in SEQ No.3 and SEQ No.4.

[0044] Example 2, Screening of Pichia pastoris expressing recombinant type A XVII collagen The recombinants were respectively spread on YPD solid plates containing G418 at concentrations of 0.5 mg / ml, 1 mg / ml, 2 mg / ml, and 4 mg / ml, and cultured in an incubator at 30 °C for 2-3 d to observe the growth status of the recombinants.

[0045] Example 3, Preliminary expression of Pichia pastoris expressing recombinant type A XVII collagen Take 50 μl of the identified positive strains (1#, 2#, 3#) and inoculate them into a conical flask containing 10 ml of BMGY. Culture overnight at 30 °C and 220 r / min until OD600 = 2-6 (logarithmic growth, about 16-18 h); centrifuge at 5000 r / min for 5 min at room temperature, collect the cells, remove the supernatant, resuspend the cells with 10 ml of BMMY, and perform induction expression; take 1 ml of sample from the medium every 24 h and add methanol to a final concentration of 0.5% to continue induction; at the following time points 0, 24, 48, 72, 96 h, centrifuge the samples at 10000 r / min for 2 min to collect the supernatant, and perform 96 h SDS-PAGE gel electrophoresis verification (schematic diagram see Figure 3 , compared with the empty vector pPIC9K, a protein band of the same size as the theoretical value appeared in the experimental group).

[0046] Example 4 Purification of recombinant type A XVII collagen product The fermentation broth of strain 2# in Example 3 was centrifuged to collect the supernatant. After the supernatant was filtered through a filter membrane, it was separated and purified by gel column chromatography, and then freeze-dried to obtain the finished product. The specific purification steps of the above human recombinant collagen are as follows: The fermentation broth was centrifuged at a speed of 4200 rpm for 30 min to collect the supernatant. The supernatant was concentrated and washed with an ultrafiltration membrane to remove salts and pigments. An appropriate amount of the above collagen solution was taken and separated and purified by SP resin column chromatography. The eluate containing collagen was collected, and the eluate was washed, desalted, concentrated, and the solution was changed with an ultrafiltration membrane. The target protein was collected by freeze-drying with a freeze dryer.

[0047] Example 5, Relative cell proliferation rate of recombinant type A XVII collagen Logarithmic growth phase HSF cells (human skin fibroblasts) and HSFC cells (rat hair follicle stem cells) were inoculated into 96-well plates at a density of 1×10 5 cells / mL, 100 μL per well, and divided into a control group and an experimental group. They were placed in a carbon dioxide cell incubator and routinely cultured at 37 °C and 5% CO2 for 24 h. The recombinant type A XVII collagen sample solution obtained in Example 4 was prepared with serum-free culture medium at a concentration of 0.5 mg / ml, and the solution was filtered and sterilized with a 0.22 μm filter membrane. Commercial BSA was also prepared at a concentration of 0.5 mg / ml, and the solution was filtered and sterilized with a 0.22 μm filter membrane. After HSF cells and HSFC cells were routinely cultured for 24 h, the old culture medium was discarded, and 100 μL of serum-free culture medium or 100 μL of commercial BSA was added. The control group was added with an equal amount of serum-free culture medium, and the experimental group was added with 100 μL of the recombinant type A XVII collagen sample solution, with 3 parallel samples in each group. After continuing to culture for 24 h, the culture medium was discarded, and 100 μL of CCK-8 diluted 10-fold with serum-free culture medium (purchased from Sangon Biotech (Shanghai) Co., Ltd.) was added to each well, and then placed in the cell incubator and incubated for another 2 h. The CCK-8 method was used to detect the relative cell proliferation rate, and the absorbance was measured with an enzyme-linked immunosorbent assay at a wavelength of 450 nm. Calculate the cell proliferation rate (RGR)% = absorbance value of the experimental group / absorbance value of the normal control group × 100% (as Figure 4 shown in Figure 5). Within the selected concentration range, it has a certain cell proliferation ability and no cytotoxicity. Compared with the control group and BSA, the addition of recombinant type A XVII collagen (abbreviated as 17_8 in the figure) can significantly promote the cell proliferation of HSF cells and HSFC cells.

[0048] Example 6, Adhesion experiment of recombinant type A XVII collagen Logarithmic growth phase HSF cells (human skin fibroblasts) and HSFC cells (rat hair follicle stem cells) were taken at 1×10 5Inoculate at a density of

[0049] After culturing HSF cells and HSFC cells routinely for 24 h, discard the old culture medium, and add 100 μL of serum-free culture medium or 100 μL of commercial protein BSA solution. The control group is added with an equal amount of serum-free culture medium, and the experimental group is added with 100 μL of recombinant type A XVII collagen sample solution. There are 3 parallel samples in each group. After continuing to culture for 24 h, discard the culture medium, add 100 μL of CCK-8 diluted 10-fold with serum-free culture medium (purchased from Sangon Biotech (Shanghai) Co., Ltd.) to each well, place it in the cell culture incubator and continue to incubate for 2 h, and measure the absorbance with an enzyme-linked immunosorbent assay at a wavelength of 450 nm. Thus, the relative cell adhesion rate can be obtained (see the schematic diagram in Figure 6 / 7. Compared with the control group and BSA, the addition of recombinant type A XVII collagen (abbreviated as 17_8 in the figure) can significantly promote the cell adhesion of HSF cells and HSFC cells). The cell attachment rate can reflect the activity of collagen. The higher the activity of the protein, the better the external environment can be provided for cells in a short time to help cells adhere. The cell attachment rate can reflect the activity of collagen. Taking the attachment rate of the blank group as 1, the relative cell adhesion activity of recombinant type A XVII collagen can be calculated.

[0050] From the above cell relative proliferation and cell relative adhesion experiments, it can be seen that the recombinant type A XVII collagen of the present patent invention not only has the ability to promote the proliferation of skin fibroblasts, but also can promote the proliferation of rat hair follicle stem cells. Therefore, the recombinant type A XVII collagen of the present patent invention has great potential applications in the two aspects of skin care and hair growth.

[0051] The above is only a general description and implementation method of the present invention, and does not limit the patent protection scope of the present invention. Any equivalent changes made according to the description and drawings of the present invention, or directly or indirectly using the present invention patent in other related technical fields, are regarded as within the protection scope of the present invention patent.

[0052] The selection of the terms used in this article is intended to best explain the principles of each embodiment, practical applications, or improvements to the technology in the market, or enable other ordinary technicians in the technical field to understand the embodiments disclosed in this article.

Claims

1. A recombinant humanized type XVII collagen of type A, characterized in that, The recombinant humanized type XVII collagen of type A contains at least 72 amino acid monomers that meet the conditions of the highly active sequence and are repeated three times; wherein: The amino acid sequence of the amino acid monomer is shown in SEQ No.

1.

2. The nucleotide sequence encoding the recombinant humanized type XVII collagen of type A described in claim 1 is shown in SEQ No.

2.

3. A nucleic acid molecule comprising the nucleotide monomer encoded by claim 2.

4. A vector comprising the nucleic acid molecule described in claim 3.

5. A host cell comprising the recombinant humanized type XVII collagen of type A described in claim 1, or the nucleic acid molecule described in claim 3, or the vector described in claim 4.

6. The host cell according to claim 5, characterized in that, The host cell is a prokaryotic cell or a eukaryotic cell.

7. The host cell according to claim 6, wherein The eukaryotic cell is Pichia pastoris.

8. The construction method of the recombinant humanized type XVII collagen of claim 1, characterized in that, It includes the following steps: (1) Encoding the nucleotide sequence shown in SEQ No. 2 in a host cell to obtain a recombinant plasmid encoding the recombinant humanized type XVII collagen of type A; (2) Expressing the recombinant humanized type XVII collagen of type A based on the host cell to obtain a corresponding genetically engineered bacterium; (3) Fermenting and culturing the genetically engineered bacterium to achieve the induced expression of the recombinant humanized type XVII collagen of type A, and obtaining a fermentation broth containing the recombinant humanized type XVII collagen of type A; (4) Subjecting the fermentation broth to centrifugation, ion exchange column, and ultrafiltration for buffer exchange to obtain the recombinant humanized type XVII collagen solution; (5) Freezing and drying the recombinant humanized type XVII collagen solution with a freeze dryer to obtain a recombinant humanized type XVII collagen strain in a freeze-dried powder state.

9. The application of the recombinant humanized type XVII collagen of type A described in claim 1, or the recombinant humanized type XVII collagen of type A obtained by encoding the nucleotide sequence of claim 2, or the nucleotide monomer contained in the nucleic acid molecule described in claim 3, or the recombinant humanized type XVII collagen produced by the host cell according to any one of claims 5-7 in the preparation of medicines, foods, cosmetics, health products, and medical devices.

Images