Gene edited hematopoietic stem cell and combined application of gene edited hematopoietic stem cell and CAR-T cell

Abstract

Provided herein are methods of altering antigen epitopes of cells and cells prepared using the methods. The invention further provides a method and a pharmaceutical composition for treating tumors through combined application of the cells and CAR-T cells or antibody drugs. The cells with the changed antigen epitopes are not killed by CAR-T or antibody drugs and can be input into the body of a patient, so that the side effects of CAR-T products or antibody drugs in tumor treatment are relieved.

Description

[0001] This application is a divisional application of the invention patent application with the application date of April 27, 2022, application number 202280003215.1, and invention title "A Genetically Edited Hematopoietic Stem Cell and Its Combined Application with CAR-T Cells". Technical Field

[0002] The present invention belongs to the technical field of tumor treatment, and specifically relates to the transplantation of genetically edited hematopoietic stem cells and the combined application of chimeric antigen receptor T cells or antibody drugs. In particular, it relates to a hematopoietic stem cell or progenitor cell that is resistant to the action of chimeric antigen receptor T cells, its preparation method, and the application of the combined CAR-T cells or antibody drugs in the treatment of tumors. Background Art

[0003] Hematopoietic stem cells (HSCs) are a type of hematopoietic tissue stem cells with self-renewal and multi-lineage differentiation potential. They generate various hematopoietic progenitor cells (such as lymphoid progenitor cells and myeloid progenitor cells, etc.) through directed differentiation, and then proliferate and differentiate massively into various mature functional blood cells, thereby maintaining the hematopoietic homeostasis of the whole body. In the field of disease treatment, the method of using healthy autologous or allogeneic HSCs to replace the patient's HSCs and reconstruct the patient's hematopoietic function and immune function to treat diseases is called hematopoietic stem cell transplantation. After more than sixty years of development and application, more than one million patients have received and benefited from hematopoietic stem cell transplantation. As the first regenerative method to enter clinical practice, hematopoietic stem cell transplantation has had a profound impact on the development of clinical medicine related to cell therapy.

[0004] However, past research and clinical experiments have proved that the popularization and expansion of hematopoietic stem cell transplantation in clinical applications are still greatly restricted, facing two major problems that need to be solved urgently: tumor recurrence and transplantation complications. For autologous transplantation recurrence patients, it is mainly because the cancer cells remaining in the bone marrow or peripheral blood of malignant tumor patients contaminate the autologous stem cells obtained, resulting in the recurrence of malignant diseases. For patients undergoing allogeneic hematopoietic stem cell transplantation, the probability of developing graft-versus-host disease (GVHD) is very high. Among them, the incidence of acute GVHD is 20%-60%, the incidence of chronic GVHD is about 50%, and the incidence of lethal GVHD is 5%-20%. Severe GVHD is very likely to endanger life and requires prompt treatment once it occurs. In addition, early engraftment after hematopoietic stem cell transplantation is crucial for post-transplantation and long-term immune reconstitution. The pre-transplant conditioning that damages the recipient's bone marrow microenvironment will have a "bystander effect" on the transplanted donor hematopoietic stem cells, resulting in poor engraftment of the donor hematopoietic stem cells and a decline in their self-renewal ability, leading to poor transplantation efficacy.

[0005] With the continuous breakthroughs in science and technology, many major changes have taken place in the field of cell therapy. The modern cancer immunotherapy methods have benefited to a certain extent from the development of hematopoietic stem cell transplantation. At the same time, there are great prospects in improving the applicability, safety and efficacy of hematopoietic stem cell transplantation, and there are also many new applicable fields.

[0006] Chimeric antigen receptor T cell (CAR-T) therapy is an immunotherapy technology that achieves tumor-targeted killing through T cell gene modification. By expressing receptors that can recognize specific antigens on the surface of T cells, the edited CAR-T cells can specifically eliminate tumor cells. Compared with traditional transplantation techniques, currently available CAR-T products are all autologous in origin, and these CAR-T cells will not cause the occurrence of GVHD. Multiple clinical trials have confirmed that it has good efficacy for patients with relapsed / refractory hematological malignancies.

[0007] However, the lack of specific tumor surface antigens has always been one of the difficulties in antigen-specific immunotherapy using CAR-T. For example, CAR-T cells targeting the CD33 antigen will kill normal myeloid progenitor cells and myeloid cells in the body during the treatment of acute myeloid leukemia, and CAR-T cells targeting the CD19 antigen cannot distinguish between malignant tumor B cells and normal B cells. Therefore, patients in these treatments must endure immune deficiencies caused by myeloid dysplasia (CD33) or long-term B cell depletion (CD19), and their quality of life is greatly affected. In addition, the survival time of CAR-T cells in the body is not as persistent as that of fully engrafted donor cells in transplantation. Once the killing effect of CAR-T cells on tumor cells is lost, the primary disease may relapse.

[0008] Combining the respective advantages and disadvantages of hematopoietic stem cell transplantation and CAR-T therapy may make up for each other's weaknesses. Experimental data show that using CAR-T therapy as part of the conditioning treatment before allogeneic hematopoietic stem cell transplantation can reduce the toxicity of high-dose chemotherapy and have a positive impact on the quality of life. For relapsed / refractory patients, achieving complete remission through upfront CAR-T therapy allows for a smooth transition to transplantation in the best condition and achieves the best therapeutic effect. The combination of hematopoietic stem cell transplantation and CAR-T therapy can improve anti-tumor targeting, reduce the recurrence rate, adverse reactions and the incidence of GVHD. CAR-T therapy for patients with relapse after transplantation has good efficacy and safety. Therefore, the combined application of CAR-T therapy at various stages of transplantation can achieve complementarity or synergy, optimize the therapeutic effect, expand the range of applicable patients, and is expected to become a new treatment strategy worthy of promotion.

[0009] CD33 is a member of the sialic acid-binding immunoglobulin-like lectin family and is expressed in all myeloid cells that differentiate backward from myeloid progenitor cells (CMP). Therefore, CD33 is also a classic target in the diagnosis and treatment of AML (acute myelocytic leukemia). However, when using CAR-T and ADC drugs targeting CD33 to treat AML patients, severe side effects will occur, and normal myeloid cells and myeloid progenitor cells will be killed by the targeting drugs. Currently, researchers use the CRISPR-Cas9 system to knockout the CD33 gene in human-derived hematopoietic stem cells. The hematopoietic stem cells after CD33 knockout can differentiate into myeloid cells and perform their functions, and at the same time, they will not be recognized and killed by anti-CD33 CAR-T cells.

[0010] Therefore, the modification of target antigens of hematopoietic stem cells by gene editing technology and the combination with corresponding CAR-T products provide a new idea and mode for cell therapy. Summary of the Invention

[0011] Aiming at the deficiencies of the existing technology, the purpose of the present invention is to provide a hematopoietic stem cell or progenitor cell that is immune to the action of chimeric antigen receptor T cells and its application. In the present invention, the autologous hematopoietic stem cells of the patient are modified, and the epitopes of the target antigens are modified by gene editing technology, so that the modified hematopoietic stem cells are not killed by CAR-T cells or antibody drugs, and then transplanted back into the patient's body through hematopoietic stem cell transplantation to relieve the side effects of CAR-T products or antibody drugs in tumor treatment.

[0012] For this purpose, the present invention provides the following technical solutions.

[0013] In one aspect, the present invention provides a cell having a cell surface protein, wherein the cell surface protein is modified to have an antigen epitope change, and the antigen epitope change enables the cell to be immune to the killing of CAR-T or antibody drugs.

[0014] In some embodiments, the cell is a hematopoietic stem cell or its differentiated cell. In some specific embodiments, the cell is a lymphoid progenitor cell, a myeloid progenitor cell, a lymphoid cell or a myeloid cell.

[0015] In some embodiments, the cell surface protein is a lymphoid cell-specific cell surface protein or a myeloid cell-specific cell surface protein.

[0016] In some embodiments, the antigen epitope change of the cell is caused by a single nucleotide mutation, a splicing site mutation and / or a nucleotide fragment substitution, insertion and / or deletion in the coding gene of the cell surface protein.

[0017] In some embodiments, exon deletions are present upon expression of the cell surface protein.

[0018] In some embodiments, the cell surface protein is CD33, CD19, or BCMA.

[0019] In some embodiments, the cell surface protein is CD33, which lacks an amino acid fragment encoded by the second exon in the CD33 gene.

[0020] In some embodiments, the cell surface protein is CD33, and one or any combination of the following features is present in the CD33 gene of the cell: 1) the rs12459419 locus is nucleotide T; 2) the 3'ss site before the second exon sequence is AA or CT; and 3) the TTTCT within the second exon is replaced by AATCC.

[0021] In another aspect, provided herein is the use of the cells described above in combination with CAR-T or antibody drugs in the preparation of anti-tumor drugs.

[0022] In some embodiments, the CAR-T or antibody drug can target the cell surface protein of tumor cells to kill the tumor cells, and the cell surface protein expressed by the cell is modified to have an antigenic epitope change, and the antigenic epitope change enables the cell to resist killing by the CAR-T or antibody drug.

[0023] In some embodiments, the tumor is a hematological tumor, preferably AML.

[0024] In another aspect, provided herein is a method for preparing cells, wherein the cell surface protein of the cells has an antigenic epitope change capable of resisting killing by CAR-T or antibody drugs, and the method includes gene editing of the coding gene of the cell surface protein.

[0025] In some embodiments, the gene editing includes introducing single nucleotide mutations, splicing site mutations, and / or nucleotide fragment substitutions, insertions, and / or deletions into the coding gene.

[0026] In some embodiments, the gene editing is carried out by introducing a CRISPR gene editing system into the cell.

[0027] In some embodiments, the cell is a hematopoietic stem cell or its differentiated cells. In some specific embodiments, the cell is a lymphoid progenitor cell, a myeloid progenitor cell, a lymphoid cell, or a myeloid cell.

[0028] In some embodiments, the cell surface protein is a lymphoid cell-specific cell surface protein or a myeloid cell-specific cell surface protein.

[0029] In some embodiments, exon deletions are present upon expression of the cell surface protein.

[0030] In some embodiments, the cell surface protein is CD33, CD19, or BCMA.

[0031] In some embodiments, the cell surface protein is CD33, and the gene editing includes any one or any combination of the following: 1) mutating the nucleotide C at the rs12459419 locus to T; 2) mutating the nucleotides AG at the 3'ss locus before the second exon sequence to AA or CT; and 3) mutating the nucleotides TTTCT within the second exon to AATCC.

[0032] In some embodiments, the CRISPR gene editing system for mutating the nucleotide C at the rs12459419 locus to T includes sgRNAs with target sequences of SEQ ID NO: 10, 11, 12, 14, or 15.

[0033] In some embodiments, the CRISPR gene editing system for mutating the nucleotide C at the rs12459419 locus to nucleotide T includes an sgRNA with a target sequence of SEQ ID NO: 10, 11, or 12 and an ssDNA containing SEQ ID NO: 21; an sgRNA with a target sequence of SEQ ID NO: 14 and an ssDNA containing SEQ ID NO: 23; or an sgRNA with a target sequence of SEQ ID NO: 15 and an ssDNA containing SEQ ID NO: 24.

[0034] In some embodiments, the CRISPR gene editing system for mutating the nucleotides AG at the 3'ss locus before the second exon sequence to AA includes sgRNAs with target sequences of SEQ ID NO: 13 or 16.

[0035] In some embodiments, the CRISPR gene editing system for mutating the nucleotides AG at the 3'ss locus before the second exon sequence to AA includes sgRNAs with target sequences of SEQ ID NO: 13 or 16 and a base editor cytosine editor, and the base editor cytosine editor is preferably A3A-CBE3.

[0036] In some embodiments, the CRISPR gene editing system for simultaneously mutating the nucleotide C at the rs12459419 locus to T and mutating the nucleotides AG at the 3'ss locus before the second exon sequence to CT includes sgRNAs with target sequences of SEQ ID NO: 10 or 14.

[0037] In some embodiments, the CRISPR gene editing system that simultaneously mutates the nucleotide C at the rs12459419 locus to T and mutates the nucleotides AG at the 3'ss locus before the second exon sequence to CT includes an sgRNA with a target sequence of SEQ ID NO: 10 and an ssDNA containing SEQ ID NO: 22, or an sgRNA with a target sequence of SEQ ID NO: 14 and an ssDNA containing SEQ ID NO: 27.

[0038] In some embodiments, the CRISPR gene editing system that mutates the nucleotides TTTCT within the second exon to AATCC includes an sgRNA with a target sequence containing SEQ ID NO: 18 or 20.

[0039] In some embodiments, the CRISPR gene editing system that mutates the nucleotides TTTCT within the second exon to AATCC includes an sgRNA with a target sequence containing SEQ ID NO: 18 or 20 and an ssDNA containing SEQ ID NO: 26.

[0040] In another aspect, the present disclosure provides a method for eliminating or reducing tumor cells in a subject, which includes administering to the subject a CAR-T or antibody-based drug capable of killing the tumor cells and replenishing the subject with normal cells, wherein the CAR-T or antibody-based drug targets a cell surface protein of the tumor cells, and the cell surface protein expressed by the normal cells is modified to have an altered epitope, and the altered epitope enables the normal cells to resist killing by the CAR-T or antibody-based drug.

[0041] In some embodiments, the tumor cells are hematological tumor cells, and the normal cells are blood cells or hematopoietic stem cells or progenitor cells capable of differentiating into blood cells.

[0042] In some embodiments, the cell surface protein is a lymphoid cell-specific cell surface protein or a myeloid cell-specific cell surface protein.

[0043] In some embodiments, the altered epitope of the normal cells is caused by a single nucleotide mutation, a splice site mutation, and / or a nucleotide fragment substitution, insertion, and / or deletion in the coding gene of the cell surface protein.

[0044] In some embodiments, the cell surface protein of the normal cells has an exon deletion upon expression.

[0045] In some embodiments, the cell surface protein is CD33, CD19, or BCMA.

[0046] In some embodiments, the cell surface protein is CD33, which lacks the amino acid fragment encoded by the second exon in the CD33 gene.

[0047] In some embodiments, the cell surface protein is CD33, and one or any combination of the following characteristics exist in its encoding gene: 1) the nucleotide at the rs12459419 locus is T; 2) the 3'ss site before the second exon sequence is AA or CT; and 3) the TTTCT within the second exon is replaced by AATCC.

[0048] In some embodiments, the tumor cells are AML cells.

[0049] On the other hand, the present disclosure provides a pharmaceutical composition or combination, which comprises a CAR-T or an antibody-based drug and normal cells, wherein the CAR-T or the antibody-based drug can target the cell surface protein of tumor cells to kill the tumor cells, and the cell surface protein expressed by the normal cells is modified to have an altered antigenic epitope, and the altered antigenic epitope enables the normal cells to resist killing by the CAR-T or the antibody-based drug.

[0050] In some embodiments, the tumor cells are hematological tumor cells, and the normal cells are blood cells or hematopoietic stem cells or progenitor cells that can differentiate into blood cells.

[0051] In some embodiments, the cell surface protein is a lymphoid cell-specific cell surface protein or a myeloid cell-specific cell surface protein.

[0052] In some embodiments, the alteration of the antigenic epitope of the normal cells is caused by the presence of single nucleotide mutations, splicing site mutations, and / or nucleotide fragment substitutions, insertions, and / or deletions in the nucleotide sequence encoding the cell surface protein.

[0053] In some embodiments, the cell surface protein of the normal cells has an exon deletion during expression.

[0054] In some embodiments, the cell surface protein is CD33, CD19, or BCMA.

[0055] In some embodiments, the cell surface protein is CD33, which lacks the amino acid fragment encoded by the second exon in the CD33 gene.

[0056] In some embodiments, the cell surface protein is CD33, and one or any combination of the following characteristics exists in its encoding gene: 1) the nucleotide at the rs12459419 locus is T; 2) the 3'ss locus before the second exon sequence is AA or CT; and 3) the TTTCT within the second exon is replaced by AATCC.

[0057] In some embodiments, the tumor cells are AML cells.

[0058] The cells modified herein to have altered antigenic epitopes can be used in combination with CAR-T cells or antibody drugs for tumor treatment. The cells with altered antigenic epitopes are not killed by CAR-T or antibody drugs and can be infused into patients to alleviate the side effects of CAR-T products or antibody drugs in tumor treatment. Description of the Drawings

[0059] Figure 1 It is a diagram showing the analysis results of the CD33 exon2 SNP genotypes among different cell lines in Example 1.

[0060] Figure 2 It is a gel electrophoresis diagram of the alternative splicing expression of CD33 exon2 in different cell lines in Example 1.

[0061] Figure 3A It is a schematic diagram of the probe primer design across CD33 exon2 in the RT-qPCR experiment in Example 1.

[0062] Figure 3B It is a diagram showing the RT-qPCR results of detecting the deletion of CD33 exon2 in different cell lines in Example 1.

[0063] Figure 4A It is a comparative diagram of the flow cytometry results of the expression of CD33 exon2 and total protein in different cell lines in Example 1.

[0064] Figure 4B It is a statistical chart of the mean fluorescence intensity of CD33 exon2 and total protein in different cell lines in Example 1.

[0065] Figure 5 It is a bar chart showing the GFP positive rate and cell viability detected by FACS flow cytometry in different cell lines in Example 2, where Figure I is the GFP positive rate and Figure II is the cell viability.

[0066] Figure 6A It is a schematic diagram of the mutation status of the G base after mutating the CD33 exon2 3'ss AG site using the single-base cytosine editor A3A-CBE3 in Example 2.

[0067] Figure 6B It is a bar graph obtained after analyzing the efficiency of single-base mutation at 3'ss using EditR in Example 2.

[0068] Figure 6C It is a comparison graph of the E13 / E2 ratio detected by RT-qPCR in the K562 cell line in Example 2.

[0069] Figure 6D It is a comparison graph of the E13 / E2 ratio detected by RT-qPCR in the HL60 cell line in Example 2.

[0070] Figure 7 It is an analysis graph of the mutation status obtained after mutating the SNP site and 3'ss site by the method of electrotransferring RNP combined with ssDNA into cells in Example 3.

[0071] Figure 8A It is an RT-qPCR result graph of E13 / E2 after mutating the SNP site and 3'ss site in Example 3.

[0072] Figure 8B It is a flow cytometry antibody staining result graph after mutating the SNP site and 3'ss site in Example 3.

[0073] Figure 9 It is an analysis graph of the mutation status of the PE+ and PE- cells sorted by Tyto flow cytometry and the cells obtained after sorting in Example 4, where Figure I is the Tyto flow cytometry sorting graph and Figure II is the analysis graph of the mutation status.

[0074] Figure 10A It is a sequence comparison graph of CD33 and DNA with high similarity to CD33 in Example 5.

[0075] Figure 10B It is a schematic diagram of the editing situation mediated by sg4 in the CD33 and off-target regions in Example 5.

[0076] Figure 11A It is an analysis graph of the sequence obtained after mutating the SNP site in CD33 exon2 by sg4-14 and sg4-15 in Example 5.

[0077] Figure 11B It is a result graph of the expression level of the V region (P67.6) encoded by CD33 exon2 in the cells after mutation detected by flow cytometry in Example 5.

[0078] Figure 12A It is a sequence analysis graph of the AATCC mutation mediated by Sg3 and sg10 in Example 6.

[0079] Figure 12BIt is a graph showing the expression level results of the V region (P67.6) encoded by CD33 exon2 in cells after mutation detected by flow cytometry in Example 6.

[0080] Figure 13 It is a graph showing the proportion of CAR-positive cells in CD33 CART cells detected by flow cytometry in Example 7.

[0081] Figure 14A It is a graph showing the flow cytometry detection results obtained after co-incubating CD33 CAR-T cells and edited NB4 cells for 0 hours in Example 7.

[0082] Figure 14B It is a graph showing the detection results obtained after simultaneously flow cytometric staining with CD33 P67.6 and HIM-3-4 antibodies for 0 hours in Example 7.

[0083] Figure 14C It is a graph showing the flow cytometry detection results obtained after co-incubating CD33 CAR-T cells and edited NB4 cells for 96 hours in Example 7.

[0084] Figure 14D It is a graph showing the detection results obtained after simultaneously flow cytometric staining with CD33 P67.6 and HIM-3-4 antibodies for 96 hours in Example 7.

[0085] Figure 14E It is a graph showing the proportion curves of mutant target cells at 0 hours, 22 hours, 44 hours, 68 hours, and 96 hours after co-incubating different cell lines with CD33 CAR-T cells in Example 7.

[0086] Figure 15A It is a sequence analysis graph of the cells obtained after electroporating the RNP complex of sg10 and cas9 into HSC cells in Example 8.

[0087] Figure 15B It is a graph showing the detection results obtained after simultaneously flow cytometric staining with CD33 P67.6 and HIM-3-4 antibodies in Example 8.

[0088] Figure 15C It is a graph showing the proportion of CD14-positive cells detected on days 1, 5, 9, and 14 of differentiation after adding a medium that induces in vitro myeloid monocyte differentiation to HSC cells in Example 8.

[0089] Figure 15D It is a graph showing the content curve of CD14-positive cells at days 1, 5, 9, and 14 of differentiation in Example 8.

[0090] Figure 16 It is a schematic diagram of the deletion of CD33 exon 2 caused by a single nucleotide change. Detailed implementation mode

[0091] Unless otherwise specified, all technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art. For the purpose of facilitating the understanding of the technical solutions provided herein, some technical terms are briefly described below.

[0092] "Cell surface protein" as used herein refers to a protein that is at least partially located on the cell surface after expression, which is usually a membrane protein with some amino acid sequences embedded in the cell membrane, or can also be an extracellular component attached to the cell surface. For cells derived from different tissues or organs, they usually express their respective specific cell surface proteins, that is, tissue-specific or cell-specific proteins. These cell surface proteins can also increase or decrease in expression as the cells differentiate or mature. In some cases, this article focuses on blood cell-specific cell surface proteins, such as proteins mainly expressed on the surface of lymphoid cells (such as T cells or B cells) or myeloid cells (such as various granulocytes, monocytes, etc.), for example, cell surface markers such as CD33, CD19, CD21, BCMA, CD22, CD24, etc. In tumor cells, the expression levels of some cell surface proteins are upregulated, or certain tumor-specific surface proteins are expressed, which can serve as targets for drug binding or action.

[0093] "Chimeric antigen receptor (CAR)", also known as chimeric T cell receptor and chimeric immunoreceptor, is an engineered membrane protein receptor molecule that can confer desired specificity to immune effector cells, such as the ability to bind to cell surface proteins (such as tumor antigens). A chimeric antigen receptor typically consists of an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In some cases, the antigen-binding domain is a scFv sequence responsible for recognizing and binding to a specific antigen. The intracellular signaling domain usually includes an immunoreceptor tyrosine-based activation motif (ITAM), such as the signaling domain derived from the CD3ε molecule, which is responsible for activating immune effector cells to produce a killing effect. In addition, the chimeric antigen receptor may also include a signal peptide at the amino terminus responsible for intracellular localization of the nascent protein, and a hinge region between the antigen-binding domain and the transmembrane domain. In addition to the signaling domain, the intracellular signaling domain may also include a co-stimulatory domain derived from, for example, the 4-1BB or CD28 molecule. Accordingly, T cells expressing CAR are simply referred to as CAR-T. CAR-T uses the CAR expressed on its cell surface to recognize target cells and, after being activated by the target cells, produces a killing response against the target cells. The general process of treating a subject (such as a cancer patient) with CAR-T cells is as follows: collecting peripheral blood mononuclear cells (PBMCs) from the subject, isolating and culturing T cells, introducing the CAR-encoding nucleic acid sequence by lentiviral transduction, continuing to culture and collecting CAR+ cells, and reinfusing the CAR+ cells into the subject. Those skilled in the art know that, in some cases, NK cells can be used instead of T cells to carry out this process. Therefore, when referring to CAR-T, it may also cover NK cells expressing CAR as appropriate.

[0094] "Antibody-based drugs" as used herein refer to antibodies or antibody-drug conjugates (ADCs) that can bind to cell surface proteins, thereby altering the activity of cells expressing the cell surface proteins. For example, when an antibody molecule binds to a cell surface protein (such as a receptor), it may cause the cell activity to be inhibited, growth to stagnate or death, or, because the antibody binds to the cell surface protein, the ligand of the cell surface protein cannot bind normally, thereby causing the cell activity to be inhibited, growth to stagnate or death. Another example is that when an antibody molecule is conjugated to a cytotoxic agent through a degradable linker, the cytotoxic agent can be targeted to cells expressing the antigen molecule by the antibody specifically recognizing its corresponding antigen molecule, resulting in cell killing.

[0095] "Epitope" as used herein refers to the recognition and binding site of the corresponding antibody. An epitope can be a continuous amino acid sequence or a three-dimensional structure formed by discontinuous amino acids, which are usually located on the surface of a protein molecule. An antibody molecule binds to an epitope through the antigen-binding site formed by its heavy-chain variable region and light-chain variable region. The antigen-binding domain in a CAR molecule usually includes an antigen-binding site in the form of scFv, which can recognize an epitope on a cell surface protein on a target cell. An epitope change is at least an insertion, deletion, and / or substitution of one or more amino acids that make up the epitope. In some cases, an epitope change is a continuous amino acid deletion in a cell surface protein, such as caused by exon deletion due to alternative splicing of a precursor mRNA molecule. When the epitope of a cell surface protein on a target cell changes, an antibody molecule that recognizes the epitope will lose or weaken its binding ability. In such a case, the corresponding CAR-T, which includes the light-chain variable region and heavy-chain variable region (for a single-domain antibody, only the heavy-chain variable region) from the antibody molecule, will also lose or weaken its target cell killing ability, that is, the target cell has acquired the property of "resistance to CAR-T killing". In a preferred embodiment, such an epitope change is only for obtaining the property of resistance to CAR-T killing against a specific CAR-T without affecting the normal function of the cell surface protein.

[0096] "Single nucleotide mutation" as used herein refers to a single nucleotide change in the editing gene of a cell surface protein, including insertion, deletion, or substitution. This single nucleotide change will cause a change in the amino acid sequence of the expressed cell surface protein, or if the single amino acid change occurs in a sequence related to controlling RNA splicing (such as exon splicing enhancer, intron splicing enhancer, 3'ss or 5'ss), a splicing error will occur, resulting in a change in the amino acid sequence. These amino acid sequence changes can all cause the epitope to change, thereby enabling the cell expressing the cell surface protein to acquire the property of resistance to CAR-T killing.

[0097] "Splicing site mutation" as used herein refers to a mutation related to the splicing of precursor RNA (pre-RNA). The mutation site can be located, for example, in an exon splicing enhancer, an intron splicing enhancer, 3'ss or 5'ss, a branch point, and other sequences, as long as they can cause a change in the amino acid sequence of the finally produced protein. In some cases, a splicing site mutation can cause the coding sequence of at least one exon not to appear in the synthesized protein. In a specific embodiment, when a SNP site (rs12459419) in the second exon of the CD33 gene is T, it can cause the second exon to be deleted (see Figure 16 ).

[0098] The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) gene editing technology is a newly emerged RNA-guided technology for DNA editing of target genes by Cas nucleases. The CRISPR gene editing system used in this technology includes Cas nucleases and guide RNAs (single-guide RNAs, sgRNAs), and may also include ssDNA as a repair template as needed. The sgRNA can bind to the Cas nuclease, and some of its sequences can be complementary to some of the sequences of the target gene. With the recognition of the sgRNA, the Cas nuclease can form single-stranded or double-stranded nicks at specific sites of the target gene. Cells usually repair the broken strands by two ways, which are homology-directed repair (HDR) and non-homologous end joining (NHEJ). When providing a repair template to the cells, the cells can repair the nicks according to the repair template. If mutant nucleotides are added to the repair template (ssDNA), mutations expected by technicians can be generated after homology-directed repair, achieving the purpose of gene editing. The NHEJ repair mechanism without providing a repair template may generate various mutant products, and these mutant products can also be screened to obtain the mutant products expected by technicians. Recently, various site-directed base editors have been developed on the above CRISPR gene editing system, such as CBE, ABE and their various improved variants, etc. These base editors utilize the fusion proteins formed by modified Cas enzymes and various deaminases to form nucleotide-directed changes at specific sites under the guidance of sgRNAs. This kind of base editor can be considered as an improved CRISPR gene editing technology, and they are also covered when referring to CRISPR gene editing in this article. In addition, those skilled in the art can also expect that DNA homologous recombination and site-specific cleavage with endonucleases (such as ZFN and TALEN) can be used to introduce gene changes. As long as the desired antigen epitope changes can be generated, the use of these and other gene modification technologies should also be covered by the protection scope of the present invention.

[0099] "Normal cells" in this article refer to non-tumor cells, especially non-tumor cells that are killed during CAR-T (or antibody-based drugs) treatment. Since CAR-T relies on its antigen-binding domain to recognize antigen epitopes on tumor cells and kill tumor cells, but these antigen epitopes are often also expressed or present on non-tumor cells, resulting in their being killed by CAR-T, causing the "on-target, off-tumor" problem. The killing of these normal cells leads to impairment of the subject's immune system or other functions. In medical practice, the above problems can be alleviated by supplementing the subject with these normal cells. Since these normal cells may also carry the antigen epitopes recognized by CAR-T, to prevent them from still being killed by CAR-T, the methods provided in this article can be used to modify these antigen epitopes to avoid CAR-T killing. Therefore, in terms of preventing CAR-T killing, these normal cells are mainly cells with modified antigen epitopes. These normal cells can be from the subject himself or from other donors. These normal cells can be differentiated or mature cells, or they can be stem cells, progenitor cells or precursor cells, such as hematopoietic stem cells (HSCs).

[0100] "Pharmaceutical composition" in this article refers to a pharmaceutical preparation containing at least one pharmaceutically active ingredient. Pharmaceutical preparations usually may also include other ingredients such as pharmaceutically acceptable excipients, buffers, etc. When the pharmaceutical composition includes at least two active ingredients, they usually coexist in the same pharmaceutical preparation. "Drug combination" in this article refers to at least two pharmaceutically active ingredients in a separate state, that is, present in different pharmaceutical preparations, but they are suitable for sequential or simultaneous administration to a subject to produce a therapeutic effect superior to that of the individual administration of the pharmaceutically active ingredients in the subject. This therapeutic effect can be reflected in the synergistic effect of the pharmaceutically active ingredients, or it can be that one pharmaceutically active ingredient weakens the side effects of another pharmaceutically active ingredient. The pharmaceutically active ingredients in the form of "drug combination" can be present in the same drug packaging box or separately in different drug packaging boxes.

[0101] By combining CAR-T (or antibody-based drugs) therapy with the infusion of normal cells (such as HSC transplantation), this article provides a new treatment strategy for tumors, especially hematological tumors (such as AML). Based on this strategy, by supplementing the subject with genetically modified normal cells (such as HSCs), the side effect of CAR-T killing non-tumor cells during tumor treatment can be overcome, enabling the design of CAR-T therapy to not have to select tumor-specific antigens (which are often difficult to find) as targets, but also be able to select tumor-associated antigens as targets.

[0102] The hematopoietic stem cells or progenitor cells provided in the present invention that are resistant to chimeric antigen receptor T cell killing may include a gene editing system for mutating the nucleotide sequence encoding a cell surface protein. The cell surface protein includes the cell surface protein targeted by CAR-T cells. Preferably, the antigen surface protein includes any one of a CD33 antibody recognition epitope, a CD19 antibody recognition epitope, or a BCMA antibody recognition epitope. As a preferred technical solution of the present invention, the genotype of the SNP (single nucleotide polymorphism site, rs12459419) in the second exon region (exon2) corresponding to the CD33 antibody recognition epitope site of the hematopoietic stem cells or progenitor cells is a mutated T genotype; and / or, the TTTCT site in the second exon region corresponding to the CD33 antibody recognition epitope site of the hematopoietic stem cells shows a mutation to AATCC. In the present invention, CD33 is used as the target antigen, and SNP and CD33 alternative splicing experiments are performed on commercialized AML cells. After confirming the effectiveness of the SNP site mutation, mutations that can effectively cause the CD33 V structure not to bind to the antibody are screened; after screening, it is found that there is an SNP site in CD33 exon2. After mutating the SNP from C to T, exon 2 is deleted, resulting in the non-expression of the CD33 V domain. However, after the mutation, there is also a risk that the CD33 C domain is affected; therefore, in further research of the present invention, it is unexpectedly found that introducing a new AATCC mutation site can not only block the expression of the CD33 V domain, but also does not affect the expression of the CD33 C domain. The obtained cells are not only resistant to the killing of Anti-CD33 CAR-T, but also do not affect the normal in vitro differentiation of the cells.

[0103] Therefore, mutating the SNP site and / or the TTTCT site in the second exon region of CD33 of hematopoietic stem cells, preferably mutating the TTTCT site, can effectively resist the killing of anti-CD33 CAR-T, and the cells can normally differentiate in vitro. Traditional gene knockout will cause the loss of gene function. Compared with directly knocking out genes, by means of gene editing and other means, mutating some genes can cause changes in the antigen epitope conformation, and without affecting the protein function, cause the failure of CAR-T or antibody drugs to target it, which has less impact on hematopoietic stem cells. Moreover, during the co-incubation process with CAR-T cells, the intracellular tolerance ability of the gene-mutated cells provided by the present invention is stronger and the survival rate is higher.

[0104] At the same time, the gene editing method and design idea provided in the present invention can also be extended to other target antigens, such as specifically expressed antigens in lymphoid and myeloid cells (B cells, T cells, NK cells, monocytes, granulocytes, etc.), greatly broadening the selection of tumor targets in cell immunotherapy. By combining hematopoietic stem cell transplantation and CAR-T cell therapy, a new treatment idea for tumor immunotherapy is provided.

[0105] For example, for antigens such as CD19 and BCMA, the present invention can edit the relevant antigens of hematopoietic stem cells through base editing or knockout-synergistic homologous recombination, screen out the mutation sites of antigens such as CD19 and BCMA respectively, and enable the differentiated B cells or plasma cells to be tolerant to the targeting of anti-CD19-CAR-T cells (or anti-CD19 antibodies) or anti-BCMA-CAR-T cells (or anti-BCMA antibodies), while having normal cell functions.

[0106] Preferably, the 3'ss site of the CD33 gene of the hematopoietic stem cells shows a mutation from AG to AA or CT.

[0107] Similarly, in the present invention, a gene editing method for mutating the nucleotide sequence encoding CD33 can be used to change the antibody recognition epitope of CD19 or the antibody recognition epitope of BCMA. The experimental methods or design ideas are similar to those of CD33, except that the sgRNAs used in the gene editing system are different. Accordingly, the targeted sites also change.

[0108] As a preferred technical solution of the present invention, the gene editing system includes a CRISPR gene editing system. The CRISPR gene editing system may include a Cas enzyme and an sgRNA (or their expression vectors). Among them, the sgRNA includes an sgRNA for mutating the CD33 antibody recognition epitope site, an sgRNA for mutating the CD19 antibody recognition epitope site, or an sgRNA for mutating the BCMA antibody recognition epitope site.

[0109] In the present invention, the sgRNAs for mutating the nucleotide sequence of the second exon region encoding CD33 include any one of the nucleotide sequences shown in SEQ ID NO: 10 (sg4), SEQ ID NO: 11 (sg4-14), SEQ ID NO: 12 (sg4-15), SEQ ID NO: 18 (sg3), or SEQ ID NO: 20 (sg10).

[0110] When using sg4 for gene mutation at SNP sites, there is a situation where sg4 is mismatched to the CD33 homologous sequence, resulting in off-target effects. Therefore, in the present invention, the 14th (sg4-14) or 15th (sg4-15) base on sg4 is further replaced to reduce the possibility of sg4 off-targeting to the CD33 homologous region. Both sg4-14 and sg4-15 can effectively mediate the mutation of SNP site C to T on CD33 exon2, and exon2 of the mutated cells is deleted; in the mutation groups mediated by sg3 and sg10, TTTCT on the CD33 region is mutated to AATCC, and in the CD33 homologous region, the sequencing peak is single and there is no difference from the group transfected with only cas9, indicating that sg3 and sg10 will not off-target to the CD33 homologous sequence to produce non-specific cleavage.

[0111] Preferably, the sgRNA is any one of SEQ ID NO: 11 (Sg4-14), SEQ ID NO: 12 (Sg4-15), or SEQ ID NO: 20 (Sg10).

[0112] Preferably, the sgRNA is SEQ ID NO: 20, and the TTTCT site in the second exon region corresponding to the CD33 epitope site of the prepared hematopoietic stem cells shows a mutation to AATCC.

[0113] In the present invention, corresponding sgRNAs are also designed for the antibody recognition epitope of CD19 or the antibody recognition epitope of BCMA to achieve gene mutation.

[0114] As a preferred technical solution of the present invention, the gene editing system further includes a repair template ssDNA.

[0115] Among them, the repair template ssDNA includes the nucleotide sequence shown in any one of SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 26.

[0116] The present invention also provides a method for preparing the hematopoietic stem cells or progenitor cells as described above. The method includes transferring the gene editing system into the hematopoietic stem cells or progenitor cells to be edited. Among them, the transfer method includes any one of transduction, transfection, or electroporation. For example, the method in the present invention can be: preparing an RNP complex of cas9 and sgRNA, incubating, then mixing the RNP complex with an optional repair template ssDNA, adding the suspension of hematopoietic stem cells to be edited, performing electroporation, and culturing with a medium after the electroporation to obtain gene-edited hematopoietic stem cells.

[0117] The present invention also provides the use of the hematopoietic stem cells or progenitor cells in the preparation of a medicament for treating tumors.

[0118] The present invention also provides the use of the combination of the hematopoietic stem cells or progenitor cells and CAR-T cells in the preparation of a medicament for treating tumors, the development of a medicament combining an antibody or antibody-like substance with a small molecule, and the development of an immunocyte therapy medicament expressing an antibody-like molecule or a CAR molecule.

[0119] In the present invention, the hematopoietic stem cells modified with the CD33 epitope in combination with Anti-CD33 CAR-T, the hematopoietic stem cells modified with the CD19 epitope in combination with Anti-CD19 CAR-T, and the hematopoietic stem cells modified with the BCMA epitope in combination with Anti-BCMA CAR-T are applied to the therapeutic research of tumor cell immunity, which is of great significance for alleviating the side effects of CAR-T products in tumor treatment and improving the quality of life of patients.

[0120] The present invention also provides a pharmaceutical composition, which comprises the hematopoietic stem cells or progenitor cells as described above. Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

[0121] The present invention also provides a treatment method, which comprises administering the above-mentioned pharmaceutical composition and CAR-T to a subject.

[0122] Wherein, the subject is an animal or a human being suffering from a tumor.

[0123] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0124] Based on the design concept of genetically editing and modifying the normal conformation of antigen epitopes, blocking the immune-related structures of the original surface proteins, avoiding their targeting by antibodies while still having normal biological functions, the present invention provides different designed sgRNAs to mutate the CD33 exon2 site of hematopoietic stem cells, resulting in the deletion of the exon2 site and thus the non-expression of the CD33 V domain, escaping the targeting and killing of anti-CD33 CAR-T cells, and solving the side effects caused by CAR-T cells during the killing of tumor cells. At the same time, in order to solve the problems of off-target and low efficiency faced by hematopoietic stem cells during the gene editing preparation process, the present invention further excludes sgRNAs that are prone to off-target and low efficiency. The prepared cells not only do not express the CD33 V domain, but also do not affect the expression of the CD33 C domain. When co-incubated with CAR-T cells, they have a higher survival rate, which is higher than that of cells after CD33 gene knockout. At the same time, the in vitro differentiation ability of HSCs obtained using the sgRNAs is not affected. The present invention is a feasible means based on extensive basic research, creating "tumor-specific" antigens by genetically editing and mutating hematopoietic stem cells for cellular immunotherapy, solving the "on-target, off-tumor" problem that CAR-T cells will also target healthy cells that normally express the target antigen in the patient's body while killing tumor cells, and providing a new treatment idea for tumor immunotherapy.

[0125] The technical solutions of the present invention will be further described below in conjunction with the accompanying drawings and through specific embodiments. However, the following examples are only simple examples of the present invention and do not represent or limit the scope of the protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

[0126] The materials used in the following examples are shown in Table 1 below, and the remaining materials not mentioned can be purchased from conventional manufacturers in the art.

[0127] Table 1 Some experimental materials used in the examples

[0128]

[0129] In the following examples, the experimental methods used are as follows. The remaining experimental methods not mentioned are all conventional experimental techniques and means known to those skilled in the art.

[0130] 1. Cell genotype identification

[0131] Collect about 1×10 5 cells, and extract genomic DNA using the PureLink TM Genomic DNA Mini Kit (for mutant cells, generally collect genomic DNA 72 hours after electroporation). Using genomic DNA as a template, use AmpliTaq GoldTM The 360 Master Mix PCR was used to amplify DNA fragments covering the target region. The PCR products were sequenced, and the base sequence maps were obtained by Sanger sequencing to compare the sequence genotypes.

[0132] 2. Identification of alternative splicing of CD33 exon2 at the mRNA level by RT-qPCR

[0133] Collect about 1×10 6 cells, extract cellular RNA using the PrimeScript TM RT reagent Kit, and reverse transcribe the RNA using the TB Premix DimerEraser TM kit to obtain cDNA. Using the cDNA as a template, probe primers (E13) spanning CD33 exon2 were designed to specifically amplify the sequence (m) with exon2 deletion; probe primers (E2) on exon2 were designed to specifically amplify the sequence (M) with normal exon2 expression, and the ct values of RT-qPCR were calculated and exported.

[0134] Finally, the alternative splicing degree of CD33 exon2 was reflected by the ct ratio of m / M. The higher the ratio, the higher the deletion expression of exon2 and the higher the occurrence of alternative splicing.

[0135] The common primers and probe primers used in the examples of this article are shown in detail in Table 2.

[0136] Table 2 Primers used in the examples

[0137] Primer Name Sequence (5' to 3') SEQ ID NO. CD33-F GAAGCTGCTTCCTCAGACATGC 1 CD33-R ATGGTTCTCTCCGTAGTCACAC 2 CD33-similar-F GAAGCCTCTGCCTCAGACATGC 3 CD33-similar-R ATGGTTCTCTCCGTGGTCACAC 4 CD33-VIC-E2 ACAGTTACAAATCTCCCCAG 5 CD33-FAM-E13 TGCTGCCCCTGCTGTGGGCAGACTTGAC 6 CD33-E2F TCTTTCGGATGGAGAGAGGA 7 CD33-E1F ACACAGGAAGCCCTGGAAG 8 CD33-E3R GAGCAGGTCAGGTTTTTGGA 9

[0138] 3. Flow cytometry staining

[0139] Collect about 1×10 5 cells, wash once with PBS + 2% fetal bovine serum buffer, and completely discard the supernatant. Add human FcR-blocker and incubate at 4°C in the dark for 10 minutes. After washing once, add flow antibodies, mix well and incubate at 4°C in the dark for 30 minutes. After washing once, add buffer (containing DAPI or 7-AAD) and perform detection on the machine.

[0140] 4. Electroporation

[0141] Use the LONZA electroporator and the electroporation procedures and electroporation kits recommended by the LONZA official website for each cell. The specific electroporation conditions for each cell are shown in Table 3.

[0142] Take 100 g of the required cells and centrifuge for 10 minutes. After centrifugation, completely remove the culture medium and resuspend with Lonza electroporation buffer. Meanwhile, prepare the RNP complex of cas9 and sgRNA and incubate at room temperature for 15 minutes. Subsequently, mix the ssDNA with the RNP complex, add it to the cell suspension, transfer it to a Lonza 16-well electroporation cup, and place it in the 4D-Nucleofector TM Unit X, and select the corresponding program for electroporation according to the cell type. After electroporation, carefully aspirate the cell suspension into a 48-well plate and continue culturing with complete 1640 medium or hematopoietic stem cell-specific medium.

[0143] Table 3 Electroporation conditions for various cells

[0144] Cell Type Electroporation Kit Electroporation Procedure Electroporation System Number of Cells K562 SF FF-120 20 μL 2e5 HL60 SF EN-138 20 μL 4e5 NB4 SF CZ-100 20 μL 4e5 THP1 SG FF-100 20 μL 2e5 KG1 SF FF-100 20 μL 2e5 Molm13 SF CA-137 20 μL 2e5

[0145] 5. Design of sgRNA for CD33 editable epitope sites

[0146] Through literature, find editable CD33 epitope sites. There is an SNP site in the second exon region of CD33. When the SNP is C, CD33 is normally expressed (denoted as M); when the SNP site is T, CD33 undergoes alternative splicing, and exon 2 is deleted and thus not expressed (denoted as m).

[0147] Download the hCD33 genomic sequence through the UCSC genome browser and design sgRNA through the CHOPCHOP website. Exclude sgRNA with high off-target and low efficiency. The finally selected sgRNA is shown in Table 4 below.

[0148] Table 4 sgRNA and ssDNA sequences

[0149]

[0150]

[0151]

[0152] 6. Preparation of CD33 CAR-T cells

[0153] Resuscitate cryopreserved healthy PBMC, add 20 μL / 10 7 of CD3 microbeads, and sort out CD3-positive T cells using an LS sorting column. Activate the T cells with CD3 / CD28 antibody beads on the day of sorting. After 24 - 48 hours of activation, perform virus transduction. The lentivirus packaged with the CAR molecule has an MOI of 3, add 800 ng / μL PolyBrene and 1 μg / μL DEAE for assisted infection. After 24 hours of infection, centrifuge at 300 g for 10 minutes to remove the virus, and replace it with fresh T medium.

[0154] Five days after T cells were infected with lentivirus, flow cytometry was used to detect the positive rate of CAR. The CD33-CAR molecule carries an EGFR tag, so the detection of EGFR antibody can reflect the positive rate of CAR.

[0155] 7. Co-incubate CD33-CAR-T cells with edited target cells to detect the mutation tolerance

[0156] After the electroporation editing of target cells is completed and CD33 CAR-T cells are prepared, the two types of cells are mixed evenly according to an effector-to-target ratio of 1:30 (taking 3×10⁶ target cells as an example, the number of CAR-positive effector cells should be 1×10⁵. If the CAR positivity in CAR-T cells is 10%, the number of CD33 CAR-T cells should be 1×10⁶, that is, the co-incubation system contains 3×10⁶ target cells and 1×10⁶ CD33 CAR-T cells).

[0157] Culture with T cell medium for 96 hours. During this period, detect the proportion of CD3-positive cells, which can reflect the changes in CAR-T cells. Correspondingly, the proportion of CD3-negative cells can reflect the changes in the proportion of mutant target cells.

[0158] During this period, synchronously detect the proportion changes of cells in mutant target cells that can bind CD33 P67.6 or HIM3-4 antibodies. If the cells that lose the binding to P67.6 but still bind to HIM3-4 can survive after mutation, it proves that the mutant cells can tolerate the killing of CD33 CAR-T.

[0159] Example 1 The SNP site genotype in the second exon of CD33 is related to the alternative splicing of this exon

[0160] To explore the feasibility of mutating SNP sites to modify the alternative splicing of CD33, in this example, five AML cell lines expressing CD33 (HL60, NB4, THP1, KG1, Molm13) and the CML cell line K562 were first selected as research objects.

[0161] (1) Collect the genomic DNA of each cell. Design amplification primer pairs upstream and downstream of CD33 exon2. Using gDNA as a template, perform PCR on the CD33 exon2 region. Sequence the PCR products by Sanger method. Open the sequencing files with SnapGene and align the SNP site (rs12459419) genotypes on CD33 exon2 of each cell line.

[0162] The results showed that the CD33 exon2 SNP genotypes among different AML / CML cell lines were not exactly the same ( Figure 1):The shaded part is the CD33 exon2 exon sequence, and the fourth base is the SNP site. The SNP site genotypes of K562 and HL60 are T, while NB4, KG1, THP-1, and Molm13 show the C genotype.

[0163] (2) Collect cell RNA, reverse transcribe it into cDNA, and use the primers CD33-F / CD33-R to detect the deletion of CD33 exon2 in different cell lines by RT-PCR at the mRNA level. The PCR band for exon2 deletion is 317bp (m), and the PCR band for the presence of exon2 is 698bp (M). When ensuring that the template amounts in each group are the same, the weaker the m band, the higher the degree of alternative splicing deletion of exon2.

[0164] The results showed that the CD33 exon2 of cells with the SNP site genotype of T (K562, HL60) was more likely to undergo alternative splicing and then deletion ( Figure 2 ):

[0165] In K562 and HL60 cells, the proportion of the m band was greater than that of the M band, indicating a higher deletion of CD33 exon2 in K562 and HL60 cells; in NB4 and THP1 cells, the m band and the M band were not significantly different in intensity, indicating that the alternative splicing of CD33 exon2 in NB4 and THP1 cells was lower than that in K562 and HL60 cells; in Molm13 and KG1 cells, the proportion of the M band was higher, indicating a lower degree of alternative splicing of CD33 exon2 in these two cells.

[0166] (3) To more precisely quantify the proportion of alternative splicing deletion of exon2, in this example, a probe spanning CD33 exon2 (CD33-FAM-E13) was further designed. The RT-qPCR primers CD33-E2F and CD33-E3R can specifically recognize the deletion of exon2 (denoted as m); the probe (CD33-VIC-E2) is on exon2, and the RT-qPCR primers CD33-E1F and CD33-E3R can specifically indicate the normal expression of exon2 (denoted as M), as Figure 3A shown.

[0167] Collect cell RNA, reverse transcribe it into cDNA, and detect the deletion of CD33 exon2 in different cell lines by RT-qPCR at the mRNA level. The higher the m / M ratio, the higher the degree of alternative splicing deletion of exon2.

[0168] The results showed that the CD33 exon2 of cells with the SNP site genotype of T (K562, HL60) was more likely to undergo alternative splicing and then deletion (Figure 3B )

[0169] Using Raji cells as a control, the ratio of CD33 exon2 m / M in each AML / CML cell line relative to Raji cells was statistically analyzed. In K562 and HL60 cells with the SNP genotype of T, the m / M ratio was more than 5 times that of the control group. The m / M ratios of THP-1 and NB4 cells with the SNP genotype of C were the second, and the m / M ratios of KG1 and Molm13 cells with the SNP genotype of C had no difference from the control group, and were even lower (<1-fold).

[0170] (4) Further verify the expression of CD33 exon2 protein level by flow cytometry.

[0171] Studies have shown that the antibody derived from the P67.6 clone can specifically bind to the V domain of CD33, so it can be used to indicate the expression of exon2 (M), and cells with variable splicing deletion of exon2 cannot bind P67.6. The antibody derived from the HIM3-4 clone can specifically recognize the C domain of CD33, and it can be normally bound regardless of whether exon2 is deleted (Total).

[0172] By collecting AML / CML live cells, co-staining with directly labeled antibodies of CD33-P67.6 and CD33-HIM3-4, detecting the expression of CD33 exon2 and total protein by flow cytometry, and statistically analyzing their mean fluorescence intensity (MFI), the variable splicing of CD33 exon2 was reflected by the ratio of Total / M MFI. The larger the ratio, the higher the deletion of CD33 exon2 on the side.

[0173] The flow cytometry results showed that the binding ability of the P67.6 antibody in K562 cells was significantly lower than that of other AML / CML cell lines, while the expression of Molm13 was the highest; and the Total / M MFI ratio of K562 cells was the highest, the deletion of CD33 exon2 was the highest, and the deletion of Molm13 exon2 was the lowest ( Figure 4A , Figure 4B )

[0174] The gray ones are the isotype controls of each flow antibody, and the binding ability to P67.6 can reflect the expression of CD33 M. It can be seen that the expression of CD33 exon2 without variable splicing:

[0175] K562 < HL60 < THP1 < NB4 / KG1 < Molm13.

[0176] The binding ability to HIM3-4 can reflect the expression of CD33 total protein:

[0177] K562 < HL60 < THP1 < NB4 < KG1 < Molm13.

[0178] Statistically analyze the ratio of CD33 Total / M MFI in each cell line:

[0179] K562 > HL60 > THP1 > KG1 > NB4 > Molm13;

[0180] It indicates that the deletion degree of CD33 exon2 in K562 cells is the highest, and the deletion of Molm13 exon2 is the lowest, which is basically consistent with the expression of CD33 exon2 detected at the mRNA level.

[0181] In this example, a method system for effectively identifying SNP site genotypes and alternative splicing phenotypes was initially established. Sanger sequencing can clearly indicate SNP site genotypes, and RT-PCR / RT-qPCR and P67.6 clone-derived flow antibodies can indicate the proportion of CD33 exon2 alternative splicing deletions, laying a methodological foundation for the next step of mutating CD33 exon2 SNP to change alternative splicing for proof of concept. The preliminary conclusion obtained in this example is that cells with the T genotype of SNP have a higher degree of alternative splicing, providing a basis for the next step of designing the mutation of SNP C to T to increase the skipping expression of CD33 exon2.

[0182] Example 2 Mutation of the 3'ss and SNP of CD33 exon2 can enhance its alternative splicing

[0183] (1) HL60, K562, and NB4 are more suitable cells for electroporation editing in AML / CML cells.

[0184] After initially exploring the CD33 exon2 SNP genotypes and exon2 expression levels of several AML / CML cells, in order to further perform mutation editing on the basis of each cell line, we initially explored the electroporation conditions suitable for each cell line using a plasmid with pmax-GFP.

[0185] Using a LONZA electroporator, 24 hours after electroporation, the cell viability was counted using a Countstar cell counter, and the GFP positive rate of the cells was detected by FACS flow cytometry.

[0186] The results showed that the cell viability of K562, HL60, and NB4 was better and the GFP positive rate was higher after electroporation, making them more suitable for subsequent electroporation editing ( Figure 5 , where Figure I is the GFP positive rate and Figure II is the cell viability):

[0187] The viability rates of K562 and HL60 cells were very high, above 95%, 24 hours after electroporation. Moreover, the positive rates of K562 and HL60 GFP were also above 95%, ranking the highest. The viability rate of NB4 cells was also very high, around 95%, 24 hours after electroporation, but its GFP positive rate was around 65%. The viability rate of KG1 cells after electroporation was around 60%, but its GFP positive rate was less than 40%, making it slightly more difficult to perform editing mutations on this cell in the later stage. The viability rates of THP1 and Molm13 cells after electroporation were only around 10%, and their GFP positive rates were also less than 10%, making them not suitable for later electroporation editing mutations.

[0188] (2) Mutations at the 3’ss site can induce the skipping expression of CD33 exon2 in HL60 and K562

[0189] Since the SNP site in K562 and HL60 cells is already of the T genotype, only by mutating its 3’ss site can alternative splicing be further increased.

[0190] In this example, the single-base cytosine editor A3A-CBE3 based on the CRISPR-Cas9 technology was used, and sgRNAs (sg8: SEQ ID NO: 13, sg13: SEQ ID NO: 16) that can mutate the G base at the 3’ss AG site were designed. The CBE plasmid and the sgRNA plasmid were electroporated into cells. By collecting the genomic DNA of cells on the 7th day after electroporation, the CD33 exon2 region was amplified by PCR using primers CD33-F / CD33-R. The PCR products were subjected to Sanger sequencing, and the sequencing files were opened with SnapGene to compare the mutation status of the G base at the 3’ss AG site of CD33 exon2.

[0191] The results showed that in K562 and HL60 cells, both sgRNA8 and sgRNA13 could effectively mutate the G base at the 3’ss site ( Figure 6A , Figure 6B ):

[0192] The shaded part is the CD33 exon2 exon sequence, and the first two bases AG before exon2 are the 3’ss site.

[0193] In K562 and HL60 cells, the cells electroporated with only CBE were used as the blank control group, and the 3’ss site was AG. Under the mediation of sgRNA8 or sg13, the base C on the complementary strand where sg8 and sg13 are located was directionally mutated to T by CBE, so the G base at the 3’ss AG site showed a mutation to the A base.

[0194] The inventors further adopted the method for identifying exon2 deletion by RT-qPCR in Example 2 to detect the effect of the 3'ss mutation on the alternative splicing of exon2.

[0195] The results showed that the 3'ss mutation could enhance the alternative splicing of exon2 in K562 and HL60 Figure 6C , Figure 6D ):

[0196] In K562 cells, the ratio of E13 / E2 in the sg8 group was higher than that in the sg13 group, and both sg8 and 13 in the editing group were higher than those in the blank control group, indicating that the alternative splicing of exon2 in the cells increased after editing. Moreover, the 3'ss mutation efficiency in the sg8 group was higher than that in the sg13 group, so the resulting exon2 deletion was also higher.

[0197] In HL60 cells, the ratios of E13 / E2 in the sg8 and sg13 groups were both higher than those in the blank control group, that is, the 3'ss mutation in HL60 cells would also lead to the skipping expression of CD33 exon2.

[0198] Example 3 SNP sites and 3'ss mutations mediated by Sg4 can effectively induce the deletion of CD33 exon2 in NB4

[0199] In this example, based on the CRISPR-Cas9 technology, Cas9 protein and sgRNA were used to form RNP, and an ssDNA repair template was provided. The SNP site on the ssDNA was T, and the 3'ss site was CT. The RNP and ssDNA were delivered into the cells by electroporation.

[0200] Using homologous recombination (HDR) during cell repair, near the sgRNA binding position on the CD33 exon2 of the cell genome, after cleavage by Cas9, part of it would be repaired using the ssDNA as a repair template, and then the SNP and 3'ss sites would be replaced from the original C, AG to T, CT.

[0201] (1) Sg4 can effectively mutate the SNP and 3'ss sites

[0202] Based on previous studies, cells with an SNP genotype of C had less alternative splicing, which was a better cell model for exploring SNP mutations to alter alternative splicing. Moreover, NB4 cells were superior to SNP C-type cells such as THP1 and KG1 in terms of electroporation viability and efficiency.

[0203] Therefore, in this example, sgRNAs and corresponding ssDNAs were designed for SNP sites on NB4 cells, including sg4: SEQ ID NO: 10 and its ssDNA: SEQ ID NO: 21, sg9: SEQ ID NO: 14 and its ssDNA: SEQ ID NO: 23, sg12: SEQ ID NO: 15 and its ssDNA: SEQ ID NO: 24. To simultaneously mutate the SNP and 3'ss sites, new combinations of ssDNA with the original sg4 (ssDNA: SEQ ID NO: 22) and combinations of ssDNA with sg9 (ssDNA: SEQ ID NO: 28) were designed, and the sgRNA (SEQ ID NO: 17) and ssDNA (SEQ ID NO: 25) of CD33-KO reported in the literature were used as controls. The SNP site and 3'ss site were mutated by electrotransferring RNP combined with ssDNA into cells.

[0204] The results showed that sg4 could efficiently induce CD33 SNP mutation and 3'ss mutation in NB4 cells simultaneously ( Figure 7 ):

[0205] Taking the group transfected with only cas9 protein as a control, there were no mutations at the SNP site and 3'ss site on CD33 exon2 in its genome (each sequencing site was a single peak graph). Taking the KO group reported in the literature as a positive control, due to the insertion mutation of T to TT in CD33 exon2, the transcription and translation of CD33 both had frameshift mutations, and then CD33 was knocked out.

[0206] In the electrotransfer group of RNP complex combined with ssDNA mutating the SNP site, sg4 could effectively mutate the SNP from C (blue peak) to T (red peak). In sg12, the wild-type C genotype (blue peak) and the SNP-mutated T genotype (red peak) accounted for about 50% respectively, while the mutation from C (blue peak) to T (red peak) in sg9 was the lowest.

[0207] In the electrotransfer group of RNP complex combined with ssDNA simultaneously mutating the SNP site and 3'ss site, sg4 could efficiently mutate the SNP from C (blue peak) to T (red peak), and at the same time mutate the 3'ss site from AG to CT. Since the PAM end of Sg12 was farther from the 3'ss than that of sg9, the mutation of the 3'ss mediated by Sg12 was not as good as that of sg9. Therefore, sg9 was selected to mediate the simultaneous mutation of the SNP and 3'ss sites in this example.

[0208] The results showed that the editing efficiency of sg9 combined with ssDNA with simultaneous mutations at the SNP and 3'ss sites was not high. In the sequencing peak map, there were basically no mutations at the SNP site, and the 3'ss site showed overlapping peaks of the AG wild type and the CT mutant, with a mutation efficiency of less than 20%.

[0209] (2) SNP and 3'ss mutations mediated by Sg4 can effectively mediate alternative splicing of CD33 exon2

[0210] Identification methods using RT-qPCR and FACS were used to detect the effects of SNP and 3'ss mutations on the expression of NB4 CD33 exon2.

[0211] The results showed that SNP sites and 3'ss mutations could effectively induce alternative splicing of CD33 exon2 in NB4:

[0212] The RT-qPCR results showed that the CD33 E13 / E2 ratio at the mutant SNP site (RNP-C) was higher than that in the non-mutated group, and the CD33 E13 / E2 was the highest at the simultaneous mutant SNP and 3'ss sites (RNP-C+ag), indicating that both SNP mutations and 3'ss mutations promoted alternative splicing of CD33 exon2 ( Figure 8A ).

[0213] Flow cytometry antibody staining results showed that about 60% of the cells after SNP mutation lost the ability to bind the P67.6 antibody, and about 80% of the NB4 with simultaneous SNP and 3'ss mutations did not bind the P67.6 antibody. This indicated that both SNP and 3'ss mutations could promote the deletion of CD33 exon2, and thus the V domain of CD33 was not expressed and did not have the ability to bind the P67.6 antibody ( Figure 8B ).

[0214] However, in this example, the strategy of mutating SNP and 3'ss aimed to not affect the expression of total CD33 protein, and only hoped to mutate several bases to affect the expression of the CD33 V domain to evade the killing of CAR-T targeting the CD33 V domain. The results showed that the cells after mutation had basically no difference from the completely knocked-out (KO group) in not binding the CD33 HIM-3-4 antibody, and only about 10% of the cells that did not bind P67.6 but still bound HIM3-4 after mutation, and the genotypes of these cells needed to be further identified.

[0215] Example 4 AATCC mutation leads to the deletion of CD33 exon2 without affecting the C domain

[0216] Although the strategy of mutating the SNP site or 3'ss site in the early stage can cause the non-expression of the CD33 V domain, the CD33 C domain (the binding ability of the HIM-3-4 antibody) is also affected. Therefore, the inventors sorted out NB4 cells that did not bind to P67.6 but still bound to HIM3-4 (PE+) after mutation by Tyto flow sorting, and used cells that did not bind to HIM3-4 as a control (PE-), as Figure 9 shown in Figure I in

[0217] to identify their genotypes in a relatively more homogeneous cell population after sorting. Figure 9 shown in Figure II in

[0218] In the sg4-mediated SNP mutant NB4 cells:

[0219] 4.85% of the sorted PE+ cell population mainly showed the wild-type C genotype at the SNP site, but instead showed a mutation from TTTCT to AATCC at the TTTCT site;

[0220] The PE- cells had a C to T mutation at the SNP site and also a large number of indels, mainly frameshift mutations caused by Cas9 protein cleavage.

[0221] In the NB4 cells with simultaneous mutation of SNP and 3'ss sites mediated by sg4:

[0222] 4% of the sorted PE+ cell population also mainly showed the wild-type genotype at the SNP and 3'ss sites. Similarly, at the TTTCT site, there was a peak set of mutations from TTTCT to AATCC; the PE- cells had C to T and AG to CT mutations at the SNP and 3'ss sites, and also had heterozygous peaks generated by frameshift mutations.

[0223] That is, whether it is mutating the SNP or simultaneously mutating the SNP and 3'ss sites, a small group of cells (about 10%) in which the CD33 V domain is destroyed and the C domain is not affected are actually mutations of AATCC.

[0224] Example 5 sg4 targeting SNP and 3'ss mutations has off-target effects, and the modified sg4-14\sg4-15 can greatly reduce the risk of off-target

[0225] Based on the discovery of the introduction of AATCC mutations in the previous strategy targeting SNPs and 3'ss mutations, the inventors compared the sequences of CD33 with the possible off-target positions (homologous sequences) of sgRNA on the genome to detect the possible existence of endogenous repair. That is, after the CD33 exon2 position was cleaved by Cas9 protein, part of it was repaired using the CD33 homologous sequence as a template, and then the original sequence would be replaced by the homologous sequence.

[0226] (1) Sequence alignment revealed that the introduction of AATCC mutations was indeed endogenous repair.

[0227] There is a sequence on human chromosome 19 that is highly similar to CD33 ( Figure 10A ). The introduction of AATCC mutations is actually after cleavage by Cas9 protein, and part of it is repaired using this homologous sequence as a template, resulting in the mutation of the original TTTCT to AATCC. And because the probability of endogenous template repair is lower than that of the ssDNA template provided artificially, in the previous mutation strategy, the SNP and 3'ss mutation genotypes were the main ones, and the AATCC mutation could only be detected by Sanger sequencing after the inventors sorted out this small group of cells.

[0228] (2) Compare the sequences of the targeted SNP and 3'ss sgRNAs to identify the possibility of off-target.

[0229] The results showed that among the sgRNAs used to mutate SNPs and 3'ss in the previous stage, except for sg4 having a difference with the CD33 similar sequence at the 18th base, other sgRNAs were completely matched with the CD33 homologous sequence, presenting a serious off-target risk.

[0230] In this example, to further verify whether sg4 would mismatch to the CD33 homologous sequence and cause off-target, only Cas9 protein and sg4 were transfected into NB4 cells. Primers were designed for the CD33 region and the homologous region respectively, and the PCR products were sequenced to detect the cleavage of Cas9 protein in the CD33 and homologous regions.

[0231] The results showed that frameshift mutations existed in both the CD33 region and the homologous region ( Figure 10B ):

[0232] In the CD33 region: In the case of only transfecting cas9 protein, no mutations occurred; in the case of transfecting Cas9 protein and sg4, a large number of frameshifts appeared in the CD33 exon2 region.

[0233] In the CD33 homologous region: when only Cas9 protein was transfected, no mutations occurred; when Cas9 protein and sg4 were transfected, a small number of frameshifts also appeared in the CD33 homologous region, proving that sg4 does indeed cause partial off-target effects, resulting in non-specific cleavage of Cas9 protein at the position of the CD33 similar sequence.

[0234] (3) Further, replace the 14th (sg4-14: SEQ ID NO: 11) or 15th (sg4-15: SEQ ID NO: 2) base on sg4 to reduce the possibility of sg4 off-targeting to the CD33 homologous region.

[0235] Similarly, form an RNP complex with sgRNA and Cas9, provide ssDNA for SNP C to T mutation, electro-transfect into NB4 cells, and perform PCR and Sanger sequencing on CD33 and CD33 homologous sequences to identify the efficiency and off-target possibility of the modified sg4-mediated SNP mutation.

[0236] The results showed that both sg4-14 and sg4-15 could effectively mediate the mutation of SNP site C to T on CD33 exon2, and the exon2 of the mutated cells was deleted and could not bind to the CD33 P67.6 antibody:

[0237] The SNP sites on CD33 exon2 mediated by Sg4-14 and sg4-15 showed a mixed peak of C and T, indicating that even if the 14th or 15th base of Sg4 was replaced, it could still normally bind to the CD33 region and mediate the mutation of the SNP site ( Figure 11A ).

[0238] In the CD33 homologous region, the sequenced indels were very low, indicating that the modified Sg4 rarely off-targeted to the CD33 homologous region.

[0239] The FACS results showed ( Figure 11B ) that in the sg4-14 mutation group, 60% of the cells did not bind to P67.6, and about 20% of the cells that did not bind to P67.6 normally bound to HIM3-4; in the sg4-15 mutation group, 50% of the cells did not bind to P67.6, and about 26% of the cells that did not bind to P67.6 normally bound to HIM3-4.

[0240] Therefore, although the previous strategies for SNP sites and 3'ss mutations, the sgRNAs nearby could not avoid off-target problems, but the modified sg4-14 and sg4-15 of Sg4 could still play the role of mutating the SNP site and promoting alternative splicing of CD33 exon2.

[0241] Example 6 AATCC mutations mediated by Sg3 and sg10 can efficiently induce the deletion of CD33 exon2 in NB4

[0242] In addition to promoting the skipping expression of exon2 by mutating the SNP site or 3'ss site from the perspective of upregulating alternative splicing, the AATCC mutation is a promising mutation site unexpectedly discovered by the inventors.

[0243] This mutation exists naturally, and previous results have shown that the mutated AATCC can not only block the antibody binding of the CD33 V domain but also does not affect the binding of the CD33 C domain, meaning that the AATCC mutation can evade the killing of CD33-CAR-T or GO drugs targeting the CD33 V region, and this mutation has little effect on the expression of the entire CD33 protein, minimizing the impact on the normal function of the CD33 protein.

[0244] The inventors designed sgRNAs (sg3: SEQ ID NO: 18, sg7: SEQ ID NO: 19, sg10: SEQ ID NO: 20) for the TTTCT site, and provided ssDNA containing the AATCC mutation (SEQ ID NO: 26) as the repair template for sg3 and sg7, and provided ssDNA containing the AATCC mutation (SEQ ID NO: 27) as the repair template for sg10. After 72 hours of electroporating NB4 cells, the CD33 exon2 region was amplified by PCR, and the mutation efficiency was detected by sequencing.

[0245] The results showed that sg3 and sg10 could effectively mediate the AATCC mutation. After the mutation, the cells did not bind to the CD33-P67.6 monoclonal antibody, and the binding ability of the CD33 C domain was basically unaffected, only showing partial knockout caused by indels ( Figure 12A ):

[0246] The genomic sanger sequencing results showed that in the mutation groups mediated by sg3 or sg10, TTTCT in the CD33 region was mutated to AATCC, and in the CD33 homologous region, the sequencing peak was single and there was no difference from the group transfected with only cas9, indicating that sg3 and sg10 did not cause off-target non-specific cleavage to the CD33 homologous sequence. There was almost no mutation at the TTTCT site for sg7, but partial overlapping peaks appeared in the CD33 homologous region, indicating that sg7 would partially mismatch to the CD33 homologous region and cause non-specific cleavage.

[0247] The FACS results showed ( Figure 12B) After the sg3 mutation, up to 73.2% of the cells do not bind P67.6 and normally bind HIM3-4. After the sg10 mutation, 62.2% of the cells do not bind P67.6 and normally bind HIM3-4. In the previous strategy, when the SNP was mutated by sg4-14 or sg4-15, only 20%-30% of the cells did not bind P67.6 and normally bind HIM3-4.

[0248] Example 7 sg10-mediated AATCC mutation is more resistant to the killing of Anti-CD33-CAR-T

[0249] Although the modified sg4 (sg4-14, sg4-15) can effectively mutate the SNP or 3'ss site and cause alternative splicing of CD33 exon2, and rarely off-target to the CD33 homologous region, only 20%-30% of them lose the V-region binding ability and do not affect the C-region binding.

[0250] In the case of the same non-off-target, sg10 can effectively mutate AATCC. After the mutation, the antibody binding ability of the V region of the cells is almost lost, and 60%-70% of the C regions are still not affected. Therefore, the inventors selected the AATCC mutation for the later killing tolerance experiment and the editing and differentiation of HSC.

[0251] To further explore whether the mutated cells can tolerate the killing of CD33-CAR-T, the inventors first prepared CAR-T cells targeting CD33. By infecting activated T cells with lentivirus containing the CAR molecule, CD33-CAR-T stably expressing CAR was obtained. The transduction efficiency of CAR was detected by flow cytometry 72 hours after infection.

[0252] The FACS results showed that CAR-positive cells accounted for 66.3% in the CAR-T cells ( Figure 13 ).

[0253] The inventors further designed a co-incubation experiment of NB4 cells after AATCC (sg3, sg10) or SNP mutation (sg4-14, sg4-5) with Anti-CD33-CAR-T. The effector-target ratio of CAR-positive cells in CD33-CAR-T cells to NB4 target cells was 1:30.

[0254] From the time of co-incubation of CD33-CAR-T cells and edited NB4 cells, CD3-positive cells were detected by flow cytometry, representing CAR-T cells; CD3-negative cells were used to represent target cells. At the same time, CD33 P67.6 and HIM-3-4 antibodies were stained by flow cytometry to verify whether the NB4 cells resistant to CAR-T killing were the mutated cell population.

[0255] The co-incubation results showed that the cells edited by sg10 could tolerate the killing of CD33-CAR-T:

[0256] The proportions of CAR-T and edited NB4 cells were detected at 0 hours of co-incubation. CD3-negative cells were NB4 cells, and CD3-positive cells were CD33-CAR-T cells. Calculated at an effector-to-target ratio of 1:30 for 66.3% CAR-positive CAR-T cells and edited NB4 cells, theoretically, the proportion of NB4 cells was 95.2%. Under the actual operation error, the FACS results showed that the initial proportion of NB4 target cells in each group was between 93.1% and 95.2%, which was an acceptable fluctuation ( Figure 14A ).

[0257] After 96 hours of co-incubation, the proportion of cells in the group transfected with only cas9 without editing gradually decreased from the initial 95.2% to 2.87% killed by CD33-CAR-T. The NB4 cells edited with sg4-15 were killed to 23.4%, the NB4 cells edited with sg4-14 were killed to 57.4%, the NB4 cells edited with sg3 were killed to 71.2%, while 94.6% of the NB4 cells edited with sg10 remained, which was higher than 90.7% of the NB4 cells with CD33 KO ( Figure 14B ).

[0258] The antibody-binding ability of the CD33 V region and C region of the mutant target cells was detected starting from 0 hours of co-incubation. The results showed that at 0 hours, 67.5% of the cells in the unmutated group could be recognized by the P67.6 antibody in the CD33 V region. 10.07% of the NB4 cells edited with sg4-15 could be recognized by the P67.6 antibody, 13.3% of the NB4 cells edited with sg4-14 could bind to the P67.6 antibody, 4.11% of the NB4 cells edited with sg3 could be recognized by the P67.6 antibody, 0.84% of the NB4 cells edited with sg10 could be recognized by the P67.6 antibody, and 4.49% of the NB4 cells with CD33 KO could be recognized by the P67.6 antibody ( Figure 14C ).

[0259] After 96 hours of incubation, the mutant target cell population resistant to CD33-CAR-T killing was detected. The results showed that NB4 cells that could bind to the CD33P67.6 antibody were all targeted and killed by CD33-CAR-T, and cells with normal antibody-binding ability in the C domain after mutation could tolerate killing ( Figure 14D ).

[0260] By detecting the proportion of mutant cells at 0 hours, 22 hours, 44 hours, 68 hours, and 96 hours after co-incubation, it was found that with the killing of CAR-T cells, the cells in the sg10 mutant group escaped the killing of CD33-CAR-T, while the cells in the sg3, sg4-14, and sg4-15 mutant groups still activated CD33-CAR-T cells, causing the killing and rapid proliferation of CAR-T cells, and then the target cells were killed until death or the proportion of target cells in the whole decreased. Figure 14E )

[0261] Example 8 Sg10-mediated AATCC mutation has no effect on the in vitro directed differentiation of HSC

[0262] Based on previous experiments, the present invention has verified in NB4 AML cells that the method of combining RNP complex with ssDNA electroporation can create site-directed mutations. Among them, the AATCC mutation mediated by sg10 can affect the binding ability of CD33 P67.6 antibody, and the edited NB4 cells are resistant to the killing of Anti-CD33 CAR-T.

[0263] Therefore, in this example, the mutation strategy was further applied to the editing of hematopoietic stem cells HSC to detect whether the RNP method can effectively induce AATCC mutations in HSC, and flow cytometry was used to detect whether the antibody binding ability of the CD33 V region of HSC after mutation was destroyed.

[0264] The results showed that Cas9 and sg10 formed an RNP complex and provided an ssDNA template containing AATCC mutations. After electroporation into HSC, partial AATCC mutations could also be induced in HSC Figure 15A ), and the antibody binding ability of the CD33 V region of the mutated cells was lost Figure 15B ):

[0265] At the TTTCT site, in the control group transfected with only cas9 protein, without sgRNA mediation, there was no cleavage of cas9 protein, and the TTTCT site sequencing showed a single peak Figure 15A )

[0266] When cas9 protein and sg10 were transfected and an AATCC repair template was provided, the TTTCT site showed a doublet peak of TTTCT wild type and AATCC mutant type, but the peak of AATCC after mutation was lower than the original TTTCT, so the mutation efficiency on HSC cells needs to be optimized.

[0267] Flow cytometry analysis showed that the CD33 V region of cells in the non-mutated group had normal antibody-binding ability (P67.6 positive), and the C region could still bind antibodies normally (HIM3-4 positive); after mutation, the C region of the cells was not affected (HIM3-4 positive), while the antibody-binding ability of the V region was disrupted (P67.6 negative), indicating that the structure of the V region of the mutated cells was altered, enabling them to evade the killing by CD33 CAR-T targeting the V region, and its C region was not affected ( Figure 15B ).

[0268] To further investigate whether the edited HSCs had normal differentiation ability, the inventors evaluated the ability of HSCs to differentiate into monocytes in vitro at the cellular level. By adding a medium that induces myeloid monocyte differentiation of HSCs in vitro, the proportion of CD14-positive cells was detected on days 1, 5, 9, and 14 of differentiation respectively.

[0269] The results showed that HSCs in the Sg10 editing group had normal in vitro myeloid monocyte differentiation ability:

[0270] Monocytes on day 14 after detecting non-mutated group (orange) and AATCC-mutated HSC cells (purple) with CD14-PE showed that both mutated group cells and non-mutated group cells could differentiate normally into monocytes under the action of the in vitro monocyte differentiation medium ( Figure 15C ).

[0271] Recording the proportion of CD14-positive cells on days 1, 5, 9, and 14 of differentiation, the results showed that the differentiation trend of the mutated cells (red) was basically the same as that of the unedited group (black), and at the end point of differentiation on day 14, the proportion of mutated HSCs differentiating into CD14 monocytes was even higher than that of the unedited group's CD14 monocyte differentiation ( Figure 15D ).

[0272] The applicant declares that the above description is only a specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and the disclosure scope of the present invention.

Claims

1. A cell having a cell surface protein, wherein the cell surface protein is modified to have an antigenic epitope change, and the antigenic epitope change enables the cell to resist killing by CAR-T or antibody drugs; wherein the cell surface protein is CD33, and one or any combination of the following characteristics exists in the CD33 gene of the cell: 1) The 3'ss site before the second exon sequence is AA or CT; and 2) The TTTCT within the second exon is replaced by AATCC; wherein the cell is a hematopoietic stem cell.

2. The cell according to claim 1, wherein at the rs12459419 site in the CD33 gene of the cell, the nucleotide is T.

3. Use of the cells of claims 1-2 in combination with CAR-T or antibody drugs in the preparation of an anti-tumor drug.

4. The use according to claim 3, wherein the tumor is a hematological tumor, preferably AML.

5. A method for preparing a cell, wherein the cell surface protein of the cell has an antigenic epitope change capable of resisting killing by CAR-T or antibody drugs, and the method comprises gene editing of the coding gene of the cell surface protein; wherein the cell surface protein is CD33, and one or any combination of the following characteristics exists in the CD33 gene of the cell: 1) The 3'ss site before the second exon sequence is AA or CT; and 2) The TTTCT within the second exon is replaced by AATCC; wherein the cell is a hematopoietic stem cell.

6. The method according to claim 5, wherein the gene editing is carried out by introducing a CRISPR gene editing system into the cell.

7. The method according to claim 6, wherein the crispr gene editing system that mutates the 3'ss site nucleotide AG before the second exon sequence to AA comprises an sgRNA with a target sequence of SEQ ID NO: 13 or 16.

8. The method according to claim 6, wherein the crispr gene editing system that mutates the nucleotide TTTCT within the second exon to AATCC comprises an sgRNA with a target sequence of SEQ ID NO: 18 or 20.

9. A pharmaceutical composition, comprising (i) a CAR-T or antibody drug, and (ii) a normal cell, wherein the CAR-T or antibody drug can target the cell surface protein of a tumor cell to kill the tumor cell, and the cell surface protein expressed by the normal cell is modified to have an antigenic epitope change, and the antigenic epitope change enables the normal cell to resist killing by the CAR-T or antibody drug; wherein the cell surface protein is CD33, and one or any combination of the following characteristics exists in the CD33 gene of the normal cell: 1) The 3'ss site before the second exon sequence is AA or CT; and 2) The TTTCT within the second exon is replaced by AATCC; wherein the normal cell is a hematopoietic stem cell.

10. The pharmaceutical composition according to claim 9, wherein the tumor cell is a hematological tumor cell, preferably an AML cell.

Images